ID: 901887013

View in Genome Browser
Species Human (GRCh38)
Location 1:12230291-12230313
Sequence GACGCCCAGGGTTACCCCGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 47
Summary {0: 1, 1: 0, 2: 0, 3: 2, 4: 44}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
901887013_901887018 -10 Left 901887013 1:12230291-12230313 CCCTCGGGGTAACCCTGGGCGTC 0: 1
1: 0
2: 0
3: 2
4: 44
Right 901887018 1:12230304-12230326 CCTGGGCGTCTGCTCCCCCCGGG 0: 1
1: 0
2: 2
3: 29
4: 268
901887013_901887027 13 Left 901887013 1:12230291-12230313 CCCTCGGGGTAACCCTGGGCGTC 0: 1
1: 0
2: 0
3: 2
4: 44
Right 901887027 1:12230327-12230349 CCCCAAGCCCGCCACCTCCGGGG 0: 1
1: 0
2: 0
3: 24
4: 251
901887013_901887024 11 Left 901887013 1:12230291-12230313 CCCTCGGGGTAACCCTGGGCGTC 0: 1
1: 0
2: 0
3: 2
4: 44
Right 901887024 1:12230325-12230347 GGCCCCAAGCCCGCCACCTCCGG 0: 1
1: 0
2: 1
3: 17
4: 215
901887013_901887025 12 Left 901887013 1:12230291-12230313 CCCTCGGGGTAACCCTGGGCGTC 0: 1
1: 0
2: 0
3: 2
4: 44
Right 901887025 1:12230326-12230348 GCCCCAAGCCCGCCACCTCCGGG 0: 1
1: 0
2: 2
3: 41
4: 410

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
901887013 Original CRISPR GACGCCCAGGGTTACCCCGA GGG (reversed) Intronic