ID: 901887002

View in Genome Browser
Species Human (GRCh38)
Location 1:12230265-12230287
Sequence CAGACCGAGGCCGGACGACG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 52
Summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 48}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
901887002_901887010 -2 Left 901887002 1:12230265-12230287 CCCCGTCGTCCGGCCTCGGTCTG 0: 1
1: 0
2: 0
3: 3
4: 48
Right 901887010 1:12230286-12230308 TGAGCCCCTCGGGGTAACCCTGG 0: 1
1: 0
2: 1
3: 17
4: 93
901887002_901887016 15 Left 901887002 1:12230265-12230287 CCCCGTCGTCCGGCCTCGGTCTG 0: 1
1: 0
2: 0
3: 3
4: 48
Right 901887016 1:12230303-12230325 CCCTGGGCGTCTGCTCCCCCCGG 0: 1
1: 0
2: 1
3: 22
4: 303
901887002_901887018 16 Left 901887002 1:12230265-12230287 CCCCGTCGTCCGGCCTCGGTCTG 0: 1
1: 0
2: 0
3: 3
4: 48
Right 901887018 1:12230304-12230326 CCTGGGCGTCTGCTCCCCCCGGG 0: 1
1: 0
2: 2
3: 29
4: 268
901887002_901887011 -1 Left 901887002 1:12230265-12230287 CCCCGTCGTCCGGCCTCGGTCTG 0: 1
1: 0
2: 0
3: 3
4: 48
Right 901887011 1:12230287-12230309 GAGCCCCTCGGGGTAACCCTGGG 0: 1
1: 0
2: 2
3: 6
4: 71

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
901887002 Original CRISPR CAGACCGAGGCCGGACGACG GGG (reversed) Intronic