ID: 901887003

View in Genome Browser
Species Human (GRCh38)
Location 1:12230266-12230288
Sequence TCAGACCGAGGCCGGACGAC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 39
Summary {0: 1, 1: 0, 2: 0, 3: 0, 4: 38}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
901887003_901887011 -2 Left 901887003 1:12230266-12230288 CCCGTCGTCCGGCCTCGGTCTGA 0: 1
1: 0
2: 0
3: 0
4: 38
Right 901887011 1:12230287-12230309 GAGCCCCTCGGGGTAACCCTGGG 0: 1
1: 0
2: 2
3: 6
4: 71
901887003_901887010 -3 Left 901887003 1:12230266-12230288 CCCGTCGTCCGGCCTCGGTCTGA 0: 1
1: 0
2: 0
3: 0
4: 38
Right 901887010 1:12230286-12230308 TGAGCCCCTCGGGGTAACCCTGG 0: 1
1: 0
2: 1
3: 17
4: 93
901887003_901887016 14 Left 901887003 1:12230266-12230288 CCCGTCGTCCGGCCTCGGTCTGA 0: 1
1: 0
2: 0
3: 0
4: 38
Right 901887016 1:12230303-12230325 CCCTGGGCGTCTGCTCCCCCCGG 0: 1
1: 0
2: 1
3: 22
4: 303
901887003_901887018 15 Left 901887003 1:12230266-12230288 CCCGTCGTCCGGCCTCGGTCTGA 0: 1
1: 0
2: 0
3: 0
4: 38
Right 901887018 1:12230304-12230326 CCTGGGCGTCTGCTCCCCCCGGG 0: 1
1: 0
2: 2
3: 29
4: 268

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
901887003 Original CRISPR TCAGACCGAGGCCGGACGAC GGG (reversed) Intronic