ID: 901887438

View in Genome Browser
Species Human (GRCh38)
Location 1:12232490-12232512
Sequence GTGGCTGATGACTGACATGG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 220
Summary {0: 1, 1: 0, 2: 3, 3: 18, 4: 198}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
901887431_901887438 5 Left 901887431 1:12232462-12232484 CCATGGCAAGTCTGTAGTGCCTG 0: 1
1: 0
2: 2
3: 9
4: 154
Right 901887438 1:12232490-12232512 GTGGCTGATGACTGACATGGTGG 0: 1
1: 0
2: 3
3: 18
4: 198
901887430_901887438 20 Left 901887430 1:12232447-12232469 CCAGTGGGATGCGTGCCATGGCA 0: 1
1: 0
2: 1
3: 8
4: 62
Right 901887438 1:12232490-12232512 GTGGCTGATGACTGACATGGTGG 0: 1
1: 0
2: 3
3: 18
4: 198

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
901887438 Original CRISPR GTGGCTGATGACTGACATGG TGG Intronic
900164863 1:1240600-1240622 GTGGCTGGGGGCTGGCATGGGGG - Intergenic
900294077 1:1939923-1939945 GTGACTGCTCCCTGACATGGCGG + Intronic
901094527 1:6667519-6667541 GTGGCTGATGGCTACCAGGGAGG + Intronic
901804279 1:11728086-11728108 GTGGCTCATTACAGGCATGGTGG - Intergenic
901887438 1:12232490-12232512 GTGGCTGATGACTGACATGGTGG + Intronic
903040136 1:20523299-20523321 GTGGCTGAGGCCAGGCATGGTGG - Intergenic
904615229 1:31745952-31745974 GGGGCTGGTGACTGACGTGGAGG - Intronic
907216200 1:52866336-52866358 GTAACTGATGACTGCCATGCAGG - Intronic
907550026 1:55297383-55297405 TGGGCTGATGACTGCCAGGGTGG + Intergenic
907938660 1:59065938-59065960 GTGGCAGATGAGTCAAATGGTGG + Intergenic
908261833 1:62345100-62345122 GTGGCTGATCAGTGGCATGTTGG + Intergenic
910085834 1:83401247-83401269 GTTGCTCATTACTGTCATGGTGG + Intergenic
910369999 1:86505329-86505351 GAGGGTGATGACTGGCAAGGAGG - Intergenic
911708728 1:101044430-101044452 GTGGCTGGTGTCTGAAATGAGGG - Intergenic
911715754 1:101130938-101130960 GTGGGTGCTGACCGATATGGAGG - Intergenic
912307309 1:108582023-108582045 ATGGTTGCTGACTGACAGGGTGG - Intronic
912332116 1:108829548-108829570 AAAGCTGATGACTGACATGGTGG + Intronic
912556778 1:110521941-110521963 GTGGCTGATGAGGGTCAGGGTGG + Intergenic
912560240 1:110546199-110546221 GTTGCTGTTTACTGACATTGTGG - Intergenic
913084705 1:115426071-115426093 TTAGCTCATGACTGACATGTGGG + Intergenic
913444942 1:118941141-118941163 GTGGCTGATGTCGGAGGTGGTGG - Intronic
916958572 1:169865862-169865884 GTGGCTGATGAATGAGAAGCAGG - Intronic
918998098 1:191789132-191789154 GTGGATGATGAGTGTAATGGAGG + Intergenic
919432746 1:197517227-197517249 GTGGCTGTTGCCTTACTTGGGGG + Intronic
922250198 1:223842406-223842428 GTGGCTGGTGACTGCCATGCTGG + Intronic
922276275 1:224081856-224081878 GTAGCTGGTGCCTGACATGCTGG - Intergenic
923423874 1:233848489-233848511 GTGCCTGATGACTGCCAAGTGGG - Intergenic
924552096 1:245088584-245088606 GTGGCTGCTGACTGCCTTGCAGG - Intronic
924626322 1:245698967-245698989 GTGGCTGATGAAGGAGCTGGAGG + Exonic
1068275134 10:54784962-54784984 AGGACTGATGACTGACATGATGG - Intronic
1071468678 10:85963061-85963083 GTTGCTGATGCCTGAACTGGAGG + Intronic
1072250363 10:93577463-93577485 GAGTCTAATGAGTGACATGGAGG - Intronic
1072607050 10:96993139-96993161 GAGGATCATGACTAACATGGGGG - Intergenic
1075381499 10:122022535-122022557 GTGGCTCATGCCTGTAATGGTGG - Intronic
1076016347 10:127030375-127030397 GTGGCTGGTGACAGACAGCGAGG - Intronic
1077202672 11:1319418-1319440 GGGGCTGATGACTGTTGTGGGGG - Intergenic
1078060071 11:8037624-8037646 ATGGCTGAGGATGGACATGGAGG + Intronic
1080403274 11:31956389-31956411 GTTTCTGATGGCTGACTTGGAGG - Intronic
1080454261 11:32403984-32404006 GTGACTGAGGCCGGACATGGTGG + Intronic
1080986582 11:37474226-37474248 GTGGAAGAGGACTGATATGGTGG - Intergenic
1086003027 11:82002885-82002907 CTGGCTGATGACTGAAAATGTGG - Intergenic
1087694254 11:101357701-101357723 GTGGCAGAAGGCTGACATGTGGG + Intergenic
1088849746 11:113695188-113695210 GTGGCTGGTGAGGGACATGATGG + Intronic
1089195757 11:116693250-116693272 GGGGCTGATGAATGAGATGTAGG - Intergenic
1090669126 11:128933893-128933915 GCTGATGATGACTGCCATGGTGG + Intergenic
1091685274 12:2557013-2557035 GTGGCTGAAGACAGAGCTGGTGG - Intronic
1091961961 12:4703418-4703440 GTGGTTGTTGACTGAAATGAAGG + Intronic
1092438474 12:8474146-8474168 GAGGCTGATGTCCGGCATGGTGG + Intronic
1095225274 12:39671594-39671616 GTGGGTGATGATAGTCATGGTGG + Intronic
1095651726 12:44619125-44619147 GTGGCTCTTGACAGACAGGGAGG + Intronic
1095962502 12:47844412-47844434 GTGGCTGCTGACTGATGTTGAGG - Exonic
1096408814 12:51362618-51362640 GTGCCTGGTCACTGGCATGGGGG + Intronic
1099329614 12:81267146-81267168 ATGGCTAATAACAGACATGGAGG - Intronic
1099580783 12:84444443-84444465 GTGACTGGTGTCTGACATGTGGG + Intergenic
1101415369 12:104504132-104504154 GGCGCTGATGACTGCCCTGGGGG - Intronic
1101569583 12:105940832-105940854 TTTCCTGATGACTGACATTGTGG - Intergenic
1101957753 12:109225718-109225740 GTGGCTGGTGGCTGCCATAGTGG - Intronic
1102240824 12:111323502-111323524 GAGGCTGAGGACAGGCATGGGGG + Intronic
1102830470 12:115994116-115994138 GAAGCTGATGACTGCCATAGTGG + Intronic
1103796357 12:123505891-123505913 GTGGCTGATGCCTGCCATCAGGG - Intronic
1106904594 13:34391847-34391869 GTGGCTGGCGTCTGAAATGGGGG - Intergenic
1107214009 13:37894085-37894107 GAGTCAGATGACTGACATGAGGG - Intergenic
1108754805 13:53486794-53486816 GTGGCTGTTAACTGAAATGAAGG + Intergenic
1113720843 13:112554799-112554821 GTGGCTGTTGATTGATAAGGTGG - Intronic
1114714012 14:24805820-24805842 ATAGTTGATGACAGACATGGAGG + Intergenic
1115786438 14:36831142-36831164 GTGGCTAGTGACTGCCATGTTGG - Intronic
1116934643 14:50726536-50726558 GTGGCTGATGACTGTGAGGGTGG + Intronic
1117000707 14:51368308-51368330 GTGGCTAATGACTGTCATAGTGG + Intergenic
1117618440 14:57558963-57558985 GTGGCTAATGGCTTACATGTAGG + Intergenic
1119348146 14:73943173-73943195 GTGACTGATGAGAGACACGGAGG - Intronic
1120318467 14:82928495-82928517 GTGGCTGCTTACTGATAGGGTGG + Intergenic
1122068941 14:99193057-99193079 GTGGCTGATCAGTGACAGAGAGG - Intronic
1122927901 14:104917234-104917256 ATGGCTGCTGACTGATAGGGTGG + Intergenic
1124530785 15:30503801-30503823 GTAGCTGATGTCTGAAATGAGGG + Intergenic
1124767875 15:32503894-32503916 GTAGCTGATGTCTGAAATGAGGG - Intergenic
1126514694 15:49521420-49521442 GTGGCTGACAATGGACATGGAGG + Intronic
1127480032 15:59370137-59370159 GTGGCTGAAGATTAGCATGGAGG - Intronic
1127525517 15:59789038-59789060 TTGGCTGATAACTAAAATGGGGG - Intergenic
1128661310 15:69502970-69502992 GTGGCAGCTGACGGAGATGGAGG + Intergenic
1128897814 15:71391753-71391775 GTGGCTGATGATTGAACTGCAGG + Intronic
1134411624 16:14007190-14007212 GTGGGTGATGGCTGAGAAGGTGG - Intergenic
1137266534 16:46873594-46873616 GTGGCTGGTGTCTGAAGTGGGGG + Intergenic
1138168133 16:54821644-54821666 GTGGCTGAGGCTGGACATGGTGG - Intergenic
1139926871 16:70493443-70493465 GTGGCTGGTGACTACCATGTTGG + Intronic
1139967789 16:70755243-70755265 CTGGCTGCTCACTGACCTGGTGG - Intronic
1141070307 16:80948617-80948639 GTGGCTGATGAAGGAGAGGGAGG - Intergenic
1143571204 17:7759858-7759880 GTGGCAGAAGACAGAGATGGTGG - Exonic
1144658651 17:17054193-17054215 GTGAGTGATGACAGTCATGGTGG + Intronic
1145272454 17:21412070-21412092 GAGGCTGAGGACTGACATTCTGG + Intronic
1145310662 17:21699533-21699555 GAGGCTGAGGACTGACATTCTGG + Intronic
1145834385 17:27943220-27943242 GTGGCTGAGGGCTGCCATAGTGG - Intergenic
1145923020 17:28625609-28625631 GAGCCTGATGACTGGCATGATGG - Intronic
1146690449 17:34871435-34871457 GTAGCTGATAAATGAGATGGGGG + Intergenic
1147650049 17:42056675-42056697 GTGGGAGATGACTATCATGGGGG + Intronic
1147652320 17:42069628-42069650 GTGGCTGTTGGCTGACATGGAGG - Intergenic
1149494238 17:57106930-57106952 TTGGCTGCTGTCTGACATGCAGG - Exonic
1152307011 17:79527013-79527035 GAGGCAGATGCCTGACCTGGGGG - Intergenic
1157625472 18:49047365-49047387 GTTGCTCATGACTGCAATGGAGG + Intronic
1160400174 18:78604767-78604789 GTGGCTGATATCAGCCATGGGGG + Intergenic
1165074691 19:33274120-33274142 GTGGCTGGTGTCTGCCAGGGAGG + Intergenic
1168484127 19:56746591-56746613 GAGGATGAGGAATGACATGGAGG + Intergenic
926127292 2:10279412-10279434 GGAGCTGATGGCTGAGATGGAGG + Intergenic
927776231 2:25905776-25905798 GTGACTGCTGACTGACAAAGTGG - Intergenic
929727618 2:44446696-44446718 GTGGTGGAAGACTGAGATGGAGG - Intronic
930584993 2:53258043-53258065 GAGACAGATGACTGAAATGGGGG - Intergenic
934637779 2:96006798-96006820 GTGGCAGAGGAATGACATGCTGG + Intergenic
934795882 2:97098613-97098635 GTGGCAGAGGAATGACATGCTGG - Intergenic
935418478 2:102842914-102842936 GATGCTGATGACATACATGGAGG + Intronic
939338615 2:140863679-140863701 ATGGCTAGTGACTGACATGAGGG + Intronic
942232841 2:173875925-173875947 GTGGCTCATGCCTGTAATGGCGG + Intergenic
943531767 2:189091153-189091175 GTGGCTGAAGACTGCATTGGGGG + Intronic
943655486 2:190503896-190503918 CTTGCTGATGTCTAACATGGGGG + Intronic
946400985 2:219468364-219468386 GTGGGTGCAGACTGCCATGGTGG - Intronic
948112907 2:235471415-235471437 GGGGATGAGGACTGACCTGGGGG - Intergenic
948470669 2:238175833-238175855 GTGGCTATTCACAGACATGGTGG + Intronic
948527419 2:238580275-238580297 GGAGCTGAAGACTGTCATGGAGG + Intergenic
948682812 2:239648006-239648028 GTGCCTCAAGACTGACATGGAGG + Intergenic
1170404574 20:16022709-16022731 GTTTCTCATGTCTGACATGGAGG - Intronic
1172308586 20:33899640-33899662 CTGGCTGGGGGCTGACATGGAGG + Intergenic
1172839692 20:37894893-37894915 GTGGCTCATGACTACCATAGCGG - Intergenic
1173142982 20:40500881-40500903 GTGGCTCATGGCTGCCATGCTGG + Intergenic
1174561651 20:51434772-51434794 TGGGGTGATGACTCACATGGGGG + Intronic
1175226920 20:57450078-57450100 GTTGGTGAAGAATGACATGGAGG - Intergenic
1176026201 20:62986723-62986745 GTGGCTGGAGTCTGACATGGGGG + Intergenic
1176958731 21:15135913-15135935 TTGGTTGATGAGTGACATTGAGG + Intergenic
1178304663 21:31481499-31481521 GTAGCTGGTGTCTGAAATGGGGG - Intronic
1178833119 21:36072735-36072757 GTGGGTGAGAACTGACATGGCGG + Exonic
1178839380 21:36126627-36126649 GAGGCTGTTGAGTGCCATGGGGG - Intergenic
1180157164 21:45983335-45983357 GTGGCTGAGGACAGACCGGGGGG + Intronic
1182548443 22:31088831-31088853 GTGGCAGGTGAGTGACAGGGAGG - Intronic
1182820699 22:33213562-33213584 ATGGCTGCTGACTGACAGGTTGG - Intronic
1184596459 22:45517043-45517065 GTGGCTGATGACTGATAGGGTGG + Intronic
949097225 3:99822-99844 GTGGCTGCAGGTTGACATGGAGG - Intergenic
949107678 3:220159-220181 GTGGTTGACGACTGACATGATGG + Intronic
951324698 3:21287358-21287380 GTGGGAGATAACTGACATGGGGG + Intergenic
954106891 3:48414353-48414375 GTGTCTGATGACTCACCAGGGGG + Intronic
955411922 3:58661347-58661369 CTGGCTGGTGAGAGACATGGGGG - Intronic
959488029 3:106951270-106951292 TTGGCTGAGGATTGACTTGGCGG - Intergenic
961395535 3:126585935-126585957 ATGGCTGCTGACTGACAGAGTGG + Intronic
962560966 3:136606454-136606476 GTGGCTGATGCCTGTCATTGTGG - Intronic
963703419 3:148655308-148655330 GTGGCTCAGGCCTGGCATGGTGG - Intergenic
966729029 3:183135096-183135118 TTGCCTGATGACTGCCCTGGAGG - Intronic
967900225 3:194442327-194442349 GTGGCTGATGCCTGTCATCCCGG + Intronic
968633243 4:1663589-1663611 GTGGCTGGTGGCTGCCGTGGTGG - Intronic
968633893 4:1667824-1667846 GTGGCTGATGTCTAGCCTGGAGG - Intronic
968761213 4:2443478-2443500 GTGTCAGCTGACTGGCATGGAGG - Intronic
970921462 4:21400127-21400149 GTGGGTCATGATTGACATAGAGG - Intronic
974355737 4:60810346-60810368 CTGGCTGTTGCCTTACATGGTGG - Intergenic
979429676 4:120613838-120613860 GTGTCCGATGTCTGACATGTTGG - Intergenic
980182542 4:129419317-129419339 GTGGCTAATGACTGTCTTAGTGG - Intergenic
982690331 4:158540828-158540850 ATGGCTGTTGTCTGACATTGTGG + Intronic
984726555 4:183027595-183027617 GTGCCTCATGCCAGACATGGTGG + Intergenic
986360533 5:6974090-6974112 GTGACTGGGGACTGAAATGGTGG + Intergenic
987195913 5:15526040-15526062 GGGGGTGATGAAAGACATGGGGG + Intronic
987390013 5:17366932-17366954 ATGGCTGATGTCTGAAATGGAGG - Intergenic
987593609 5:19965859-19965881 GTAGCTGTTTATTGACATGGCGG - Intronic
988685346 5:33520140-33520162 GGGGGTGATGGCTGACTTGGAGG - Intergenic
989232616 5:39103222-39103244 GTGGCCAATGACTTACATGTTGG + Intergenic
989598191 5:43177617-43177639 GTGGCTGGTGTCTGAAGTGGGGG - Intronic
991121469 5:63019949-63019971 ATGGCTGCTGACTGACAATGTGG + Intergenic
992087394 5:73290320-73290342 GTGGCTGATTATTTCCATGGAGG - Intergenic
995687755 5:114789468-114789490 GTGGCAGATGACTGAGTGGGAGG - Intergenic
1001494367 5:172177515-172177537 GTGGCTAGTGACTGCCATGTTGG - Intronic
1002552231 5:180003192-180003214 GAACCTCATGACTGACATGGAGG + Intronic
1002978743 6:2112861-2112883 AGGGCTGATGACTGAAGTGGAGG - Intronic
1003955822 6:11164192-11164214 GTAGTTGGTGAATGACATGGAGG + Intergenic
1006214719 6:32430408-32430430 GTGGCTGATTACTGATAGGCAGG + Intergenic
1007740240 6:44005421-44005443 GGAGCTCATGACTGGCATGGAGG - Exonic
1008042414 6:46816223-46816245 GTGGCTCATGCCTGTAATGGTGG - Intronic
1008192033 6:48471354-48471376 GTAGCTGATCAGTGACATGAAGG - Intergenic
1010998749 6:82562949-82562971 TTGGCTTAGGACTGACTTGGCGG - Intergenic
1012264968 6:97130695-97130717 GTTGCTGTTTTCTGACATGGAGG + Intronic
1013488576 6:110621447-110621469 GTGGCTGCTGACCAACCTGGGGG + Intronic
1013488958 6:110626079-110626101 ATGACTGGTGACTGACATGCTGG - Intronic
1014938605 6:127412792-127412814 GTGGCTCAGGCCTGGCATGGTGG - Intergenic
1015677328 6:135764469-135764491 GTGGCTCATGCCTGTAATGGAGG - Intergenic
1017879198 6:158548000-158548022 TTTGGTGCTGACTGACATGGGGG + Intronic
1023243759 7:38178474-38178496 GGGTCAGATGACTTACATGGGGG + Intronic
1024126567 7:46303532-46303554 GTGGCTGGTGTCTGAAATGGGGG - Intergenic
1024230959 7:47363048-47363070 GTGGATGATGACGGTGATGGTGG - Intronic
1024636675 7:51296695-51296717 GTTGCTGATTACTCACAGGGAGG + Intronic
1025126201 7:56347078-56347100 GTGGCTCAACACTGTCATGGAGG + Intergenic
1026107631 7:67433559-67433581 GCAGCTGATGTCTGACATGGGGG - Intergenic
1026846080 7:73699885-73699907 GTCGCTGATCACTGCCAGGGAGG - Exonic
1027302714 7:76857716-76857738 GTTGCTCATTACTGTCATGGTGG + Intergenic
1028435939 7:90803651-90803673 GTGGCAGTTGTGTGACATGGTGG + Intronic
1030699125 7:112619554-112619576 GTGGCTGATGATAAACATTGTGG + Intergenic
1031445061 7:121843371-121843393 GTGGCTGATGACTACCATATGGG + Intergenic
1032315609 7:130835807-130835829 GAGGCTGTTTACTGAAATGGGGG - Intergenic
1032486949 7:132295044-132295066 GTGGTAGATTACTGACATGCAGG + Intronic
1034944979 7:155256118-155256140 GTGGCTGAGGACTGCCACGGAGG + Intergenic
1035191493 7:157172887-157172909 GTGACTGATGACTAAGATTGAGG - Intronic
1040777525 8:51064237-51064259 GTTGTTGATGACTGACATAAGGG - Intergenic
1040972646 8:53153648-53153670 GTGGGTGAGGACTCAGATGGGGG + Intergenic
1041374923 8:57203570-57203592 GGGGCTGTTGACTGGCATCGCGG + Intergenic
1042507039 8:69571979-69572001 TTAGCTGCTGACTGCCATGGTGG - Intronic
1044199042 8:89412922-89412944 GGGGCTGATGAATGTCATGCTGG - Intergenic
1046356492 8:113092616-113092638 GTAGCTGATGACTGCCATTTGGG + Intronic
1047404787 8:124576345-124576367 GTGGCTGGTGACTGAATTTGGGG + Intronic
1049055622 8:140234369-140234391 GTGGCTGGTGGCTGCCATGGTGG + Intronic
1049377465 8:142296044-142296066 GGGGGTGATGACTGTCATGGGGG + Intronic
1049377554 8:142296296-142296318 GGGGGTGGTGACTGTCATGGGGG + Intronic
1049377563 8:142296320-142296342 GGGGGTGGTGACTGTCATGGGGG + Intronic
1051062678 9:13062927-13062949 GTGGCTAATGGTTGACATGTTGG - Intergenic
1051812005 9:21059902-21059924 GTGACTGATGATTGGCACGGAGG + Intergenic
1053295290 9:36908515-36908537 TAGGCTGATGTCTGACATGAAGG + Intronic
1054147741 9:61575251-61575273 GTGGCTGGTGTCTGAAAGGGGGG + Intergenic
1054652646 9:67636775-67636797 GTGGCTGGTGTCTGAAAGGGGGG + Intergenic
1054743002 9:68827478-68827500 GTGGCTGATGACTGCCATGCTGG + Intronic
1057765098 9:97909710-97909732 GTGGCTGCTGCCTCACAAGGTGG - Intronic
1057899283 9:98935506-98935528 GTGGCTGATGTGTGATAGGGAGG + Intergenic
1058099763 9:100905857-100905879 GTTGCTGATGTCTGAGATGTTGG + Intergenic
1061771804 9:132930299-132930321 GTGGCTGAGGCCAGGCATGGTGG + Intronic
1062448787 9:136606924-136606946 GTGGCTGCTGACTCCCAGGGCGG - Intergenic
1062524886 9:136974187-136974209 TTGGGTGTTCACTGACATGGGGG - Intergenic
1203792282 EBV:158228-158250 CTGCCTGATAACTGACATGATGG - Intergenic
1192229385 X:69254699-69254721 GTGGCTGATGAGAGACAAGATGG + Intergenic
1197668444 X:129248848-129248870 GGGCTTGATGACTGACATGGTGG - Intergenic
1199685435 X:150261024-150261046 CAGGCTGATGCCTGAGATGGTGG + Intergenic
1201452578 Y:14132335-14132357 GTGGCTCATGATGGTCATGGTGG + Intergenic