ID: 901887011

View in Genome Browser
Species Human (GRCh38)
Location 1:12230287-12230309
Sequence GAGCCCCTCGGGGTAACCCT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 80
Summary {0: 1, 1: 0, 2: 2, 3: 6, 4: 71}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
901887005_901887011 -10 Left 901887005 1:12230274-12230296 CCGGCCTCGGTCTGAGCCCCTCG 0: 1
1: 0
2: 0
3: 13
4: 178
Right 901887011 1:12230287-12230309 GAGCCCCTCGGGGTAACCCTGGG 0: 1
1: 0
2: 2
3: 6
4: 71
901887000_901887011 7 Left 901887000 1:12230257-12230279 CCTGGGGGCCCCGTCGTCCGGCC 0: 1
1: 0
2: 2
3: 12
4: 112
Right 901887011 1:12230287-12230309 GAGCCCCTCGGGGTAACCCTGGG 0: 1
1: 0
2: 2
3: 6
4: 71
901887002_901887011 -1 Left 901887002 1:12230265-12230287 CCCCGTCGTCCGGCCTCGGTCTG 0: 1
1: 0
2: 0
3: 3
4: 48
Right 901887011 1:12230287-12230309 GAGCCCCTCGGGGTAACCCTGGG 0: 1
1: 0
2: 2
3: 6
4: 71
901887004_901887011 -3 Left 901887004 1:12230267-12230289 CCGTCGTCCGGCCTCGGTCTGAG 0: 1
1: 0
2: 1
3: 2
4: 49
Right 901887011 1:12230287-12230309 GAGCCCCTCGGGGTAACCCTGGG 0: 1
1: 0
2: 2
3: 6
4: 71
901886994_901887011 30 Left 901886994 1:12230234-12230256 CCTGGGGAGAGCGATGCTAGGAG 0: 1
1: 0
2: 1
3: 13
4: 112
Right 901887011 1:12230287-12230309 GAGCCCCTCGGGGTAACCCTGGG 0: 1
1: 0
2: 2
3: 6
4: 71
901887003_901887011 -2 Left 901887003 1:12230266-12230288 CCCGTCGTCCGGCCTCGGTCTGA 0: 1
1: 0
2: 0
3: 0
4: 38
Right 901887011 1:12230287-12230309 GAGCCCCTCGGGGTAACCCTGGG 0: 1
1: 0
2: 2
3: 6
4: 71

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
901887011 Original CRISPR GAGCCCCTCGGGGTAACCCT GGG Intronic