ID: 901887024

View in Genome Browser
Species Human (GRCh38)
Location 1:12230325-12230347
Sequence GGCCCCAAGCCCGCCACCTC CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 234
Summary {0: 1, 1: 0, 2: 1, 3: 17, 4: 215}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
901887005_901887024 28 Left 901887005 1:12230274-12230296 CCGGCCTCGGTCTGAGCCCCTCG 0: 1
1: 0
2: 0
3: 13
4: 178
Right 901887024 1:12230325-12230347 GGCCCCAAGCCCGCCACCTCCGG 0: 1
1: 0
2: 1
3: 17
4: 215
901887012_901887024 12 Left 901887012 1:12230290-12230312 CCCCTCGGGGTAACCCTGGGCGT 0: 1
1: 0
2: 0
3: 11
4: 41
Right 901887024 1:12230325-12230347 GGCCCCAAGCCCGCCACCTCCGG 0: 1
1: 0
2: 1
3: 17
4: 215
901887014_901887024 10 Left 901887014 1:12230292-12230314 CCTCGGGGTAACCCTGGGCGTCT 0: 1
1: 0
2: 0
3: 4
4: 61
Right 901887024 1:12230325-12230347 GGCCCCAAGCCCGCCACCTCCGG 0: 1
1: 0
2: 1
3: 17
4: 215
901887017_901887024 -2 Left 901887017 1:12230304-12230326 CCTGGGCGTCTGCTCCCCCCGGG 0: 1
1: 0
2: 0
3: 10
4: 197
Right 901887024 1:12230325-12230347 GGCCCCAAGCCCGCCACCTCCGG 0: 1
1: 0
2: 1
3: 17
4: 215
901887009_901887024 24 Left 901887009 1:12230278-12230300 CCTCGGTCTGAGCCCCTCGGGGT 0: 1
1: 0
2: 0
3: 10
4: 154
Right 901887024 1:12230325-12230347 GGCCCCAAGCCCGCCACCTCCGG 0: 1
1: 0
2: 1
3: 17
4: 215
901887013_901887024 11 Left 901887013 1:12230291-12230313 CCCTCGGGGTAACCCTGGGCGTC 0: 1
1: 0
2: 0
3: 2
4: 44
Right 901887024 1:12230325-12230347 GGCCCCAAGCCCGCCACCTCCGG 0: 1
1: 0
2: 1
3: 17
4: 215
901887015_901887024 -1 Left 901887015 1:12230303-12230325 CCCTGGGCGTCTGCTCCCCCCGG 0: 1
1: 0
2: 1
3: 7
4: 145
Right 901887024 1:12230325-12230347 GGCCCCAAGCCCGCCACCTCCGG 0: 1
1: 0
2: 1
3: 17
4: 215

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
901887024 Original CRISPR GGCCCCAAGCCCGCCACCTC CGG Intronic