ID: 901887014

View in Genome Browser
Species Human (GRCh38)
Location 1:12230292-12230314
Sequence AGACGCCCAGGGTTACCCCG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 66
Summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 61}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
901887014_901887027 12 Left 901887014 1:12230292-12230314 CCTCGGGGTAACCCTGGGCGTCT 0: 1
1: 0
2: 0
3: 4
4: 61
Right 901887027 1:12230327-12230349 CCCCAAGCCCGCCACCTCCGGGG 0: 1
1: 0
2: 0
3: 24
4: 251
901887014_901887024 10 Left 901887014 1:12230292-12230314 CCTCGGGGTAACCCTGGGCGTCT 0: 1
1: 0
2: 0
3: 4
4: 61
Right 901887024 1:12230325-12230347 GGCCCCAAGCCCGCCACCTCCGG 0: 1
1: 0
2: 1
3: 17
4: 215
901887014_901887025 11 Left 901887014 1:12230292-12230314 CCTCGGGGTAACCCTGGGCGTCT 0: 1
1: 0
2: 0
3: 4
4: 61
Right 901887025 1:12230326-12230348 GCCCCAAGCCCGCCACCTCCGGG 0: 1
1: 0
2: 2
3: 41
4: 410

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
901887014 Original CRISPR AGACGCCCAGGGTTACCCCG AGG (reversed) Intronic