ID: 901887000

View in Genome Browser
Species Human (GRCh38)
Location 1:12230257-12230279
Sequence GGCCGGACGACGGGGCCCCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 127
Summary {0: 1, 1: 0, 2: 2, 3: 12, 4: 112}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
901887000_901887011 7 Left 901887000 1:12230257-12230279 CCTGGGGGCCCCGTCGTCCGGCC 0: 1
1: 0
2: 2
3: 12
4: 112
Right 901887011 1:12230287-12230309 GAGCCCCTCGGGGTAACCCTGGG 0: 1
1: 0
2: 2
3: 6
4: 71
901887000_901887008 -3 Left 901887000 1:12230257-12230279 CCTGGGGGCCCCGTCGTCCGGCC 0: 1
1: 0
2: 2
3: 12
4: 112
Right 901887008 1:12230277-12230299 GCCTCGGTCTGAGCCCCTCGGGG 0: 1
1: 0
2: 0
3: 10
4: 218
901887000_901887010 6 Left 901887000 1:12230257-12230279 CCTGGGGGCCCCGTCGTCCGGCC 0: 1
1: 0
2: 2
3: 12
4: 112
Right 901887010 1:12230286-12230308 TGAGCCCCTCGGGGTAACCCTGG 0: 1
1: 0
2: 1
3: 17
4: 93
901887000_901887018 24 Left 901887000 1:12230257-12230279 CCTGGGGGCCCCGTCGTCCGGCC 0: 1
1: 0
2: 2
3: 12
4: 112
Right 901887018 1:12230304-12230326 CCTGGGCGTCTGCTCCCCCCGGG 0: 1
1: 0
2: 2
3: 29
4: 268
901887000_901887006 -5 Left 901887000 1:12230257-12230279 CCTGGGGGCCCCGTCGTCCGGCC 0: 1
1: 0
2: 2
3: 12
4: 112
Right 901887006 1:12230275-12230297 CGGCCTCGGTCTGAGCCCCTCGG 0: 1
1: 0
2: 0
3: 16
4: 191
901887000_901887007 -4 Left 901887000 1:12230257-12230279 CCTGGGGGCCCCGTCGTCCGGCC 0: 1
1: 0
2: 2
3: 12
4: 112
Right 901887007 1:12230276-12230298 GGCCTCGGTCTGAGCCCCTCGGG 0: 1
1: 0
2: 2
3: 7
4: 161
901887000_901887016 23 Left 901887000 1:12230257-12230279 CCTGGGGGCCCCGTCGTCCGGCC 0: 1
1: 0
2: 2
3: 12
4: 112
Right 901887016 1:12230303-12230325 CCCTGGGCGTCTGCTCCCCCCGG 0: 1
1: 0
2: 1
3: 22
4: 303

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
901887000 Original CRISPR GGCCGGACGACGGGGCCCCC AGG (reversed) Intronic