ID: 901884103

View in Genome Browser
Species Human (GRCh38)
Location 1:12210740-12210762
Sequence AAGTAGGGGTGGGGGGAAGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 932
Summary {0: 1, 1: 1, 2: 4, 3: 92, 4: 834}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
901884103_901884114 1 Left 901884103 1:12210740-12210762 CCCACTTCCCCCCACCCCTACTT 0: 1
1: 1
2: 4
3: 92
4: 834
Right 901884114 1:12210764-12210786 CTCCTGTCTTTCTCCCTCAGTGG 0: 1
1: 0
2: 5
3: 36
4: 387
901884103_901884118 17 Left 901884103 1:12210740-12210762 CCCACTTCCCCCCACCCCTACTT 0: 1
1: 1
2: 4
3: 92
4: 834
Right 901884118 1:12210780-12210802 TCAGTGGCACCTGCAGCTGTTGG 0: 1
1: 0
2: 3
3: 26
4: 265

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
901884103 Original CRISPR AAGTAGGGGTGGGGGGAAGT GGG (reversed) Intergenic
900255739 1:1697576-1697598 AAGTCTGGTTGGGGGGTAGTAGG - Intronic
900459295 1:2793914-2793936 AGGTAGGGGAGTGGGGAGGTGGG - Intronic
900471997 1:2859602-2859624 AAGGAGGGGTAGGAGGAAGAAGG + Intergenic
900850247 1:5137028-5137050 GAGTGGGGGAGTGGGGAAGTAGG - Intergenic
900850269 1:5137076-5137098 GAGTGGGGGAGCGGGGAAGTGGG - Intergenic
901006940 1:6176494-6176516 AGGTAGGGGTGGCAGGAAGCAGG - Intronic
901130995 1:6962573-6962595 AAGGAGGGGTGGGGCCAGGTGGG - Intronic
901842712 1:11964092-11964114 AACCAGGGATGGGGGGAGGTAGG - Intronic
901884103 1:12210740-12210762 AAGTAGGGGTGGGGGGAAGTGGG - Intergenic
902210523 1:14901367-14901389 GAGTAGGGGTGGTGGGAGGCAGG + Intronic
902611891 1:17602575-17602597 CAGCAGGGGTGGGGGAAAGAGGG + Intronic
902761789 1:18585894-18585916 GAGTGGGGGTGGGGGGAAGCTGG + Intergenic
903559003 1:24214100-24214122 AGGTTTGGGTGGGGGGAAGTGGG - Intergenic
903609239 1:24597966-24597988 TGGTGGGGGTGGGGGGAACTTGG + Intronic
904171806 1:28596685-28596707 GGGTAGTGGTGGGGGGAAGTGGG - Intronic
904831267 1:33307805-33307827 AGGTTGGGGTGGGGTGAGGTTGG - Intronic
904941448 1:34166831-34166853 AACTTGGGGTGGGGGGAGGGAGG - Intergenic
905116432 1:35645281-35645303 AGGTAGGGGAAGGGGGAAGGTGG + Intergenic
905264845 1:36744484-36744506 AGTTGGGGGTGGGTGGAAGTGGG + Intergenic
905542915 1:38774399-38774421 AAGTTGGGGTGTGGGGAGGGTGG - Intergenic
905739330 1:40355965-40355987 TAGTGGGGGTGGGGGAAAGTGGG - Intronic
906036253 1:42751870-42751892 CAGTGGGGGTGTGGGGACGTGGG - Intronic
906264567 1:44418252-44418274 AAGGAGGGATGGGAGGAGGTTGG + Intronic
907325901 1:53638532-53638554 CAGTGGGGTTGGGGGGCAGTGGG - Intronic
907512480 1:54972318-54972340 AGGTAGGGGTAGGGGGACCTTGG + Intergenic
908149543 1:61285660-61285682 AAATAGGGGTGGAGGGTAGGGGG + Intronic
908573357 1:65433160-65433182 GAGTAGGGGTGGGGGGCAGAGGG - Exonic
908800009 1:67870376-67870398 AAATACGGGTGGGGGGAGGGGGG - Intergenic
909059615 1:70865266-70865288 CAGTAGGGGTGTGGTGAAGTGGG + Intronic
909556130 1:76956511-76956533 AGCTAGGGGAGGAGGGAAGTTGG - Intronic
910328532 1:86040460-86040482 TTGTAGGGGTGGGGGGAGGGGGG - Intronic
911189519 1:94933648-94933670 AAGTAGGTGTGGAGGTAAGTTGG + Intergenic
911788990 1:101986863-101986885 GTGTAGGGGTTGGGGGATGTAGG + Intronic
911843796 1:102721510-102721532 AAAAGGTGGTGGGGGGAAGTGGG + Intergenic
912227824 1:107755384-107755406 ATGTGGGGGTGAGGGGAAGCTGG + Intronic
912385849 1:109270853-109270875 AAGTAGGGCTGCGGGCAGGTGGG - Intronic
912391666 1:109307153-109307175 AAGTAGGGGTTGGGGGAGAGAGG + Intergenic
912918508 1:113842216-113842238 AAGTAGGGGTGGGTGGGAGAAGG + Intronic
912974979 1:114321332-114321354 GAGTAGGGGTGGGGGAATGTGGG + Intergenic
913303789 1:117401513-117401535 AAGTAGGGCTGGGTGGAAAACGG + Intronic
914191912 1:145419221-145419243 AAGTAGGGAAGGAGAGAAGTAGG + Intergenic
914221501 1:145686238-145686260 CAGTGGGGGTGGGGGGCACTGGG - Intronic
914342416 1:146771362-146771384 AAGTAGAGTAGGGGGAAAGTGGG - Intergenic
914474064 1:148009107-148009129 CAGTGGGGGTGGGGGGCACTGGG - Intergenic
914866052 1:151430026-151430048 AAGTGGGGGTGGGGGGCAGGGGG + Intronic
914914754 1:151812723-151812745 AAGGTGGGGTTGTGGGAAGTGGG - Intronic
915461827 1:156075137-156075159 AAGCAGGACTGGGGGGAGGTGGG - Exonic
916108411 1:161447067-161447089 AAGGAGGGATGGGTGGAGGTAGG + Intergenic
916109998 1:161454447-161454469 AAGGAGGGATGGGTGGAGGTAGG + Intergenic
916111584 1:161461858-161461880 AAGGAGGGATGGGTGGAGGTAGG + Intergenic
916113170 1:161469238-161469260 AAGGAGGGATGGGTGGAGGTAGG + Intergenic
916412422 1:164559325-164559347 GAGTGGGGGTGGGGGGCAGCGGG + Intronic
917104278 1:171476736-171476758 CAGTAGGGGTTGAGAGAAGTAGG - Intergenic
917117254 1:171615034-171615056 AAATCAGGGTGGGGGGAAGAAGG + Intergenic
918264758 1:182831453-182831475 AAGTAGGGTTGGGGGGCAGTGGG + Intergenic
918354114 1:183689762-183689784 AAGTAGGGGTGGTGGGACAGAGG + Intronic
918412257 1:184272051-184272073 ATATAGGGGTGGGGGGAGGGGGG + Intergenic
918471388 1:184878917-184878939 GACCAGGGGTGAGGGGAAGTTGG + Intronic
918687868 1:187442224-187442246 CAGAAGGGGAGGGGGGGAGTTGG - Intergenic
918871963 1:189986382-189986404 GAGTAGGGGGAGGTGGAAGTGGG - Intergenic
919390111 1:196973450-196973472 AATGAGGGGTGGGGGAATGTGGG + Intergenic
919403987 1:197152801-197152823 GTGGAGGGGTGGGGGGAAGGCGG + Intergenic
919449064 1:197748266-197748288 AAGTAGGGGTGGGGGGGTGGGGG + Intronic
919750557 1:201034995-201035017 AAGTGGGAGGGAGGGGAAGTGGG - Intergenic
919780177 1:201216361-201216383 GAGTCGGGGTGGCGGGGAGTTGG + Intronic
919801454 1:201357151-201357173 AAGTAGGGGTGGGTGGGTGGGGG - Intergenic
920018187 1:202930691-202930713 CAGTGGGGGTTGGGGGAAGGTGG - Intergenic
920091311 1:203455183-203455205 AAGCAGGGGTGTGGTGAGGTGGG - Intergenic
920350868 1:205337075-205337097 AGATGGGGGTGGGGGGAGGTGGG + Exonic
920920606 1:210294547-210294569 GAGTGAGGGTGGGGGGAAGGAGG + Intergenic
922065986 1:222143760-222143782 TAGTGGGGGAGAGGGGAAGTGGG + Intergenic
922074540 1:222230434-222230456 TGGAAGGGGTGGGGGGAAGAAGG - Intergenic
922308655 1:224367297-224367319 AAGTAGGGTTTGGAGGAAGATGG + Intronic
922794943 1:228335301-228335323 GAGTGGGGGTGGGGGGATGGGGG + Intronic
922887645 1:229032134-229032156 ATGTAGGGGAGTGGGGGAGTAGG - Intergenic
922934263 1:229411445-229411467 ATGAAGGGGTGGGGGGGAGAAGG - Intergenic
922946780 1:229523170-229523192 AAGTAGGTGTGGGAGAAGGTGGG + Intronic
923073544 1:230588725-230588747 AAGTAGGTGTGCAGGTAAGTAGG + Intergenic
923437967 1:233986293-233986315 AACTTGGGGTGGAGAGAAGTTGG - Intronic
923482462 1:234397483-234397505 AAGAGGGGGAGGGGGGAAGGGGG + Intronic
923523308 1:234752803-234752825 ATGGAGGGGAGGTGGGAAGTAGG + Intergenic
923608171 1:235464417-235464439 AGGGAGGGGTGGAGGGAAGAAGG - Intronic
924633635 1:245764967-245764989 GAGTAGGGGTAGGGGGTATTGGG - Intronic
1062797929 10:358591-358613 AAGAAGGGGGGGTGGGAGGTGGG + Intronic
1063651802 10:7945590-7945612 CTGTAGGGGTGGGAGGAGGTAGG - Intronic
1063691380 10:8290650-8290672 AAGTAGGGGGCAGGAGAAGTGGG + Intergenic
1064075920 10:12268762-12268784 AAGTAGGGTGGGTGGGGAGTGGG - Intergenic
1064194614 10:13234685-13234707 AAGCATGGGTGGGGGCAAGGAGG + Intergenic
1064499545 10:15954733-15954755 AAATTGGTGTTGGGGGAAGTAGG + Intergenic
1064597727 10:16962444-16962466 TTGTAGGGGTGGGGGGTGGTAGG + Intronic
1064987248 10:21223181-21223203 TAGCAGGGATGGGGGAAAGTGGG - Intergenic
1065139318 10:22705087-22705109 AAGGACGGGGTGGGGGAAGTGGG + Intronic
1065585321 10:27211954-27211976 AAGTGGGGGTGGGGGTAGGAAGG + Intronic
1065673989 10:28154736-28154758 TAGTTGGGGTGGGGGGTGGTGGG + Intronic
1066198681 10:33126107-33126129 AAGTAGGGCACGGGCGAAGTCGG - Intergenic
1066402217 10:35087587-35087609 AAGAAGAGGTTGGGGGAAGCAGG - Intronic
1067914669 10:50384473-50384495 AAGCAGGGATGGAGGGAAGGAGG - Intronic
1067959684 10:50834236-50834258 AATTTGGGGTGTGGGGGAGTAGG - Intronic
1068154508 10:53180649-53180671 AAGCAGGAGAGGGGGAAAGTGGG - Intergenic
1068397455 10:56482301-56482323 GAGTTGGGGATGGGGGAAGTAGG + Intergenic
1069621659 10:69841060-69841082 AAGTGGGGCAGGGGGGCAGTGGG - Intronic
1069708301 10:70473138-70473160 AGCTAGGGGTGGGGAGACGTGGG - Intergenic
1069875730 10:71561856-71561878 AAGGAGGGGAGGAGGGAAGCAGG + Intronic
1070567643 10:77615727-77615749 AAGTAGGGTTGGAGGAAAATGGG - Intronic
1070794371 10:79208125-79208147 AGGTGGGGGTGGGGGGGGGTGGG + Intronic
1071304539 10:84286833-84286855 GAGTAGGGGTGGGAGGAAGGTGG + Intergenic
1071718987 10:88123769-88123791 AGCCAGGGGTGGCGGGAAGTGGG + Intergenic
1073100956 10:101006464-101006486 ACCTGGGGGTGGGAGGAAGTGGG - Exonic
1073210254 10:101795200-101795222 AAGTAGGGGGTAGGGGAAATTGG - Intronic
1073773230 10:106758395-106758417 AAGTAGGGCTTGGCAGAAGTTGG - Intronic
1074165575 10:110871679-110871701 AAGTCGGGGTGGGGGTATGTTGG - Intergenic
1076008318 10:126966013-126966035 AAGAAGGGTAGGGGGGAAGTGGG - Intronic
1076048003 10:127310266-127310288 CTGTAGGGGTGGGGGTAAGGGGG - Intronic
1076053346 10:127352232-127352254 GGGGAGGGGTGGGGAGAAGTGGG + Intronic
1076289398 10:129332694-129332716 AATTGGGGGTGGGGGGAAGAGGG + Intergenic
1076978548 11:193185-193207 ATTCAGGGGTGGGGGGGAGTGGG + Intronic
1077852039 11:6082446-6082468 ATGTGGGGTTGGGGGGAAGGTGG + Intergenic
1078095396 11:8293317-8293339 AGGCAGGGGTGGGGAGAACTGGG - Intergenic
1078438059 11:11341782-11341804 AAGAAGGAGTTGGGGGCAGTGGG - Intronic
1079126105 11:17719636-17719658 AGGGAGGGGTGGGGGACAGTGGG + Exonic
1079183139 11:18211537-18211559 AACCCAGGGTGGGGGGAAGTGGG - Intronic
1079394602 11:20050885-20050907 AGTTAGGGGTGCAGGGAAGTGGG + Intronic
1079408041 11:20162513-20162535 AAAAAGGGGTGGGGGGCAGAGGG - Intergenic
1079885987 11:25989540-25989562 GTTTTGGGGTGGGGGGAAGTGGG + Intergenic
1080020471 11:27554395-27554417 AAGTTGGGATGGGGGTATGTGGG - Intergenic
1081512019 11:43784453-43784475 AGGTGGGGGTGGGGGGCAGCAGG + Intronic
1081699212 11:45142246-45142268 AAGCAGATGTGGGGAGAAGTGGG - Intronic
1082103264 11:48192109-48192131 AAGTGGGGGTGGGGGGACAGGGG - Intergenic
1082731929 11:56808854-56808876 AAGTAGGGGTGGGGATAAAAAGG + Intergenic
1082802516 11:57425339-57425361 AAGTGGGGCTGTGGTGAAGTGGG + Intronic
1083261181 11:61523955-61523977 CAGGAGGGGTGTGGGGAACTAGG + Intronic
1083812657 11:65114409-65114431 ACACAGGGGTGGGGGAAAGTAGG + Intronic
1084014242 11:66369281-66369303 CAGTAGGGCTGGGGGGCAGGGGG + Intronic
1084469878 11:69353377-69353399 CTGTAGGGGTGGGTGGGAGTGGG - Intronic
1084553768 11:69864145-69864167 AAGGAGGGGTGGGGGAAAGAAGG - Intergenic
1084704180 11:70806371-70806393 AAGTAGGGTTGGAGGGAAGTTGG - Intronic
1084949727 11:72657967-72657989 GAGGAGGGGTGGAGGGAAGAGGG + Intronic
1085053852 11:73392997-73393019 GAGTAGTGGTGTGGGGAAGAAGG - Intronic
1085134683 11:74075367-74075389 GGGGGGGGGTGGGGGGAAGTAGG + Intronic
1085198484 11:74686869-74686891 TAGTAGGGGTGTGGAGAAGTGGG + Intergenic
1085249121 11:75130259-75130281 AAATTGGGGTGGGGGGAGGGGGG + Intronic
1085365826 11:75943172-75943194 AAGTGGGGGTGGGAGGGTGTAGG - Intronic
1086700801 11:89898575-89898597 AAGTTGGTGTGGTGGGAAGTTGG - Intergenic
1086705368 11:89945952-89945974 AAGTTGGTGTGGTGGGAAGTTGG + Intergenic
1087012803 11:93529596-93529618 AATGAGGGCTCGGGGGAAGTGGG - Intronic
1087513027 11:99122128-99122150 AAGTGGAGTTGGGGGGAGGTTGG - Intronic
1087673786 11:101135647-101135669 AAGTATCCGTGGGGGGAAGGGGG - Intergenic
1087857470 11:103109549-103109571 TGGAAGGGGTGGAGGGAAGTTGG - Intronic
1087935947 11:104035056-104035078 AAGTGGGGGTGGGGGAGAGTAGG + Intronic
1088121873 11:106379518-106379540 AAGTGGGAGTGGGGGGAAGGGGG - Intergenic
1089030710 11:115325358-115325380 AAGAAGTGGTGGGGGGCAGCAGG + Intronic
1089166258 11:116479063-116479085 AGCTAGGGGTGGGGGGATGGGGG - Intergenic
1089307511 11:117535892-117535914 AACTAGGGGTGGGGGGTGGGGGG + Intronic
1089445031 11:118545200-118545222 AAAAAAGGGTGGGTGGAAGTAGG - Intronic
1089706768 11:120283725-120283747 AGGTAGTGGAGGGGGTAAGTTGG - Intronic
1089884250 11:121803871-121803893 AAGTGGGGGGGGGGGGGGGTGGG + Intergenic
1089923408 11:122231708-122231730 AAGTAGTGGCGAGGGGAAGAGGG - Intergenic
1090601059 11:128371710-128371732 AAGTAGAGGTTGGGGGAAGTGGG + Intergenic
1090796084 11:130136600-130136622 AATTAGGGGTGGGGGGATGGAGG + Intronic
1091086187 11:132724165-132724187 AAGAAGGGGTGGTGGGAGGTGGG - Intronic
1091135053 11:133180854-133180876 AAGTGGGGATGAGGGAAAGTAGG + Intronic
1091346076 11:134855095-134855117 AAGGTGGGGTGGGGGGATGTTGG + Intergenic
1091387425 12:103746-103768 AGGCAGGGCTGGGGGGAGGTGGG + Intronic
1091422992 12:359749-359771 AAAAAAGGGTGGGGGGGAGTGGG + Intronic
1091621432 12:2092210-2092232 ATGTAGGGGCTGGGGGAAGGAGG - Intronic
1091804281 12:3344722-3344744 GAATGGTGGTGGGGGGAAGTGGG + Intergenic
1092096637 12:5848352-5848374 AACTGGGGAGGGGGGGAAGTAGG - Intronic
1092255952 12:6927121-6927143 AATTGGGGGTGGGGGGATGAAGG - Intronic
1093132348 12:15407348-15407370 AATTGGGGGTGGGGGGAACCTGG - Intronic
1093599391 12:21002948-21002970 CGGCAGGGGTGGGGGCAAGTTGG - Intergenic
1093782809 12:23156254-23156276 TTGTGGGGGTGGGGGGAAGGGGG - Intergenic
1094006136 12:25753819-25753841 AAGTAGGGGTTGGAGGCATTAGG - Intergenic
1094204232 12:27823853-27823875 AAGTAGGGGAGGGGTGCAGCGGG - Intergenic
1094458954 12:30672411-30672433 AAGTAGGGGTGATGGGAGATGGG + Intronic
1094566208 12:31600453-31600475 AGGCAGGGGAGGGGTGAAGTGGG + Intergenic
1095170112 12:39024571-39024593 AGTATGGGGTGGGGGGAAGTGGG + Intergenic
1095443557 12:42261723-42261745 GAGAAGGGGTGGGGGGAGGGGGG - Intronic
1096291127 12:50344262-50344284 TAGTAGGGGAGAGAGGAAGTGGG - Intronic
1096598260 12:52711461-52711483 AAGTAGGGGTGGGAGAAATGGGG - Intergenic
1096625488 12:52892880-52892902 AAGGCAGGGTGGAGGGAAGTGGG + Intergenic
1096816893 12:54207469-54207491 CAGTGGAGGTGGGGGGAAGCAGG + Intergenic
1097020320 12:56016213-56016235 AGGTAGGGGTGGGGGTGAGGGGG - Intronic
1097327141 12:58289534-58289556 AAGAAGGGCTGGGAGGCAGTAGG + Intergenic
1097583835 12:61491465-61491487 AAGAAATGGTGTGGGGAAGTGGG + Intergenic
1097693615 12:62756695-62756717 AAGTAGGGGAGGGGAAAAGAAGG + Intronic
1098926458 12:76356153-76356175 ATGTAGGGGTGGGGGGGGGCGGG + Intronic
1098967995 12:76814272-76814294 AAGTAGTAGTGGGGGAAAGATGG + Intronic
1099438165 12:82668325-82668347 AAGAGGTGGTGGGGGGAAGGAGG - Intergenic
1100141060 12:91619384-91619406 AAGTAGGGTTGGAGGGTTGTGGG + Intergenic
1100470478 12:94888400-94888422 GAGAAGGGGTGGAGGTAAGTGGG - Intergenic
1100500461 12:95169132-95169154 AATTAGGGGTGGAGGGTATTGGG + Intronic
1100512256 12:95286983-95287005 AAGTGGGGGTGGGGTGGGGTAGG + Intronic
1100879857 12:99004613-99004635 AAGGTGGGGTGCGGGGAAGGAGG + Intronic
1101065501 12:101016335-101016357 AAGGTGGGGCAGGGGGAAGTGGG + Intronic
1101761324 12:107661193-107661215 AGGTGGGGGTGGAGGGAGGTGGG - Intergenic
1101881555 12:108629295-108629317 AACTGGGGGTGGGGGGTTGTTGG + Intronic
1101901099 12:108791851-108791873 CATCAGGGGTGTGGGGAAGTGGG + Intronic
1102392758 12:112562904-112562926 CAGTAGGGATAGGGAGAAGTGGG - Intergenic
1102699189 12:114824254-114824276 AAGTGGCGGTAGGGGGAAGCTGG + Intergenic
1103086344 12:118063662-118063684 AAGATGTGGTGGGGGGAGGTTGG - Exonic
1103140671 12:118545443-118545465 AATTGGGGGTGGGGGGAGGGGGG - Intergenic
1103216667 12:119207130-119207152 AGGGAGGGGTGGGGGAAGGTAGG - Intronic
1103425472 12:120830318-120830340 AGGGAGGGGTGGGGGGGAGGTGG + Intronic
1103499227 12:121388045-121388067 AGGTGAGGGTGGTGGGAAGTAGG + Intronic
1104101665 12:125618305-125618327 AAGTAGGGCTGGGTGGAGGAAGG + Intronic
1104420671 12:128631987-128632009 GAGTGGGGATGGGGGGAAGGGGG + Intronic
1104678103 12:130729444-130729466 GAGGAGGGGTGGGGGAAGGTGGG - Intergenic
1104691133 12:130827123-130827145 AGGGAGGGGTGGGGGGAGGGAGG + Intronic
1104731754 12:131108989-131109011 AGGTGGGGATGGGGGGAGGTGGG + Intronic
1106312763 13:28568201-28568223 GAGCAGGGGTGGGGTGGAGTTGG - Intergenic
1106434093 13:29708517-29708539 AGGTAGGCGTGGGGGGGAGCAGG - Intergenic
1107250052 13:38349534-38349556 AAGTAAGGGTATGGGGTAGTCGG - Intergenic
1107628174 13:42312592-42312614 AGGTATGGGTGAGGGGATGTTGG - Intronic
1107839071 13:44436972-44436994 AGGTGGGGGTGGGGGGAGGCGGG - Intronic
1108007225 13:45961540-45961562 TAGTGGGGGTGGGGAGATGTGGG + Intronic
1108007232 13:45961556-45961578 ATGTGGGGGTGGGGAGATGTGGG + Intronic
1108404001 13:50081677-50081699 AAGTAGGGTTAGGGGCAACTTGG - Intergenic
1108515290 13:51195806-51195828 CAGTAGGGGTGGGTGGGAGCAGG + Intergenic
1108676340 13:52740154-52740176 GGGTGGGGGTGGGGGGAAGATGG + Intergenic
1108703530 13:52964307-52964329 AAGGAGGGGTTGGGGGAAATGGG + Intergenic
1109143370 13:58745306-58745328 CAGTGAGGGTGGGGGAAAGTAGG + Intergenic
1109462410 13:62678972-62678994 AAGCAGGGATGGGGTGAAGGTGG + Intergenic
1109737765 13:66509120-66509142 TAGTTGGGCTGAGGGGAAGTTGG - Intronic
1110195530 13:72783922-72783944 AAGGAGGGTTGGGGAGATGTTGG + Intronic
1110229474 13:73153368-73153390 AAGGAGGGAGGGAGGGAAGTAGG - Intergenic
1111823049 13:93236376-93236398 AAGTAGGGAGGGTGGGAAGAGGG - Intronic
1112035707 13:95494903-95494925 GAGTAGGGGTGGAGGGGAGAAGG - Intronic
1112548773 13:100399859-100399881 AGGTAGTGGGGGGAGGAAGTAGG - Intronic
1113361966 13:109640034-109640056 AAAAAAGGGTGGGGGGAAGGGGG + Intergenic
1113366215 13:109678466-109678488 AAGTTAGGGATGGGGGAAGTGGG + Intergenic
1113699753 13:112375745-112375767 AAGAAGGTGTGGGGGAAAGGAGG + Intergenic
1114114523 14:19508084-19508106 AATAAGAGGTGGGGGGAAGGGGG - Intergenic
1114473036 14:22976904-22976926 AAGCAGAGGAGAGGGGAAGTTGG - Intronic
1114490019 14:23094696-23094718 AAGGAGGGGGTGGGGGAAGGAGG + Intronic
1114559347 14:23579077-23579099 AAGCAGGGGAGGAGGGAAGAAGG + Intergenic
1115091714 14:29584932-29584954 AATTTGGGGTGGAGAGAAGTCGG - Intronic
1115658638 14:35468093-35468115 CAGTGGGGGTGGGGGGGAGTGGG + Intergenic
1115784366 14:36807508-36807530 AAGTGTGGGTGGGGGGATATTGG - Intronic
1116923539 14:50608310-50608332 AGGGAGGGGTGGGGGACAGTAGG + Intronic
1117072024 14:52066281-52066303 TAGTAGGGGTCAGGGGAAGGTGG + Intronic
1117091817 14:52258714-52258736 GAGTGGGGGTGGGGGGCAATTGG + Intergenic
1117110946 14:52453894-52453916 ATGGTGGGGAGGGGGGAAGTAGG + Intronic
1117545450 14:56791240-56791262 AAGAAGGGGCAGGGGAAAGTGGG - Intergenic
1117756148 14:58976120-58976142 AAGTAGGAGTGAGGAGAAGCTGG + Intergenic
1117826102 14:59705240-59705262 AAGTTGGGGTAGGGGGTAGAGGG - Intronic
1117875291 14:60245763-60245785 ATGTAGGGGAGGGAGGAAGGAGG + Exonic
1118039066 14:61898238-61898260 AGGTAGGAGTGGGGGGAGGTGGG - Intergenic
1118597789 14:67449459-67449481 AAGGCAGGGTGTGGGGAAGTGGG + Intronic
1118994329 14:70822678-70822700 AAGTGGGGGTGAAGGGAAGGAGG - Intergenic
1119420042 14:74503059-74503081 AAGTAGGGCAGGGGAGAGGTGGG - Intronic
1119931945 14:78556190-78556212 GAGTAGGGGTGGGGGAAGCTGGG - Intronic
1120017537 14:79490675-79490697 AAGTGGGGGTTGGGGGAGGTGGG + Intronic
1120042228 14:79767202-79767224 CAGTAGGGCTGGGAGGAAGAAGG - Intronic
1120120353 14:80671867-80671889 ATGGGGGGGTGGGGGGTAGTGGG + Intronic
1120191450 14:81443775-81443797 TAGCAGGGGTGGGGGAAAGGGGG - Intergenic
1121183652 14:91947981-91948003 AAGAAGGGGTGGGGAGCAGCGGG + Intronic
1121493727 14:94378020-94378042 AACTCTGGGTGGGGGGGAGTGGG + Exonic
1121643079 14:95499380-95499402 AAGTAGAGGAGGTGGGAAGTAGG - Intergenic
1122419238 14:101564824-101564846 AGGTAGGGGTTGGTGGTAGTGGG - Intergenic
1122721880 14:103726859-103726881 GAGTGGGGGTGGTGGGAAGAGGG + Intronic
1122889178 14:104724662-104724684 GAGTAGGGGTGGGTGGAAGGAGG - Intronic
1123044195 14:105503395-105503417 AAGTGGGGGTGCGGTCAAGTTGG + Intergenic
1123062156 14:105599284-105599306 AAGGGGCGGTGGGGGGCAGTAGG + Intergenic
1123086901 14:105721012-105721034 AAGGGGCGGTGGGGGGCAGTAGG + Intergenic
1123097487 14:105773385-105773407 AAGCAGGGCTGGTGGGAAGCAGG - Intergenic
1123905311 15:24914913-24914935 AAGCAGGGTTGGGGTGTAGTGGG + Intronic
1124139364 15:27063883-27063905 GAGAAGGGGTGTGGGGAAGTGGG - Intronic
1124612255 15:31216292-31216314 AAGGAGGGGTGCGGGAAAGGAGG + Intergenic
1124938496 15:34195430-34195452 AGGTAGGGGTGGGAGAAAGGTGG + Intronic
1125517804 15:40332506-40332528 CAGAAGGGCTGTGGGGAAGTAGG - Intronic
1126379501 15:48031375-48031397 AAGAAGGAGTGAGGGGAAGTGGG + Intergenic
1126914250 15:53448049-53448071 AAGGGGGGGTGGGGGGATGGGGG - Intergenic
1126953173 15:53905611-53905633 GACTGGGGGTTGGGGGAAGTGGG + Intergenic
1127221743 15:56887409-56887431 AGGCAGGGGTGGCGGGAAGTGGG + Intronic
1127320000 15:57834690-57834712 GAGTGGGGGCGGGGGGAAGCTGG + Intergenic
1127362728 15:58259316-58259338 AAGTGGGGGTGGGGAGGGGTAGG + Intronic
1127374325 15:58369185-58369207 AAGGAGGCGTGGAGAGAAGTGGG - Intronic
1127711102 15:61598946-61598968 GAGAAGGGGTGGGGGGAAGACGG + Intergenic
1128729816 15:70013637-70013659 AGGTAGGGGTGGGGTGGAGAGGG + Intergenic
1129220186 15:74127985-74128007 AAGTAGGGGTGGGGGAGGGGAGG - Exonic
1129331985 15:74832452-74832474 AGGCAGGGGTGGTGGGCAGTGGG + Intergenic
1130382238 15:83380460-83380482 AGGTAGGGGTTGGGGCAAGAGGG + Intergenic
1130862304 15:87901755-87901777 AAGTTGGGGAGGGGGGGAGAGGG + Intronic
1132582765 16:693158-693180 AAGCTGGGGAGGGGTGAAGTGGG + Exonic
1133691852 16:8223301-8223323 AAGAAGGGGTTGGGGGACGGGGG - Intergenic
1133866867 16:9652215-9652237 AAATTGGGGCGGGGGGAAGGTGG + Intergenic
1133966472 16:10535702-10535724 AACTTGGGGTGGGGGGACTTGGG - Intronic
1134107427 16:11494317-11494339 GAGTGGGGGTGGGGTGAAGGGGG - Intronic
1134780292 16:16889214-16889236 TAGTTGGGGTGGTGGGAGGTGGG + Intergenic
1134981561 16:18614402-18614424 AAGGGGGGGTGGGGGGAATGCGG + Intergenic
1135134634 16:19878640-19878662 AGGTAGGGGTTGGGGGAAGAGGG - Intronic
1136067353 16:27768083-27768105 AGGTGGGGGTGGGGGGGAATGGG + Intronic
1136107219 16:28038499-28038521 GAGCTGGGGTGGAGGGAAGTGGG + Intronic
1136174747 16:28508862-28508884 AAGAAAGGGTAGGGGGCAGTTGG + Intronic
1136399434 16:30009841-30009863 AGGTAGGGGAGGAGGGCAGTGGG - Intronic
1136636790 16:31529369-31529391 AGCTTGGGGTGGGGGGAAGGCGG - Intergenic
1137235662 16:46615335-46615357 ATGTAGGGGTGGGGGGAGATAGG + Intronic
1137634199 16:49971434-49971456 AAAAAAGGGTGGGGGGAAATGGG + Intergenic
1137675644 16:50302549-50302571 AGGGTGGGGTGGGGGGAAGGTGG - Intronic
1137693135 16:50442865-50442887 GTGGGGGGGTGGGGGGAAGTGGG + Intergenic
1137961352 16:52884902-52884924 ATGTAGAGGTGGGGTAAAGTTGG + Intergenic
1138131764 16:54485875-54485897 AGGTAGGAGTGGGTGCAAGTGGG + Intergenic
1138392932 16:56683320-56683342 AAGGAGGGGTTTGGGGAAGCTGG - Intronic
1138696347 16:58817086-58817108 ATGTAGGGGAGGGGGGAGGAGGG - Intergenic
1139278287 16:65748395-65748417 GAGGAGGGGTGAGGGGAGGTGGG - Intergenic
1139413947 16:66790447-66790469 AAGGAAGGGAGGGGGGAAGGAGG + Intronic
1139613950 16:68077891-68077913 TGGTGGGGGTGGGGGGGAGTGGG - Intronic
1139620116 16:68132870-68132892 AAGTAAGGATGGGGAGAAGTTGG + Intronic
1139991858 16:70946058-70946080 AAGTAGAGTAGGGGGAAAGTGGG + Intronic
1140269910 16:73456341-73456363 AAGGAAGGGAGGGGGAAAGTGGG - Intergenic
1140571309 16:76109330-76109352 ACTGAGGGGTTGGGGGAAGTGGG + Intergenic
1140659784 16:77177453-77177475 AAGTTGAGGTGAGGGGTAGTTGG - Intergenic
1140857810 16:78993258-78993280 ATTTGGGGGTGGGGGGAGGTTGG + Intronic
1141210172 16:81972379-81972401 AAGTGGGGGGAGGGGGAAGAAGG - Intergenic
1141857450 16:86693449-86693471 AGGAAAGGGTGGGGGGAAGCGGG - Intergenic
1142232173 16:88905125-88905147 AAGGAGGGGGGTGGGGGAGTGGG + Intronic
1142361124 16:89627590-89627612 AAGGAGGGGAGGGGAGAAGAGGG + Intronic
1142708894 17:1712978-1713000 AAGTAGGGGAGGTGGGTTGTGGG - Intergenic
1143374974 17:6462012-6462034 GAGTAGGGGTGGAGGGAAAGAGG - Intronic
1143882017 17:10036955-10036977 ACTTAGGGTTGGGAGGAAGTTGG - Intronic
1144081897 17:11770515-11770537 AAGGGCGGGTGGGGGGAAGCCGG - Intronic
1144440655 17:15278343-15278365 AAGGTGGGGTGGGGGGCAGGCGG - Intergenic
1144572376 17:16407832-16407854 AGGTGGGGGTGAGGGGTAGTGGG + Intergenic
1144793801 17:17877567-17877589 AAGAAGGGGTGGGAAGATGTCGG + Intronic
1145903216 17:28501248-28501270 AAGAAGGGGTGGGGAGATCTGGG - Intronic
1146086333 17:29833714-29833736 AAGTAGGGAGGGAGGGAAGGAGG - Intronic
1146667514 17:34714977-34714999 AAGAATGGGTAGGGGGAACTGGG + Intergenic
1146688421 17:34856894-34856916 AAGATGGGGTGGGGGGAGGATGG + Intergenic
1146763254 17:35496498-35496520 ACGGTGGGGAGGGGGGAAGTCGG - Intronic
1147306692 17:39569078-39569100 AGGGAGGGGTGGGAGGAACTTGG - Intergenic
1147328066 17:39679504-39679526 TAGTAGAGGTGGGGACAAGTGGG + Intronic
1147660065 17:42112565-42112587 AGGTGGGGGTGGGGGGGGGTGGG + Intronic
1148231956 17:45941663-45941685 AAGGAGGGAAGGGGGGAAGGGGG - Intronic
1148258514 17:46158315-46158337 GAGGAGGGGTTGGGGGAATTGGG + Intronic
1148458902 17:47826595-47826617 AGTTAGGGGTGGGGTGAAGAGGG - Intronic
1148458990 17:47826987-47827009 TGGTGGGGGTGGGGGGAAGATGG + Intronic
1148651778 17:49255284-49255306 AAGTGGGGGTGGGGTGAACACGG - Intergenic
1148664987 17:49367792-49367814 AAGTAGGGCTGGTGGGAGGTGGG - Intergenic
1148856854 17:50583656-50583678 TGGTGGGGGTGGGGGGAGGTGGG + Intronic
1149389629 17:56175921-56175943 TAGTAGGGGGGTGGGGGAGTTGG + Intronic
1149492275 17:57093759-57093781 TAATGGGGGTGGGGGGCAGTGGG - Intronic
1149978729 17:61292228-61292250 AAGTGGGGGTGGGGTGGGGTTGG - Intronic
1149982041 17:61318483-61318505 AATTAGGGGGAGGGGGAAGAGGG - Intronic
1150007472 17:61478793-61478815 AAGTGGGGCTGTGGGGCAGTGGG - Intronic
1150677773 17:67259563-67259585 AAGGAGGGGTAGAGGGAAGGAGG + Intergenic
1151301960 17:73232978-73233000 AAGGAAGGGTGCGGGGAGGTGGG + Intronic
1151316417 17:73325261-73325283 AAGTCGGGGGAGGGGGAGGTTGG + Intergenic
1151401352 17:73857942-73857964 AAGCAGGGGTGTGGGGAGGGTGG + Intergenic
1151462488 17:74262794-74262816 AAGGAGTGGGGTGGGGAAGTGGG + Intergenic
1151617598 17:75224484-75224506 GAGAAGGGGTGGGGGGAAGCAGG + Intronic
1151656915 17:75500520-75500542 TAGCAGGGGTGGGAGGCAGTGGG - Exonic
1151699246 17:75733986-75734008 AGATAGGGGTGTGGAGAAGTGGG - Intronic
1151772411 17:76172825-76172847 ATCTAGGGGTGGCGGGCAGTGGG + Intronic
1152098381 17:78286446-78286468 AGGCAGGGGTGGGGGGCAGGAGG - Intergenic
1152318148 17:79592913-79592935 AAGCAGGGGTGTGGGGTAGTGGG - Intergenic
1152596905 17:81242219-81242241 AGGCAGGGGTGGGGGGCAGCCGG - Intergenic
1152624060 17:81380172-81380194 GAGTGGGGGTGGGGAGTAGTGGG - Intergenic
1152859096 17:82685241-82685263 AGGGAGGGGGAGGGGGAAGTGGG + Intronic
1153859470 18:9186678-9186700 AAGTTGGGGTAGGGGGTAGAAGG + Intronic
1154015298 18:10610885-10610907 AATTAAGGGTGTGGGGAAATAGG + Intergenic
1154190224 18:12224756-12224778 AATTAAGGGTGTGGGGAAATAGG - Intergenic
1155437319 18:25826725-25826747 AAGTGGGGGTGGGAGGGGGTGGG + Intergenic
1155757963 18:29525705-29525727 GGGTAGGGGTGGGGAGAGGTTGG - Intergenic
1155968538 18:32058758-32058780 TAGTGGGGATTGGGGGAAGTGGG - Intronic
1156003900 18:32417729-32417751 TAGTGGGGGTGGGAGGAAGGTGG + Intronic
1156366191 18:36429424-36429446 AGGTACGGGTGGGGGCATGTGGG + Intronic
1157106796 18:44781495-44781517 AGGTGGGGGTGGGGGGGAGAGGG - Intronic
1157117557 18:44876342-44876364 AAATAGGGGTGTGGGGGTGTGGG - Intronic
1157335507 18:46734394-46734416 GAGCAGGGGTGGGGGGAGGTGGG - Intronic
1157544676 18:48539445-48539467 GAGCAGGGATGGGGGGAAGGGGG - Intronic
1157616995 18:48992871-48992893 TAGTAGGGGTGGGGGCAGGAAGG - Intergenic
1157828519 18:50834889-50834911 AAGTCGGGGTGGGAAGAAGTAGG - Intergenic
1158005992 18:52672662-52672684 AAGGAGGGAAGGGGGGAAGGGGG - Intronic
1158162355 18:54499540-54499562 GAGTAGGGATGGGGGGAATAGGG + Intergenic
1158832535 18:61296029-61296051 AGCCAGGGGTGGGGGGTAGTGGG + Intergenic
1159633431 18:70777073-70777095 AAGTAGAGTTGGAGGGAAATTGG + Intergenic
1160047414 18:75399920-75399942 CAGGAGGGGTGGGGGTAAGATGG + Intergenic
1160191878 18:76721506-76721528 CAGTAGGGGCAGGGGGAAGATGG + Intergenic
1160782274 19:883180-883202 AAGTGGGGATGTGGGGCAGTGGG + Intronic
1161168691 19:2802314-2802336 AGGTGGGGGTGTCGGGAAGTGGG - Intronic
1161435736 19:4261856-4261878 GAGCAGGGGTGGGAGGGAGTAGG - Intronic
1161660973 19:5546049-5546071 AGGTGGGGGTGGCAGGAAGTGGG - Intergenic
1161980330 19:7626890-7626912 GAATAGGGGTGGGGAGAAGCAGG - Intronic
1162254910 19:9482430-9482452 AAGGAAGGGAGGGGGGAAGGGGG + Intronic
1162322162 19:9976878-9976900 CATTCGGGGTGGGGGGAAGTTGG + Intronic
1162540982 19:11295856-11295878 AAGCGGGGGAGGGGGGAACTTGG - Intergenic
1162561666 19:11421103-11421125 CAGTATGGGTGGGGGGATGAAGG - Intronic
1162594008 19:11613130-11613152 AGGGAGGGGAGGGGGGAAGGAGG - Intronic
1162878759 19:13641130-13641152 CCGTAGTGGTGGAGGGAAGTAGG - Intergenic
1162906750 19:13828617-13828639 AGGTAGGGGTGGGGAGAAGGGGG - Intronic
1163023413 19:14495857-14495879 AAGCGGGGGTGGGGGGTGGTGGG - Intronic
1163026266 19:14514491-14514513 AAGTAGCGGTGGGGAGAGGCAGG - Intergenic
1163374935 19:16924249-16924271 AAGTGGGTTTGGGGGGAAGATGG + Intronic
1163443843 19:17335016-17335038 AAGCATGGGTGGGGACAAGTTGG - Intronic
1163569646 19:18073394-18073416 ATGTAGAGGTGGCAGGAAGTGGG - Intronic
1164776487 19:30857398-30857420 GAGTAGGGGAGGGTGGAAGCTGG + Intergenic
1165099015 19:33427364-33427386 AGGTAGGAGATGGGGGAAGTGGG + Intronic
1166054831 19:40282148-40282170 AAGTAGGGGGTGGGGGAGGCTGG + Intronic
1166234012 19:41442822-41442844 AAGTGGTGGTGGGGGGCAGGTGG + Intergenic
1166337709 19:42118361-42118383 GAGTAGGGGTGGATGGAGGTGGG + Intronic
1166626953 19:44366638-44366660 AAGTGGGGGTGGGGGGAATGGGG - Intronic
1166876426 19:45900538-45900560 TAGTAGGGGGGTGGGGAAGACGG - Intronic
1166993201 19:46705337-46705359 AAGTTGGGGTTGGGGAAAGAGGG - Intronic
1167087749 19:47321877-47321899 GTGTGGGGGTGGAGGGAAGTGGG - Exonic
1167103217 19:47416738-47416760 GAGGAGGGGTGGGTGGAAGGCGG - Intronic
1167817688 19:51898532-51898554 AAGTGGGGGGTGGGGGAAGGGGG - Intronic
1168083599 19:54028575-54028597 AAGGAGTGTTGGGGGGAAGGGGG + Intergenic
1168464973 19:56594951-56594973 AAGTAGGAGAGGTGGGAAGAAGG - Intergenic
1168601677 19:57723714-57723736 CAGTAGGGTGGGGGGGAAGCTGG - Intronic
925998459 2:9311063-9311085 AAGTAGGGGTGGGGAAAGGAAGG + Intronic
926117261 2:10221356-10221378 AAGAAGGGTTGGGGGGATGGGGG + Intergenic
926628706 2:15117794-15117816 AAGCAGGAGTGGGAGGAGGTTGG - Intergenic
926741751 2:16117073-16117095 AAGTAGGGGCAGGGGAAGGTGGG - Intergenic
926884182 2:17582217-17582239 CAGGAGGGGTGAGGGGAAGGAGG + Intronic
927453956 2:23233099-23233121 CAGGAGGGGTGGGGAGGAGTAGG + Intergenic
927805648 2:26144342-26144364 AAGTGGGGGTGGGGAAAAGGAGG - Intergenic
927832570 2:26365286-26365308 AAGTAGGGATGCTGGGAAGAAGG - Intronic
928022561 2:27715880-27715902 GGGTCGGGGTGGGGGGAGGTGGG - Intergenic
928294841 2:30073552-30073574 AGGCAGGGGAGGTGGGAAGTAGG + Intergenic
928349738 2:30538945-30538967 AAAAAGAGGTTGGGGGAAGTTGG - Intronic
928599688 2:32892032-32892054 GAGTGGGGGTGGGGAGATGTTGG + Intergenic
929082991 2:38139452-38139474 AGGTGGGGGTGGGGGCAGGTGGG + Intergenic
929390545 2:41464214-41464236 AGGTAGGGGTGGGGTGGGGTGGG - Intergenic
929932447 2:46269455-46269477 AGGTGGGGGTGGGTGGGAGTGGG - Intergenic
929961752 2:46502491-46502513 GTGTATGGTTGGGGGGAAGTGGG - Intronic
929962044 2:46504299-46504321 AAGAAGGGGAGGAGGGAACTGGG - Intronic
930021094 2:47002737-47002759 AGGGAGGGGTAGGGGGAAATGGG - Intronic
930376138 2:50569146-50569168 TAGTGGGGGTTGGGAGAAGTGGG + Intronic
930771455 2:55134320-55134342 CAGGAGGAGTGGGGGGAAGAGGG - Intergenic
931160054 2:59679583-59679605 AAGTGGGGATGGTGGGAAGATGG - Intergenic
931343531 2:61425736-61425758 CAGTAGAGGTGGTGGGAAGGGGG + Intronic
932133938 2:69212204-69212226 AAGTAGGGGAGGGGAGGAGGAGG + Intronic
932407329 2:71522181-71522203 GAGGAGGGGTGGGGAGAAATGGG - Intronic
932411311 2:71549605-71549627 TAGGAAGGGTTGGGGGAAGTGGG - Intronic
932804846 2:74774571-74774593 AAATAGCTGTGGGGGGAAGTGGG - Intergenic
933377801 2:81502236-81502258 AAGGAGGAGTGGGTGGAAGGAGG + Intergenic
933503883 2:83152884-83152906 AAAATGGGGTGGGGGGAACTTGG - Intergenic
933679225 2:85084323-85084345 AAGTAGGGGTGGGTAGGGGTGGG + Intergenic
934311663 2:91872431-91872453 TATTAGGGGTGGGGGGAGGAGGG + Intergenic
934554758 2:95281428-95281450 CAGGAGGGTTGGGGGAAAGTGGG + Intronic
934617730 2:95785292-95785314 AAGCAGGTATGGTGGGAAGTTGG + Intergenic
934643163 2:96039267-96039289 AAGCAGGTATGGTGGGAAGTTGG - Intronic
934760995 2:96857151-96857173 TAGGAGGGGCGGAGGGAAGTAGG + Intronic
935045616 2:99479385-99479407 AATTTGGGGTAAGGGGAAGTGGG - Intronic
935315243 2:101826924-101826946 AAGTAGGGGTGTGGGTGCGTGGG - Intronic
935359251 2:102233564-102233586 AGGGAGGGGAGGGGGCAAGTAGG - Intronic
935395221 2:102600989-102601011 AGGTAGGGGTAGGGGGAAATGGG - Intergenic
936288591 2:111200454-111200476 CAGTATGGGTTGTGGGAAGTGGG + Intergenic
936843072 2:116797453-116797475 CAGTAGGGATGTGGGGGAGTGGG + Intergenic
937515311 2:122648161-122648183 AAGTAGGGGTGAGGTGAAAGTGG - Intergenic
937690671 2:124751210-124751232 AAGTAGGGGTTGGGGGTAGGGGG + Intronic
937785904 2:125897448-125897470 AAATAAGGGTGGGGGGAGGGGGG + Intergenic
938464478 2:131517306-131517328 AAGCAGGGGATGGGGGAAGACGG - Intergenic
938756153 2:134381033-134381055 AATTTGGGATGGGGGGAGGTAGG - Intronic
938809216 2:134836742-134836764 AAGACAGGGTGGGAGGAAGTAGG + Intergenic
938995279 2:136671839-136671861 GAGAAGGGAGGGGGGGAAGTTGG + Intergenic
939133457 2:138265816-138265838 GGGTAGGGATAGGGGGAAGTGGG + Intergenic
939519356 2:143210184-143210206 AAGCAATGGTGGGTGGAAGTTGG + Intronic
940123231 2:150292316-150292338 GAGTAGGGGTGGGGGCAAAAAGG - Intergenic
940565357 2:155353566-155353588 AAGTACGTGTGGAGGGAAGGTGG - Intergenic
941786865 2:169506351-169506373 GAGTGGAGGTGGGGGGAAGGTGG + Exonic
942457294 2:176147200-176147222 AAGCAGGGGTGAGGGGCAGATGG + Intergenic
942745226 2:179224621-179224643 TAGTGGGGGTAGGGGGAGGTTGG - Intronic
943430075 2:187788647-187788669 AAGGTGGGGTGGAGGGGAGTGGG + Intergenic
943460466 2:188166162-188166184 AGGCAGGGGTGGGGGGAGGGGGG + Intergenic
943659691 2:190545696-190545718 AAAAAGGGGTGGGTGGAGGTTGG + Intergenic
944395097 2:199257879-199257901 GTGTTGGGGTGGGGGGTAGTGGG + Intergenic
944819020 2:203410169-203410191 AAGTAGTGGTGGAGGTAAGGAGG - Intronic
944935539 2:204563385-204563407 AGGTATGGGTGGGGGGGACTGGG + Intronic
947544706 2:231002645-231002667 AAGTGGGGGTGGTGGGAAGCTGG - Intronic
947581398 2:231321371-231321393 AAGGAGGGGTGGGAGGAGGCTGG + Intronic
947837074 2:233183527-233183549 AAGGAGAGATGGGTGGAAGTCGG - Intronic
947885839 2:233570305-233570327 GGGTGGGGGTAGGGGGAAGTTGG - Intergenic
948813734 2:240499342-240499364 ATGTGGGGGTGGGGGTGAGTAGG + Intronic
948950303 2:241246265-241246287 AAGTGGGGGTGGGGGGAGTGTGG + Intronic
948989209 2:241543506-241543528 GAGAAGGGGAAGGGGGAAGTTGG - Intergenic
1168921284 20:1538168-1538190 AGGCAGGGGTGGGGAGCAGTGGG - Intronic
1169305390 20:4485230-4485252 AAGAATGGGTGGTGGGAGGTGGG + Intergenic
1169768635 20:9177047-9177069 AAGGAGGGGTGGTTGGAACTTGG + Intronic
1170373640 20:15677365-15677387 ATGCGGTGGTGGGGGGAAGTGGG + Intronic
1170634082 20:18089594-18089616 AAGTAGGGGTGAAGAGAAGTTGG + Intergenic
1170958381 20:21002575-21002597 AAGGCGGGGTGGCGGGGAGTGGG - Intergenic
1171046305 20:21811544-21811566 GAGCAGGGGAGTGGGGAAGTGGG + Intergenic
1171196600 20:23204806-23204828 AAGAATTGGTGTGGGGAAGTGGG - Intergenic
1171862402 20:30412933-30412955 AAGTAGGGAGGGAGGGAGGTAGG + Intergenic
1171974744 20:31587484-31587506 GAAGAGGGGTGGGGGGAAGGCGG + Intergenic
1172022460 20:31924229-31924251 ACGTTGGGGTGGAGTGAAGTGGG - Intronic
1172130305 20:32650694-32650716 GGGGAGGGGTGGGGGGAAGTTGG - Intergenic
1172289044 20:33762048-33762070 AAGCACAGGTGGGTGGAAGTAGG + Exonic
1172863493 20:38076648-38076670 GGGCAGGGGTGGGGGGAAGGGGG - Intronic
1173465960 20:43281630-43281652 CAGTAGGAGAGAGGGGAAGTGGG - Intergenic
1173733248 20:45342653-45342675 AGGTGGGGGTTGGGGGAAGCAGG + Intronic
1173997942 20:47353800-47353822 AAGGGGGGTTGGGGGGAAGCAGG + Intronic
1174090055 20:48039580-48039602 AAGGGGGGTTGGGTGGAAGTGGG + Intergenic
1174109651 20:48189866-48189888 AAGCAGGTGGGGCGGGAAGTGGG + Intergenic
1174726395 20:52867178-52867200 AAGGTGGAGTGGGAGGAAGTGGG - Intergenic
1174842722 20:53915431-53915453 ACGCGGGGGTGGGGGGAAGGTGG - Intergenic
1174915210 20:54646703-54646725 AAGTAGGGGAGAGGGAAGGTAGG - Intronic
1174941108 20:54929406-54929428 AGCTAGGGTTGGGGGGAGGTAGG - Intergenic
1175066377 20:56292093-56292115 AATTATGGGTAGGGAGAAGTAGG - Intergenic
1175194568 20:57234068-57234090 GAGTGGGGGTGGGGGGACATGGG - Intronic
1176063503 20:63182480-63182502 AAGGAGGGGCGGGGGGAGGGGGG - Intergenic
1176248667 20:64109672-64109694 AAGAAGGTGTGGGTGGCAGTCGG - Intergenic
1177401430 21:20610638-20610660 ATGGAGGGTTGGGGGGAGGTGGG + Intergenic
1178083084 21:29085924-29085946 AGGAAGGGGTTGGGGGAAGGCGG - Intronic
1178163955 21:29950312-29950334 AAGGAAGGATGGGGGGAAGAGGG - Intergenic
1178823137 21:35993115-35993137 AAGTTGGGGTGTGTGGGAGTTGG - Intronic
1179043967 21:37829127-37829149 AAGTGGGAGTGGCGGGAGGTGGG + Intronic
1179067705 21:38041684-38041706 AAGGAGGGGTGGGGGGAGCAAGG - Intronic
1179647468 21:42784585-42784607 AGGTAGGGGTGAGGTGGAGTGGG - Intergenic
1179647549 21:42784789-42784811 AGGTAGGGGTGGGGTGGAGTAGG - Intergenic
1180118188 21:45725865-45725887 AGGAAGGGGTGGGGGGCAGCTGG + Intronic
1182049984 22:27305276-27305298 AGTCAGGGCTGGGGGGAAGTTGG - Intergenic
1182093963 22:27614045-27614067 ATGGAGGGGTGGGGGGAAGGCGG + Intergenic
1182201351 22:28573832-28573854 TAGTGGGGGTGGGGGGAAGTGGG - Intronic
1182241393 22:28919088-28919110 AAGGAGGGGTTGGGGCAAGATGG + Intronic
1182442677 22:30373420-30373442 GGGTAGGGGTCGGGGGAAGCTGG - Intronic
1183228933 22:36568861-36568883 AAGCAGGGGTGGGAGGATGGGGG + Intronic
1183487599 22:38097779-38097801 AAGTAGGAGATGGGGGAGGTGGG + Intronic
1183602307 22:38847023-38847045 ATGTAGGGGAGGGAGGAAGCTGG + Intergenic
1183777632 22:39977389-39977411 AAGTGGGGGTGGGGGAACGGGGG - Intergenic
1183848457 22:40562707-40562729 AAGGAGGGGAAGGGGGAAGGGGG + Intronic
1183874910 22:40771716-40771738 GAGTAGTGGCGGGGGGAAGGTGG + Intronic
1184729724 22:46365850-46365872 AAGGTTGGGTGGGGGGAAGGTGG + Intronic
1185229795 22:49673528-49673550 AAGGAGGGGAAGGGGGAAGAGGG + Intergenic
1185275968 22:49950361-49950383 ACAGAGGGGTGGGGGGATGTGGG + Intergenic
949102341 3:161241-161263 AAGCAGGGGTGGGGAGATGGAGG - Intergenic
950112276 3:10426869-10426891 GGGTGGGGGTGGGGGGAAGATGG + Intronic
950482127 3:13250795-13250817 CAGCAGGGGTGGGGGAAAGCTGG - Intergenic
950633896 3:14302012-14302034 CAATAGGGGTGGGGGCAACTCGG - Intergenic
950875106 3:16264613-16264635 TAGTTGGGGTGGGGGGACGCGGG + Intronic
950998403 3:17529492-17529514 GAGAAAGGGTGGGGGGAAGAGGG + Intronic
951546363 3:23829974-23829996 AAGAAGGAGTGGAGGGAAGGGGG - Intronic
951657818 3:25028911-25028933 GAGTAGGGGTGGGGTGGAGTTGG - Intergenic
951672380 3:25199312-25199334 AGGTTGGGGGTGGGGGAAGTGGG + Intronic
952061250 3:29513437-29513459 AAGTCTGGGTGGGGGCCAGTTGG - Intronic
952224839 3:31365008-31365030 AAACAGGGGAGGAGGGAAGTTGG - Intergenic
952621000 3:35342389-35342411 AAGTGGGGGAGGGGGGAAGAAGG + Intergenic
953186365 3:40641841-40641863 AAGTAAGGGTGAGGGGATATGGG + Intergenic
953254191 3:41273677-41273699 GAGTGGGGGTGTGGGGAGGTGGG + Intronic
954043433 3:47908210-47908232 AATTGGGGGTGGGGGGAAACGGG + Intronic
954445328 3:50543188-50543210 GGGCAGGGGTGGGGGGAAGAGGG + Intergenic
954580901 3:51702476-51702498 AATTAGGAGAGGGGGGAATTTGG - Intronic
955058314 3:55474886-55474908 AGGTAGGGCTGGGGGGAGGTTGG + Intronic
955780897 3:62483320-62483342 GAGTAGGGGAGTGGGGGAGTGGG + Intronic
956800863 3:72757018-72757040 ATGTAGGGGCAGGGGGAACTGGG + Intronic
956831459 3:73053241-73053263 AAGTAGGGGTGGGTGGGTGTGGG - Intronic
957036532 3:75298488-75298510 AAGGAAGGGTGGGGAGAAGGTGG + Intergenic
957037058 3:75303130-75303152 GAGTAGGGGTGGAGGAAAGGGGG + Intergenic
957086765 3:75687244-75687266 AAATAGGGGAGGGGGGAGTTTGG - Intergenic
957152866 3:76509173-76509195 AAGAAGGGGTGGGGCCAAGGTGG + Intronic
958574867 3:95935664-95935686 ATTTTGGGGTGGGGGGAGGTGGG + Intergenic
958916900 3:100060045-100060067 AAATGGGGGCGGGGGGAAGATGG + Intronic
959539963 3:107525687-107525709 AGGTCGGGGTGGGGGGAGCTAGG - Intronic
960346103 3:116535373-116535395 AAGTAGGGAAAGGGGGAAATGGG - Intronic
960624370 3:119666123-119666145 AAGCAGGGGTGGGATGAAGGGGG + Intronic
960982558 3:123244277-123244299 AAGTGGGTGGGGGCGGAAGTGGG + Intronic
961041830 3:123683283-123683305 AAGTGGGGGTGGGGGTGGGTGGG + Intronic
961064444 3:123862788-123862810 AAGTAGGGGAGAAGGGAGGTGGG - Intronic
961080266 3:124020943-124020965 AAGGAAGGGTGGGGAGAAGGTGG + Intergenic
961369603 3:126421507-126421529 AAGCAGGGATGGAGAGAAGTGGG + Intronic
962087645 3:132208720-132208742 AGATAGGGTTGGGGTGAAGTAGG - Intronic
962124513 3:132601568-132601590 AAGAATGGGTTGGGGGAAGGGGG + Exonic
962693516 3:137925370-137925392 AAGCAGAGGTTGGGGGAAGGTGG - Intergenic
962735575 3:138322365-138322387 AAGCGGGGGTGGGGGGTAGGGGG + Intronic
962848928 3:139293446-139293468 AAGTAGGGTTGGGGGGTGGCTGG + Intronic
962859747 3:139389008-139389030 AAGAAGGGTTGGGAGGAAGGGGG - Intronic
962866168 3:139449512-139449534 AAGGAGGGTTGGGGAGAGGTGGG - Intergenic
962949516 3:140205000-140205022 CAGGAGGGGTGAGGGGAGGTGGG + Intronic
963514150 3:146288037-146288059 GAGTTGGGGTGGGGGGATGGAGG - Intergenic
963599003 3:147361123-147361145 AAGGAGGGGGGAGGGAAAGTAGG - Intergenic
963934218 3:151035689-151035711 AAGTAGGGTTGCGGGGGATTTGG - Intergenic
964446714 3:156766948-156766970 AAGGAGGGGTCGGGTGATGTGGG - Intergenic
964608066 3:158580132-158580154 AAGTAGAGTGGGGTGGAAGTAGG + Intronic
965415433 3:168387069-168387091 AAGAAGAGGTGGTGGGAAGTGGG - Intergenic
966266046 3:178044669-178044691 GAGAAGGGATTGGGGGAAGTAGG + Intergenic
966542249 3:181105351-181105373 AAGGTGGGCTGGGGGGAGGTGGG - Intergenic
966592949 3:181701470-181701492 AAGTTGGGTTGGGGGGGGGTGGG + Intergenic
966647482 3:182262864-182262886 AAATAGGGGTGGGGTGAGGTGGG - Intergenic
966748240 3:183298528-183298550 ATGTAGGGATGGGGGATAGTGGG + Intronic
966748973 3:183304055-183304077 GAGTATGGGTGAGGGGGAGTAGG - Intronic
966911110 3:184560871-184560893 AAGTAGGTGTTGGGGGAAGAAGG - Intronic
966944773 3:184770152-184770174 AAGTAGGGGTGGTGGGAGGGAGG - Intergenic
967290868 3:187918867-187918889 AGGGAGGAGTGGGGGGCAGTTGG + Intergenic
967703054 3:192617320-192617342 AAGTGGGGGAGGTGGGAGGTTGG + Intronic
968186181 3:196634740-196634762 AAGTGGGGGCTGGGAGAAGTGGG + Intergenic
968186196 3:196634787-196634809 AAGTGGGGGCTGGGAGAAGTGGG + Intergenic
968186217 3:196634863-196634885 AAGTGGGGGCTGGGAGAAGTTGG + Intergenic
968425199 4:518661-518683 AAGTAGTGGCTGGGGGAAGATGG + Intronic
968878972 4:3288893-3288915 TCGTAGGGGTGGGGGGATGGCGG - Intergenic
968920269 4:3518807-3518829 CAGGAGGGGTGGGGGGCAGGAGG + Intronic
968985629 4:3872876-3872898 GAGCAGGGGTCGGGGGAAGAGGG + Intergenic
969436982 4:7194008-7194030 TTGTGGGGGTGGGGGGAAGTGGG - Intronic
969721556 4:8895207-8895229 AGGTAGGGGTGGGAGGAGGGCGG + Intergenic
969967081 4:11008020-11008042 AACTAAGGGTGTGGGGGAGTGGG + Intergenic
970108343 4:12609872-12609894 AATAAGGGGCGGGGGGAGGTGGG - Intergenic
970187026 4:13467016-13467038 GACTAGGGGTTGGGGGAAATGGG + Intronic
970526108 4:16933878-16933900 AAGGGGGGGTGGCGGGAATTTGG - Intergenic
970619296 4:17800831-17800853 AAGTGGAGGTGGGAGGAGGTAGG - Exonic
970626674 4:17893182-17893204 TAGTAGGGGTAGGGGCAAGGTGG - Intronic
970684138 4:18546428-18546450 AGGAATGGGTGGGGGGAAATGGG - Intergenic
970761644 4:19496553-19496575 CAGTAGTGGTGGGGGAGAGTAGG + Intergenic
971177388 4:24293340-24293362 AGGAAGGGGTGGGGGTAAGGGGG - Intergenic
971291548 4:25346073-25346095 GAGTAGGGGTCGGGGGAGGCTGG - Intronic
971483027 4:27131177-27131199 CAGTAGGGGAGTGGGGAAGAGGG + Intergenic
972273533 4:37535545-37535567 AGGTAGAGGTGGAGCGAAGTGGG - Intronic
972395330 4:38654416-38654438 AAATAAGGGTGGGGAGTAGTGGG + Intergenic
973595340 4:52482772-52482794 CTGTAGGGGTGAGGGGAAGGAGG - Intergenic
973602269 4:52553613-52553635 GAGCAGGGGTGGGGGAAATTGGG - Intergenic
973929729 4:55779862-55779884 TATCAGGGGTTGGGGGAAGTGGG + Intergenic
974107735 4:57489897-57489919 AATTTGGGGTGGGGTGAGGTGGG - Intergenic
974696609 4:65383780-65383802 GAAAAGGGGTTGGGGGAAGTAGG + Intronic
974852859 4:67424713-67424735 TACTAGGGGCTGGGGGAAGTGGG + Intergenic
974907411 4:68075455-68075477 AGGTAGGGATGGGGCAAAGTAGG - Intronic
975698984 4:77043619-77043641 AAGGAGGGGTTGGGGGAAGATGG - Intergenic
976310537 4:83607483-83607505 GAGGTGGGGTGGAGGGAAGTGGG + Intergenic
976408352 4:84684664-84684686 AAATAGGGGTGGGGGAATGTGGG + Intronic
977037164 4:91969054-91969076 CAGTAGGGGTGGGGGGAAAACGG - Intergenic
977353931 4:95921712-95921734 AAGTAGTGGTGGGGTGATGGGGG + Intergenic
978285573 4:107073405-107073427 TGGTAGGGGTGGGGGGGAGGGGG - Intronic
979357688 4:119724660-119724682 CAGGAGGGGTGAGGGGAAATAGG + Intergenic
980580791 4:134747373-134747395 GAGTGGGGGTGGGGGGGAGTGGG + Intergenic
981115693 4:140988633-140988655 TACTTGGGGTGGGGGGAAGGGGG - Intronic
981334198 4:143550573-143550595 CAGTGGGGGTGGGGGAAAGTGGG - Intronic
981837988 4:149077835-149077857 GAGTGGGGGTGGGGGGAGGAGGG - Intergenic
982220026 4:153116306-153116328 GAGGTGGGGTGGAGGGAAGTGGG - Intergenic
982426211 4:155264512-155264534 AAGTAGGGGAGAGAGGTAGTGGG + Intergenic
982755208 4:159209656-159209678 TAGTAAGGTTGTGGGGAAGTAGG + Intronic
982874926 4:160635407-160635429 AAATAGGGGTGGGGGTAGGAGGG - Intergenic
982972050 4:162000879-162000901 AAGAAGGGATGGAGGGAAGAGGG + Intronic
983904300 4:173168725-173168747 CGGTAGGGGTGGGGGAAAGAGGG + Intergenic
983959329 4:173733140-173733162 AGGGTGGGGTGGGGGGGAGTGGG - Intergenic
984450407 4:179893673-179893695 ATGTAGGGGTGGGAGGAAAAGGG + Intergenic
984592924 4:181636641-181636663 CAGCAGAGGTGGGGAGAAGTGGG - Intergenic
984703166 4:182831871-182831893 AAGGAGGGGAGGGGAGAAGGAGG - Intergenic
984703990 4:182834596-182834618 AAGGAGGGGAGGGGAGAAGAAGG - Intergenic
984703997 4:182834615-182834637 AAGGAGGGGAGGGGAGAAGAAGG - Intergenic
984811540 4:183799647-183799669 AAGTACGGGTAGGGGGTAGATGG - Intergenic
984812366 4:183806659-183806681 AAGTGGGGGTCGGGGGAAGAAGG - Intergenic
985004858 4:185524090-185524112 CAGTAGGACTGGAGGGAAGTAGG - Intronic
985391805 4:189498073-189498095 ATGTAGGGATGAGGGAAAGTTGG + Intergenic
985663627 5:1169863-1169885 AAGGAGGGGAGGAGGGAAGGAGG + Intergenic
985913490 5:2900681-2900703 AGGTTGGGGTGGGGAGAAGCTGG - Intergenic
986021441 5:3807825-3807847 AACCAGGGGTTGGGGGTAGTGGG - Intergenic
986390106 5:7277475-7277497 AAGTTGGGGTGTGGGGAGGGTGG - Intergenic
987197467 5:15541508-15541530 GAATAGGGGTGGGGGTAAGATGG - Intronic
987384144 5:17313203-17313225 AGGTAGGGATGGGAGGAAGTAGG - Intergenic
988666194 5:33330549-33330571 AGGGAGGGGAGGGGAGAAGTTGG - Intergenic
989213757 5:38882636-38882658 ACGGCGGGGTGGGGGGAAGGGGG + Intronic
989550643 5:42731735-42731757 AAAAAGGGTTGGGGGGAGGTGGG + Intergenic
990032819 5:51282645-51282667 AAATAAGGGAGGAGGGAAGTGGG - Intergenic
990407268 5:55503895-55503917 AAGTAGAGGGGGGAGGAAGGGGG + Intronic
990768564 5:59216426-59216448 TAGTAGGGATGGAAGGAAGTGGG - Intronic
991007504 5:61844194-61844216 AAGTGGGGGTGGGGGTAGGGAGG + Intergenic
991143971 5:63279504-63279526 AAGGAGGGGAAGGGGGAAATCGG - Intergenic
991422607 5:66456370-66456392 GAGTGGGGTTGGGGGGTAGTGGG - Intergenic
991481926 5:67090298-67090320 AAGTGGGGAGGGGGAGAAGTGGG - Intronic
991481938 5:67090330-67090352 AAGTGGGGAGGGGGAGAAGTGGG - Intronic
991481945 5:67090346-67090368 AAGTGGGGGGAAGGGGAAGTGGG - Intronic
991927502 5:71719516-71719538 GAGTGGGGGTGGGGGGAGGAGGG - Intronic
992013927 5:72557188-72557210 GAGCAGGGGTGGGGTGAGGTGGG + Intergenic
992130839 5:73691379-73691401 AAATGGGGGTGAGGGGAAATGGG - Intronic
992489057 5:77223379-77223401 AAGAATGGGTGGGGGGAGGGGGG - Intronic
992998382 5:82355082-82355104 GTGTGGGGTTGGGGGGAAGTTGG + Intronic
993979781 5:94531395-94531417 AGGTAGAGGTGGTGGTAAGTGGG - Intronic
994390729 5:99190060-99190082 TAGTGGGGGTGGGGGGAGATAGG - Intergenic
995019309 5:107349038-107349060 TAGTGGGGTTAGGGGGAAGTGGG - Intergenic
995080233 5:108042406-108042428 ATGTAGGGGTGGGAGGAAAATGG - Intronic
995655206 5:114418568-114418590 AAGTGGGGCTGGCGGGGAGTTGG + Intronic
996298677 5:121955135-121955157 GGGTAGTGGTTGGGGGAAGTGGG - Intergenic
996906028 5:128601403-128601425 GAGTGGGGCTGGGGGGAAGTGGG - Intronic
996906040 5:128601432-128601454 GAGTGGGGCTGGGGGGAAGTGGG - Intronic
997405348 5:133641881-133641903 AAGAAGAGGAGGGGGGAAGAAGG - Intergenic
997411847 5:133696715-133696737 AAGAAGGGCTGTGGGGAAGGAGG + Intergenic
997979238 5:138458838-138458860 AAGAAGGAGTGGGTGGAAGTGGG - Intergenic
998034023 5:138898155-138898177 GAGAAGGGGTGGGGGGGGGTGGG - Intronic
998090835 5:139367463-139367485 AAAAAGGGGTGGGGGGGAATGGG - Exonic
998131892 5:139655552-139655574 AAGGAGAGGTGTGGGGAGGTAGG - Intronic
998775351 5:145594256-145594278 CAGTATGGGTGTGGGGAAATAGG - Intronic
998802870 5:145888404-145888426 AAGTAGGGATCGGGCCAAGTGGG + Intergenic
999081817 5:148851578-148851600 AAGGAGGGGAGGGGAGAAGCTGG - Intergenic
999319630 5:150605484-150605506 ATGGAGGGGTGGGGGCAAGAAGG + Intronic
999408264 5:151326305-151326327 AGGTGGGGGTGAGGGGAGGTGGG - Intronic
1000163506 5:158624607-158624629 AAGGGTGGGAGGGGGGAAGTTGG - Intergenic
1000219876 5:159204380-159204402 AAGTAGTGGGGGGGGGCAGGGGG + Intronic
1001154000 5:169257356-169257378 AGGTTGGGGTGGGGGGCTGTGGG - Intronic
1001332866 5:170774360-170774382 TAGTGGGGTTGGGGGGATGTAGG + Intronic
1001821853 5:174716558-174716580 TAGTGGGGGTGGGTGGGAGTGGG + Intergenic
1001891712 5:175344780-175344802 AGGCAGGAGTGGGGGGAAGGAGG + Intergenic
1001926662 5:175642129-175642151 AAATGGGGTTGGGGGGAATTAGG + Intergenic
1002179845 5:177425780-177425802 AAGTAGGGGGTGGAGGAAGCGGG + Intronic
1002258941 5:177981152-177981174 AACAAGGGGTGGAGAGAAGTGGG + Intergenic
1002327747 5:178420685-178420707 AGGGAGGGGAGGGGGAAAGTGGG - Intronic
1002377009 5:178796056-178796078 AAGGAGGGAGGGAGGGAAGTGGG + Intergenic
1002461431 5:179375845-179375867 CAGCAGGGGAGGGGGGAAGGGGG + Intergenic
1002461456 5:179375905-179375927 AACTGGGGGAGGGGGGAAGGGGG + Intergenic
1003772337 6:9319297-9319319 ATGGAGGCCTGGGGGGAAGTGGG + Intergenic
1004022047 6:11784822-11784844 GAGTGGGGGTTGGGGAAAGTTGG + Intronic
1004294353 6:14396794-14396816 AGGTGGGGGTGGGTGGGAGTTGG - Intergenic
1004559245 6:16731764-16731786 TAGGAGGGGTGGGGGTAGGTGGG - Intronic
1005117696 6:22356480-22356502 GAGCAGGGGTGGGGGGTGGTGGG + Intergenic
1005358454 6:25007882-25007904 AACTAGGGGTGAGGGCAGGTGGG - Intronic
1005602687 6:27443778-27443800 AAGTGGGGGTGGAGGGAGGTGGG - Intergenic
1005631058 6:27708423-27708445 AAGTAGGGAGGGAGGGAGGTAGG - Intergenic
1005966119 6:30727862-30727884 AAGTTGAGGTGGGGTGGAGTGGG + Exonic
1006030033 6:31171601-31171623 ACGGAGGGGTGGGGGGATGGGGG - Intronic
1006130919 6:31869100-31869122 TAGTAGGGGTGAGGGGCTGTAGG - Intronic
1006311356 6:33263463-33263485 AGGTAGGGGTGTGGGGAAAAGGG - Exonic
1006405340 6:33841743-33841765 ATGGAGGGGTGGGAGGCAGTGGG - Intergenic
1006516197 6:34546999-34547021 AAGGAGGGGTGGGGGGCTGCGGG - Intronic
1006813633 6:36836901-36836923 AGCCAGAGGTGGGGGGAAGTGGG - Intronic
1006974499 6:38086343-38086365 TGGTAGGGGTGGGGTGGAGTGGG - Intronic
1006988442 6:38192901-38192923 AACAAGGGGTGGGGGGAGGGGGG + Intronic
1007152018 6:39703020-39703042 AAATGGGGGTGGGGTGGAGTTGG - Intronic
1007420831 6:41718650-41718672 AAATAGGGGTTGGGGGAATGGGG - Intronic
1007840625 6:44713089-44713111 CAGCAAGGTTGGGGGGAAGTTGG - Intergenic
1008222180 6:48868256-48868278 ATGTGGGGGTGGGAAGAAGTTGG + Intergenic
1008385037 6:50879609-50879631 AACTAGGAGTGGTGGGAACTGGG + Intergenic
1008437226 6:51490528-51490550 AAGTGGGGCTTGGGGGAAGCTGG - Intergenic
1008623114 6:53291367-53291389 AGGTAGGGGAGGAAGGAAGTGGG - Intronic
1008893696 6:56526675-56526697 AACTAAGGGAGGGGGGGAGTGGG - Intronic
1009035218 6:58109504-58109526 AATTAGGGGTGTAGGAAAGTGGG + Intergenic
1009210731 6:60860212-60860234 AATTAGGGGTGTAGGAAAGTGGG + Intergenic
1009602627 6:65821854-65821876 TAGTGGGAGTGGGGGGAAGTGGG + Intergenic
1010203018 6:73299474-73299496 GGGGAGGGGTGGGGGGACGTTGG - Intronic
1011970057 6:93211431-93211453 AAGGGGGGGAGTGGGGAAGTGGG + Intergenic
1012362345 6:98398331-98398353 AAGTTGGGGTGGGGTGGGGTGGG - Intergenic
1012402333 6:98852179-98852201 AGGTAGGGGTGGGGAAATGTTGG + Intergenic
1012896045 6:104950727-104950749 AAGTGGGGGTGGGGGGAAAGGGG - Intergenic
1013167413 6:107606437-107606459 AGGTTGGGGTGGGTGGCAGTGGG + Intronic
1014165191 6:118216442-118216464 AAGTGGGGGTAGGGGGAAGAAGG - Intronic
1014315254 6:119856549-119856571 AAGGAAGGGAGGGGGGAAGGAGG - Intergenic
1014510982 6:122322006-122322028 AAGTAGGAGTAGGAGGAAGAAGG + Intergenic
1015025880 6:128532001-128532023 AAGTGGGGGTGGGGGGAAAGTGG - Intergenic
1015655490 6:135513657-135513679 GACTAGGGGAAGGGGGAAGTGGG + Intergenic
1015979422 6:138823917-138823939 AAGAATGGGTTGGGGGAAGGGGG + Intronic
1016050809 6:139528089-139528111 ATGTATGTGTGGGGGGAAGGAGG + Intergenic
1016174462 6:141062211-141062233 AGGTGGGGGTGGGGGGAAGATGG + Intergenic
1016440930 6:144082621-144082643 AAGTGGGTGTGGGGGGAGGGGGG + Intergenic
1017086039 6:150713748-150713770 GGGAAGGGGTGGGGGGCAGTTGG + Intronic
1018250665 6:161866786-161866808 GAGTAGGTGTGGGAGGATGTGGG + Intronic
1018839525 6:167508091-167508113 AGGGAGGGGTGGGGAGAAGAGGG - Intergenic
1018953535 6:168393538-168393560 CAGAAGGGATGGGTGGAAGTGGG + Intergenic
1019059185 6:169243100-169243122 AGGTAGGAGTGGTGGGAAGGTGG - Intronic
1019113648 6:169738725-169738747 AACTAGGGGTGGGGCCAAGACGG - Intergenic
1019500511 7:1362297-1362319 AAGTGGGGGAAGGGGGAGGTGGG - Intergenic
1019731024 7:2629728-2629750 GAGTTGTGGTGGGGGGAAGCAGG + Intergenic
1019904209 7:4048472-4048494 GACGAGGGGTGGGGGGAAGCGGG - Intronic
1020023263 7:4881941-4881963 AAGCAGGGGTGGGGGGAAGTGGG - Intronic
1020032859 7:4945067-4945089 AAGAAGGGGTCGGGGGGAGGAGG - Intronic
1020035154 7:4959653-4959675 CTGGAGGGGTTGGGGGAAGTGGG + Intergenic
1020361222 7:7328818-7328840 AAGTAGGAGTTGGTGGAAGGAGG - Intergenic
1020440261 7:8209965-8209987 AAGCTGGGGTTGGGGGAGGTAGG + Intronic
1021632279 7:22659211-22659233 TTGGGGGGGTGGGGGGAAGTGGG - Intergenic
1021634818 7:22681949-22681971 CAGTGGGGGTGGGGGTAAGAAGG - Intergenic
1021883741 7:25118462-25118484 ACCTAGGGGTGGGGGGCGGTGGG - Intergenic
1021940634 7:25675590-25675612 AATTTGGGGTGGGTGGAAGAGGG + Intergenic
1021948518 7:25752223-25752245 CTGCAGGGCTGGGGGGAAGTAGG + Intergenic
1021964501 7:25904422-25904444 AATTAGGGGTGGAGGTAGGTGGG - Intergenic
1022056549 7:26741420-26741442 GGGTAGAGGTGGGGGGAAGGGGG + Intronic
1022108973 7:27216321-27216343 AAGGAGGGGTAGAGGGAGGTGGG + Intergenic
1022537931 7:31109528-31109550 AAGTGGGGCTGGGGAGAAGCAGG + Exonic
1023311729 7:38894445-38894467 GGCTAGGGTTGGGGGGAAGTGGG + Intronic
1023402981 7:39803889-39803911 AAATGGGGGTGGGCAGAAGTGGG + Intergenic
1023496369 7:40801543-40801565 AAGAAGGGGTTGGGAGAAGCTGG + Intronic
1023796650 7:43798976-43798998 ACGGTGGGGTGGGGGGCAGTGGG + Intronic
1024646355 7:51374248-51374270 AAATGGGGGTGGGCAGAAGTGGG - Intergenic
1024985643 7:55191352-55191374 AAGTGGGGGTGGGGGGTGGCGGG - Intronic
1025117195 7:56268436-56268458 AAGGAGGGGAGGTGGGAAGGAGG - Intergenic
1026266939 7:68803428-68803450 AAAAAGGGATTGGGGGAAGTGGG + Intergenic
1026539470 7:71267849-71267871 AAGTGGGGGTGGGGGCAGGTGGG - Intronic
1026829088 7:73600522-73600544 AAGTGGGGGGGGGGTGAAGGGGG + Intronic
1027119102 7:75502994-75503016 GAGCAGGGGTGGGGGGAGGGGGG + Intergenic
1027188280 7:75984380-75984402 AAGCAGGGGTGGGGCGAGGTGGG - Intronic
1027201080 7:76064264-76064286 TAGTGGGGGTGGGAGGCAGTGGG + Intronic
1027272726 7:76532611-76532633 GAGCAGGGGTGGGGGGAGGGGGG - Intergenic
1027326174 7:77051696-77051718 GAGCAGGGGTGGGGGGAGGGGGG - Intergenic
1027733569 7:81905198-81905220 AAGGAGGGAAGGGGGGAAGGAGG - Intergenic
1028206524 7:88023820-88023842 CAGGAGGGTAGGGGGGAAGTGGG - Intronic
1028601598 7:92606502-92606524 ATGTAGAGGTGTGGGGATGTTGG + Exonic
1028621313 7:92832783-92832805 AAGGAGGGTCTGGGGGAAGTGGG - Intronic
1028867923 7:95735377-95735399 AAGGTGGGGTTGGGGTAAGTGGG - Intergenic
1029014987 7:97306544-97306566 AAAAAGGGGTGGGGGGAGATAGG + Intergenic
1029181506 7:98705283-98705305 TAGTAGGGGTTGGGGGAGGCGGG - Intergenic
1029440904 7:100586146-100586168 AAGGAGGGGGTGGGGGAAGGAGG - Exonic
1029443786 7:100602093-100602115 AAGCAGGGGCGGGGGGAGGATGG + Intergenic
1029718396 7:102347038-102347060 GAGCAGGGGTGGGGGGAGGGGGG - Intergenic
1029754220 7:102562217-102562239 GAGCAGGGGTGGGGGGAGGGGGG + Intronic
1029772170 7:102661307-102661329 GAGCAGGGGTGGGGGGAGGGGGG + Intronic
1030205138 7:106945102-106945124 AAGTGGGAGTTGGGGGAAGGAGG - Intergenic
1030396083 7:108988502-108988524 AGGGAGGGGTGGGGGGAGGGGGG + Intergenic
1030652704 7:112132621-112132643 AAAAAGGGGCGGGGGGAGGTGGG + Intronic
1032246215 7:130215561-130215583 ACGTAGTGGTGTGAGGAAGTTGG - Intronic
1032285461 7:130535730-130535752 GGGTTGGGGTGGGGTGAAGTGGG + Intronic
1033126403 7:138711070-138711092 AAGTGGGGGTGGGGGGACGGTGG - Intronic
1033396599 7:140979863-140979885 AAGTTGGGGAGAGGGGAAGAGGG - Intergenic
1033608797 7:142946163-142946185 AGGAAGGGGTGGAGGGATGTGGG + Intronic
1033798485 7:144874822-144874844 AGGGAGAGGTGGGGGGTAGTAGG - Intergenic
1034339309 7:150341676-150341698 AGGTGGGGGTGGGAGGAGGTGGG - Intergenic
1034397731 7:150839917-150839939 CAGCAGGGGTAGGGGGTAGTTGG + Intronic
1036448716 8:8846257-8846279 AAAAAGGGGGGGGGGGAAGGAGG + Intronic
1036495757 8:9268573-9268595 AAGGAGGGAAGGGGGGAAGGAGG + Intergenic
1036525316 8:9529401-9529423 AAGCAGGGGTGGGGGGTGGTGGG - Intergenic
1036538148 8:9672736-9672758 AGCTAGGGGCTGGGGGAAGTGGG - Intronic
1036555523 8:9856393-9856415 AGTGGGGGGTGGGGGGAAGTGGG - Intergenic
1037674866 8:21043635-21043657 GAGGTGGGGTGGGGGGAGGTGGG - Intergenic
1037773615 8:21818111-21818133 AATTTGGGGTGGGGGGAGGGGGG + Intergenic
1037929342 8:22868447-22868469 AGGTAGGGGTGGGAGGAATTGGG + Intronic
1038038899 8:23707450-23707472 GAGTGGGGGTGGGGGGGGGTGGG + Intergenic
1038039121 8:23709407-23709429 AAGTGCTGGAGGGGGGAAGTAGG + Intergenic
1038320161 8:26518336-26518358 AAGTGGGGGTGGGGGATAATTGG + Intronic
1039059912 8:33565271-33565293 AAGGCGGGGTGGGGGGATGTGGG + Intronic
1039509558 8:38080183-38080205 AAAATGGGGTGGGGGAAAGTAGG + Intergenic
1040464254 8:47679492-47679514 TGGAAGGGGTGGGGGGAGGTAGG - Intronic
1041359774 8:57040784-57040806 AAGTGGGGGTGGGGTGGGGTGGG + Intergenic
1041935128 8:63324895-63324917 AAGCAGGTCTGGGGGGAAGCTGG - Intergenic
1042179117 8:66067196-66067218 ATGTGGGGGTGGGGGGCGGTGGG - Intronic
1042735514 8:71983629-71983651 AATTGGGGGTGGGGGGAGGGCGG - Intronic
1042862194 8:73326164-73326186 CAGTAGGGGTTGGGGGAACAGGG + Intergenic
1042889353 8:73590085-73590107 AAGTAGGGGGAGAAGGAAGTAGG + Intronic
1043052970 8:75405134-75405156 GAGTAGGGGTGGGGGGATGGGGG + Intergenic
1043585240 8:81760909-81760931 AAGTGGTGGTGGGGGGATGGGGG + Intergenic
1043930599 8:86086494-86086516 GTGTAGAGGTGGGGGAAAGTAGG + Intronic
1044099951 8:88122902-88122924 AGGCAGGGGTGGGGGGAGGAGGG - Intronic
1044480813 8:92685744-92685766 AAGTTGGGGTGGGGTGAAAAGGG - Intergenic
1044683805 8:94807980-94808002 AGTGAGGGGTGGGGGGAGGTGGG - Intergenic
1045172714 8:99688052-99688074 CAGCATGGGTTGGGGGAAGTGGG + Intronic
1045364154 8:101460182-101460204 AAGTAGGGGTGGGGGTTAAATGG + Intergenic
1046135204 8:110017344-110017366 AAGCGGGGGTGGGAGGAAGGTGG - Intergenic
1047145891 8:122199068-122199090 AAGTGGGGGCGGGGGGGAGGGGG - Intergenic
1047367236 8:124222693-124222715 AAGTATGGCTGGGGGGAGGGCGG + Intergenic
1047450521 8:124961339-124961361 AGGTAGGGGTGGGGGAAGATGGG + Intergenic
1048366439 8:133742706-133742728 AAGGAGGGGAGGAGGGAAGGAGG + Intergenic
1048423843 8:134304289-134304311 AAGTGGGGGTGGGGGGTTGCTGG + Intergenic
1048520565 8:135150458-135150480 GGGTTGGGGTGGGGGGAAGGGGG - Intergenic
1048822633 8:138393958-138393980 AAGTGGGGTTTGGGGGCAGTTGG + Intronic
1048868268 8:138776620-138776642 ATGATGGGGTGGGGGGAAGCAGG - Intronic
1049231779 8:141488450-141488472 GAGGAGGGGTAGGGGGAAGGAGG - Intergenic
1049462700 8:142737416-142737438 CAAAAGGGGTGGGGAGAAGTGGG + Intergenic
1050008261 9:1157767-1157789 AAGTAGGAGTGGTGAGAACTGGG + Intergenic
1050503901 9:6327843-6327865 AATTACGGTTGGGGGGAGGTTGG + Intergenic
1050512626 9:6412207-6412229 GAGTCGGGGTGGGGGTGAGTGGG - Intergenic
1050782606 9:9356604-9356626 AAGTAGTGATGGGGAGAAGTAGG + Intronic
1050889601 9:10807343-10807365 AAATAGGGATGAGGGTAAGTTGG - Intergenic
1051028799 9:12648679-12648701 AAATGGAGGTGTGGGGAAGTTGG - Intergenic
1051370942 9:16358503-16358525 TGGTAGGGATGGTGGGAAGTGGG + Intergenic
1051976524 9:22956921-22956943 AGGTAGGGGAGGGGAGGAGTTGG - Intergenic
1052330731 9:27265255-27265277 AAAAAGGGGGGGGGGGGAGTGGG - Intergenic
1052482823 9:29053407-29053429 ACCTATGGGTGGGGGGAAGGGGG + Intergenic
1052733394 9:32315643-32315665 AAGGAAGGGTTGGGGGAAGAAGG + Intergenic
1053028653 9:34755067-34755089 TTGGAGGGTTGGGGGGAAGTAGG + Intergenic
1053037551 9:34838245-34838267 AATTGGGGGAGAGGGGAAGTGGG + Intergenic
1053329172 9:37188514-37188536 AAGGAGGGGTGGGGAGAGGGGGG - Intronic
1055000840 9:71447218-71447240 AGCTCGGGGTGGGGGGAAGTGGG - Intergenic
1055600901 9:77917365-77917387 AAGGAGGGTGGGGGGGAAGAAGG + Intronic
1055906302 9:81297253-81297275 AGGTATGGGAGGGAGGAAGTAGG + Intergenic
1056092418 9:83217790-83217812 GAGTTGGGGGGTGGGGAAGTGGG + Intergenic
1056268407 9:84922826-84922848 ATGAAGGAGTGGGGGAAAGTAGG + Intronic
1056665126 9:88575612-88575634 AAGTGGGGTTGGGAGGAAGGTGG + Intronic
1056671114 9:88627588-88627610 AAGGAGGATTGGGGGGAAGGTGG + Intergenic
1056766557 9:89447774-89447796 AAGTGGTGGTGGGGGGCAGTGGG - Intronic
1056802856 9:89705656-89705678 TTGAAGGGGTTGGGGGAAGTGGG + Intergenic
1057040600 9:91844875-91844897 AAGGCGGGGCGGGGGGAAGGGGG + Intronic
1057260001 9:93577699-93577721 AAGATGGGGAGGGGGGAAGGAGG + Intronic
1057313873 9:93956996-93957018 GAGTGGGGGTGGGGGGCAGGTGG + Intergenic
1057978173 9:99629056-99629078 AAGGATGGGTGGGGGGGAGGGGG + Intergenic
1058085252 9:100741266-100741288 AAGTTGGGGTATGGGGAAGGTGG - Intergenic
1059646035 9:116268837-116268859 AAGTAGGGGTGGGGGGGTAGGGG + Intronic
1059671178 9:116493784-116493806 CAGTGGGAGTGGGGGGATGTGGG + Intronic
1059874368 9:118617877-118617899 AAGAAGAGGTGGTAGGAAGTGGG - Intergenic
1061074635 9:128333669-128333691 AAGCAGGGGATGGGGGAGGTAGG - Exonic
1061192130 9:129088126-129088148 AGCTGGGGGTGGGGGGAGGTGGG + Intronic
1061382189 9:130265417-130265439 AGGCAGGGGTGGGGGGAGTTGGG + Intergenic
1061416084 9:130447594-130447616 AAGGAGGGCTGGAGGGCAGTGGG + Intronic
1061633137 9:131886420-131886442 CAGTGGGGGTAGGGAGAAGTGGG - Intronic
1061680019 9:132238346-132238368 ACGTAGGGGTGGGGTGCAGGAGG + Intronic
1062697944 9:137884951-137884973 GAGGAGGGGGGGGGGGAAGAGGG - Intronic
1185492196 X:526244-526266 CAGCAGGGGTGGGGGGACGGCGG + Intergenic
1185550884 X:981572-981594 AAGATGGGGCGGGGGGAGGTGGG - Intergenic
1186206359 X:7204823-7204845 AAGGAGGGGAGGAGGGAAGAAGG - Intergenic
1186351781 X:8747530-8747552 AATTAGCGGTGGGGGGAGGGGGG - Intergenic
1186490815 X:9970586-9970608 AAGAAGGGAGGGAGGGAAGTAGG - Intergenic
1186497486 X:10023301-10023323 ATGTGGGGGTGGGGAGAGGTAGG + Intronic
1186785801 X:12955155-12955177 AGGAAGGGGTGAGGGGAAGTAGG - Intergenic
1187095400 X:16142760-16142782 GAATAAGGGTGGTGGGAAGTTGG - Intronic
1187413993 X:19076275-19076297 AAGCAAGGGTGAGGGGAAGAGGG + Intronic
1187464997 X:19519207-19519229 CAGTGGGGCTGGGGGGAGGTAGG - Intergenic
1187516120 X:19972648-19972670 AAGCAGGGGAGGGGAGAAGTGGG - Intergenic
1187557077 X:20362351-20362373 AAGCAGGGAAGCGGGGAAGTGGG - Intergenic
1187567484 X:20465860-20465882 AAGTGTGGGTGGTGGAAAGTAGG + Intergenic
1188150024 X:26661749-26661771 AACTAGGGGAGGTGGGAAGGAGG + Intergenic
1188307008 X:28571157-28571179 GAGTTGGGGTGCGGGGAATTAGG + Intergenic
1188475252 X:30585424-30585446 AAATACGGGTGGGGGGAGGGGGG - Intergenic
1189052087 X:37656461-37656483 ATAAAGGGGTTGGGGGAAGTAGG - Intronic
1189098447 X:38164050-38164072 AAGAAGGGGTGGTGAGAAGAAGG - Intronic
1189333240 X:40155485-40155507 AAGGAGGAGTGGGAGGAAGTGGG + Intronic
1189351117 X:40276545-40276567 CAGTGGGGGTGGGAGGAATTAGG + Intergenic
1189527987 X:41846452-41846474 TAGTAGGGGTTGGGGAAAGTAGG + Intronic
1189722369 X:43933323-43933345 AAGTCAGGGTGTGGGGAATTGGG + Intergenic
1189761347 X:44324545-44324567 ATGCAGGGGTTGGGGGAGGTGGG - Intronic
1190133063 X:47768764-47768786 AGGTGGGGGTGGGGGGGACTGGG - Intergenic
1190231778 X:48587791-48587813 TAGTGGGGGTGGGAGGAGGTGGG - Intergenic
1190266251 X:48828884-48828906 AAGGAGAGATGGGGGGACGTGGG + Exonic
1190368817 X:49722522-49722544 AGGGTGGGGTGGGAGGAAGTGGG + Intergenic
1190432833 X:50394232-50394254 CAGTGGGGGTGGGAGGAGGTGGG + Intronic
1190604692 X:52128621-52128643 AGGCAGGGGTGTGGGGGAGTGGG - Intergenic
1190931020 X:54949850-54949872 AAGTAGGGGTTGTGGGATTTGGG + Intronic
1190985088 X:55492547-55492569 GGGTGGGGGTGGGGGGGAGTTGG - Intergenic
1191852597 X:65596693-65596715 ATGGAGGGGTGGGGGGAATGAGG + Intronic
1191882976 X:65860685-65860707 AAGGATGGGTGGGGAGAGGTAGG + Intergenic
1192273957 X:69611244-69611266 GAAGAGGGGAGGGGGGAAGTAGG - Intergenic
1192567124 X:72174287-72174309 TAGTATGGGTGGGGGACAGTGGG - Intergenic
1193685096 X:84568149-84568171 TGGGAGGGGTGGGGGGTAGTGGG - Intergenic
1194167028 X:90529875-90529897 AAGGCGGGGTGGCGGGGAGTGGG + Intergenic
1194227734 X:91282026-91282048 TAGTGGGGGTGGGAGGAGGTGGG - Intergenic
1195312879 X:103650334-103650356 TAGTAGGGGAGGTGGGGAGTGGG + Intergenic
1195329682 X:103786755-103786777 AACAAGGGGTGGGGGAAAATTGG + Intronic
1195923401 X:110003357-110003379 AAGCAGGGGTCAGGGGAAGCCGG - Intronic
1196348408 X:114696325-114696347 AAGTAGAGGTGGAAGGAAGAAGG - Intronic
1197547278 X:127840375-127840397 AGGGAGTGGTGAGGGGAAGTAGG + Intergenic
1197867933 X:131038196-131038218 AAGGTGGGGTGGGGGGAGGGGGG + Intergenic
1198253906 X:134908446-134908468 AAGGAGGGGAGGGGAGAAGAGGG - Intronic
1198770009 X:140120463-140120485 GAGTAGTGTTGGGAGGAAGTGGG - Intergenic
1198934778 X:141894914-141894936 CCGAAGGGGTGGGAGGAAGTTGG + Intronic
1198956584 X:142137924-142137946 AGGCAGGGGTGGGGGGCGGTGGG + Intergenic
1199102200 X:143815543-143815565 TAGCGGGGGTGGGGGTAAGTGGG + Intergenic
1200096816 X:153668466-153668488 ACGTAGGGGTGAGGGCAGGTGGG + Intergenic
1200138223 X:153885248-153885270 AGGTAGGGGTGAGGGAAGGTGGG - Intronic
1200147136 X:153932200-153932222 AAGTGGGATTGGGGGGAAGGAGG - Intronic
1200513296 Y:4107650-4107672 AAGGCGGGGTGGCGGGGAGTCGG + Intergenic
1201189055 Y:11430683-11430705 AGGTAAGGGTGGGGGTAAGCTGG - Intergenic
1202051074 Y:20781437-20781459 AAAGAGGGGAGGAGGGAAGTGGG - Intergenic