ID: 901887005

View in Genome Browser
Species Human (GRCh38)
Location 1:12230274-12230296
Sequence CGAGGGGCTCAGACCGAGGC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 192
Summary {0: 1, 1: 0, 2: 0, 3: 13, 4: 178}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
901887005_901887025 29 Left 901887005 1:12230274-12230296 CCGGCCTCGGTCTGAGCCCCTCG 0: 1
1: 0
2: 0
3: 13
4: 178
Right 901887025 1:12230326-12230348 GCCCCAAGCCCGCCACCTCCGGG 0: 1
1: 0
2: 2
3: 41
4: 410
901887005_901887024 28 Left 901887005 1:12230274-12230296 CCGGCCTCGGTCTGAGCCCCTCG 0: 1
1: 0
2: 0
3: 13
4: 178
Right 901887024 1:12230325-12230347 GGCCCCAAGCCCGCCACCTCCGG 0: 1
1: 0
2: 1
3: 17
4: 215
901887005_901887016 6 Left 901887005 1:12230274-12230296 CCGGCCTCGGTCTGAGCCCCTCG 0: 1
1: 0
2: 0
3: 13
4: 178
Right 901887016 1:12230303-12230325 CCCTGGGCGTCTGCTCCCCCCGG 0: 1
1: 0
2: 1
3: 22
4: 303
901887005_901887027 30 Left 901887005 1:12230274-12230296 CCGGCCTCGGTCTGAGCCCCTCG 0: 1
1: 0
2: 0
3: 13
4: 178
Right 901887027 1:12230327-12230349 CCCCAAGCCCGCCACCTCCGGGG 0: 1
1: 0
2: 0
3: 24
4: 251
901887005_901887011 -10 Left 901887005 1:12230274-12230296 CCGGCCTCGGTCTGAGCCCCTCG 0: 1
1: 0
2: 0
3: 13
4: 178
Right 901887011 1:12230287-12230309 GAGCCCCTCGGGGTAACCCTGGG 0: 1
1: 0
2: 2
3: 6
4: 71
901887005_901887018 7 Left 901887005 1:12230274-12230296 CCGGCCTCGGTCTGAGCCCCTCG 0: 1
1: 0
2: 0
3: 13
4: 178
Right 901887018 1:12230304-12230326 CCTGGGCGTCTGCTCCCCCCGGG 0: 1
1: 0
2: 2
3: 29
4: 268

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
901887005 Original CRISPR CGAGGGGCTCAGACCGAGGC CGG (reversed) Intronic