ID: 901882998

View in Genome Browser
Species Human (GRCh38)
Location 1:12204916-12204938
Sequence TGTAATCTCAGTACTTCAGG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 412788
Summary {0: 7, 1: 223, 2: 4133, 3: 45828, 4: 362597}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
901882993_901882998 8 Left 901882993 1:12204885-12204907 CCTGGTCTGGCCAGGCAAGGTGG 0: 1
1: 1
2: 32
3: 245
4: 1078
Right 901882998 1:12204916-12204938 TGTAATCTCAGTACTTCAGGAGG 0: 7
1: 223
2: 4133
3: 45828
4: 362597
901882992_901882998 9 Left 901882992 1:12204884-12204906 CCCTGGTCTGGCCAGGCAAGGTG 0: 1
1: 1
2: 9
3: 82
4: 514
Right 901882998 1:12204916-12204938 TGTAATCTCAGTACTTCAGGAGG 0: 7
1: 223
2: 4133
3: 45828
4: 362597
901882995_901882998 -2 Left 901882995 1:12204895-12204917 CCAGGCAAGGTGGCTCATGCCTG 0: 325
1: 16621
2: 68129
3: 148017
4: 183383
Right 901882998 1:12204916-12204938 TGTAATCTCAGTACTTCAGGAGG 0: 7
1: 223
2: 4133
3: 45828
4: 362597

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
901882998 Original CRISPR TGTAATCTCAGTACTTCAGG AGG Intronic
Too many off-targets to display for this crispr