ID: 901887016

View in Genome Browser
Species Human (GRCh38)
Location 1:12230303-12230325
Sequence CCCTGGGCGTCTGCTCCCCC CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 327
Summary {0: 1, 1: 0, 2: 1, 3: 22, 4: 303}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
901887009_901887016 2 Left 901887009 1:12230278-12230300 CCTCGGTCTGAGCCCCTCGGGGT 0: 1
1: 0
2: 0
3: 10
4: 154
Right 901887016 1:12230303-12230325 CCCTGGGCGTCTGCTCCCCCCGG 0: 1
1: 0
2: 1
3: 22
4: 303
901887005_901887016 6 Left 901887005 1:12230274-12230296 CCGGCCTCGGTCTGAGCCCCTCG 0: 1
1: 0
2: 0
3: 13
4: 178
Right 901887016 1:12230303-12230325 CCCTGGGCGTCTGCTCCCCCCGG 0: 1
1: 0
2: 1
3: 22
4: 303
901887002_901887016 15 Left 901887002 1:12230265-12230287 CCCCGTCGTCCGGCCTCGGTCTG 0: 1
1: 0
2: 0
3: 3
4: 48
Right 901887016 1:12230303-12230325 CCCTGGGCGTCTGCTCCCCCCGG 0: 1
1: 0
2: 1
3: 22
4: 303
901887004_901887016 13 Left 901887004 1:12230267-12230289 CCGTCGTCCGGCCTCGGTCTGAG 0: 1
1: 0
2: 1
3: 2
4: 49
Right 901887016 1:12230303-12230325 CCCTGGGCGTCTGCTCCCCCCGG 0: 1
1: 0
2: 1
3: 22
4: 303
901887003_901887016 14 Left 901887003 1:12230266-12230288 CCCGTCGTCCGGCCTCGGTCTGA 0: 1
1: 0
2: 0
3: 0
4: 38
Right 901887016 1:12230303-12230325 CCCTGGGCGTCTGCTCCCCCCGG 0: 1
1: 0
2: 1
3: 22
4: 303
901887000_901887016 23 Left 901887000 1:12230257-12230279 CCTGGGGGCCCCGTCGTCCGGCC 0: 1
1: 0
2: 2
3: 12
4: 112
Right 901887016 1:12230303-12230325 CCCTGGGCGTCTGCTCCCCCCGG 0: 1
1: 0
2: 1
3: 22
4: 303
901887012_901887016 -10 Left 901887012 1:12230290-12230312 CCCCTCGGGGTAACCCTGGGCGT 0: 1
1: 0
2: 0
3: 11
4: 41
Right 901887016 1:12230303-12230325 CCCTGGGCGTCTGCTCCCCCCGG 0: 1
1: 0
2: 1
3: 22
4: 303

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
901887016 Original CRISPR CCCTGGGCGTCTGCTCCCCC CGG Intronic