ID: 901887009

View in Genome Browser
Species Human (GRCh38)
Location 1:12230278-12230300
Sequence ACCCCGAGGGGCTCAGACCG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 165
Summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 154}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
901887009_901887018 3 Left 901887009 1:12230278-12230300 CCTCGGTCTGAGCCCCTCGGGGT 0: 1
1: 0
2: 0
3: 10
4: 154
Right 901887018 1:12230304-12230326 CCTGGGCGTCTGCTCCCCCCGGG 0: 1
1: 0
2: 2
3: 29
4: 268
901887009_901887025 25 Left 901887009 1:12230278-12230300 CCTCGGTCTGAGCCCCTCGGGGT 0: 1
1: 0
2: 0
3: 10
4: 154
Right 901887025 1:12230326-12230348 GCCCCAAGCCCGCCACCTCCGGG 0: 1
1: 0
2: 2
3: 41
4: 410
901887009_901887024 24 Left 901887009 1:12230278-12230300 CCTCGGTCTGAGCCCCTCGGGGT 0: 1
1: 0
2: 0
3: 10
4: 154
Right 901887024 1:12230325-12230347 GGCCCCAAGCCCGCCACCTCCGG 0: 1
1: 0
2: 1
3: 17
4: 215
901887009_901887016 2 Left 901887009 1:12230278-12230300 CCTCGGTCTGAGCCCCTCGGGGT 0: 1
1: 0
2: 0
3: 10
4: 154
Right 901887016 1:12230303-12230325 CCCTGGGCGTCTGCTCCCCCCGG 0: 1
1: 0
2: 1
3: 22
4: 303
901887009_901887027 26 Left 901887009 1:12230278-12230300 CCTCGGTCTGAGCCCCTCGGGGT 0: 1
1: 0
2: 0
3: 10
4: 154
Right 901887027 1:12230327-12230349 CCCCAAGCCCGCCACCTCCGGGG 0: 1
1: 0
2: 0
3: 24
4: 251

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
901887009 Original CRISPR ACCCCGAGGGGCTCAGACCG AGG (reversed) Intronic