ID: 901887027

View in Genome Browser
Species Human (GRCh38)
Location 1:12230327-12230349
Sequence CCCCAAGCCCGCCACCTCCG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 276
Summary {0: 1, 1: 0, 2: 0, 3: 24, 4: 251}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
901887014_901887027 12 Left 901887014 1:12230292-12230314 CCTCGGGGTAACCCTGGGCGTCT 0: 1
1: 0
2: 0
3: 4
4: 61
Right 901887027 1:12230327-12230349 CCCCAAGCCCGCCACCTCCGGGG 0: 1
1: 0
2: 0
3: 24
4: 251
901887017_901887027 0 Left 901887017 1:12230304-12230326 CCTGGGCGTCTGCTCCCCCCGGG 0: 1
1: 0
2: 0
3: 10
4: 197
Right 901887027 1:12230327-12230349 CCCCAAGCCCGCCACCTCCGGGG 0: 1
1: 0
2: 0
3: 24
4: 251
901887005_901887027 30 Left 901887005 1:12230274-12230296 CCGGCCTCGGTCTGAGCCCCTCG 0: 1
1: 0
2: 0
3: 13
4: 178
Right 901887027 1:12230327-12230349 CCCCAAGCCCGCCACCTCCGGGG 0: 1
1: 0
2: 0
3: 24
4: 251
901887012_901887027 14 Left 901887012 1:12230290-12230312 CCCCTCGGGGTAACCCTGGGCGT 0: 1
1: 0
2: 0
3: 11
4: 41
Right 901887027 1:12230327-12230349 CCCCAAGCCCGCCACCTCCGGGG 0: 1
1: 0
2: 0
3: 24
4: 251
901887009_901887027 26 Left 901887009 1:12230278-12230300 CCTCGGTCTGAGCCCCTCGGGGT 0: 1
1: 0
2: 0
3: 10
4: 154
Right 901887027 1:12230327-12230349 CCCCAAGCCCGCCACCTCCGGGG 0: 1
1: 0
2: 0
3: 24
4: 251
901887015_901887027 1 Left 901887015 1:12230303-12230325 CCCTGGGCGTCTGCTCCCCCCGG 0: 1
1: 0
2: 1
3: 7
4: 145
Right 901887027 1:12230327-12230349 CCCCAAGCCCGCCACCTCCGGGG 0: 1
1: 0
2: 0
3: 24
4: 251
901887013_901887027 13 Left 901887013 1:12230291-12230313 CCCTCGGGGTAACCCTGGGCGTC 0: 1
1: 0
2: 0
3: 2
4: 44
Right 901887027 1:12230327-12230349 CCCCAAGCCCGCCACCTCCGGGG 0: 1
1: 0
2: 0
3: 24
4: 251

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
901887027 Original CRISPR CCCCAAGCCCGCCACCTCCG GGG Intronic