ID: 901892222

View in Genome Browser
Species Human (GRCh38)
Location 1:12276511-12276533
Sequence ATTTCTGTGCTCAAGGTGTT TGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 243
Summary {0: 1, 1: 0, 2: 0, 3: 23, 4: 219}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
901892222 Original CRISPR ATTTCTGTGCTCAAGGTGTT TGG Exonic
901892222 1:12276511-12276533 ATTTCTGTGCTCAAGGTGTTTGG + Exonic
902117516 1:14133601-14133623 ACTTCTGTGCTCAGTGTGGTTGG + Intergenic
902933618 1:19748414-19748436 ATTTTTCTGCTCAAGGAGATGGG - Intronic
906305536 1:44716249-44716271 GTTTCTGTCATCAAGGTGGTAGG - Intronic
908055634 1:60283758-60283780 AGATCTATGGTCAAGGTGTTAGG + Intergenic
908319897 1:62968970-62968992 ATTTCTGTGCTGAATGTGCTGGG - Intergenic
908596111 1:65690384-65690406 ATTTCTACCCTCAAGGTGTCTGG - Intergenic
909297211 1:73966108-73966130 ATTTTTGAGCTCAAACTGTTGGG + Intergenic
910196609 1:84647819-84647841 ATTCCTGGGCTCAAGCAGTTCGG - Intronic
912382962 1:109257481-109257503 ATTTCTGGGCTTAGGGTGTGTGG + Intronic
912778944 1:112526104-112526126 ATTTCTGTTTTGAAGGTGCTGGG - Exonic
913659375 1:120993044-120993066 ATTTCTATGTTCAAGTTCTTGGG + Intergenic
914010737 1:143776168-143776190 ATTTCTATGTTCAAGTTCTTGGG + Intergenic
914167091 1:145184947-145184969 ATTTCTATGTTCAAGTTCTTGGG - Intergenic
914506399 1:148293364-148293386 ATGTCTGTGACCAAGGTATTTGG + Intergenic
914649359 1:149684825-149684847 ATTTCTATGTTCAAGTTCTTGGG + Intergenic
914923384 1:151862708-151862730 ATGTCTGTGGTCAAGGGGGTGGG + Intergenic
915000356 1:152583900-152583922 ATTCCTGTTCTCTAGGTTTTAGG + Intronic
915516159 1:156413805-156413827 GTTTCTAGGCTCACGGTGTTGGG + Intronic
916164185 1:161950276-161950298 ATATCTCTGCCCATGGTGTTGGG - Intronic
917048411 1:170890073-170890095 TTTTCTGTGATCAAGGTGTGGGG + Intergenic
917395200 1:174586282-174586304 TTTTCTGTTCACGAGGTGTTTGG - Intronic
917538913 1:175894900-175894922 ACTTCTGTACTCATGGAGTTGGG + Intergenic
917624665 1:176833472-176833494 ATATCTGTGATCAAGTGGTTGGG - Intronic
917677563 1:177334280-177334302 ATTTCCTTACTCAAGGTTTTTGG - Intergenic
918147583 1:181771278-181771300 GTTTCTCTCCTCAAGGTATTTGG + Exonic
918779980 1:188687158-188687180 AGGTCTGTGCCCTAGGTGTTGGG + Intergenic
919853024 1:201686383-201686405 ATTTCTTTAGTCAAGGTGTTTGG + Intronic
921246158 1:213243223-213243245 ACTCCTGGGCTCAAGGTGCTGGG + Intronic
921286527 1:213614595-213614617 ATTTCTGCCCTCCAGGAGTTTGG - Intergenic
923062867 1:230491899-230491921 GTTTCAGTGCTCAAGATATTGGG + Intergenic
1063213807 10:3905872-3905894 ATTTCTGTTTTCAAGGTATGTGG - Intergenic
1065178024 10:23097225-23097247 ATTTCTGTGGTGAAGGGCTTGGG + Intronic
1066372826 10:34831757-34831779 TCATCTGTGCCCAAGGTGTTTGG - Intergenic
1069395371 10:67982079-67982101 ATTTCTGTGATCAATGTCATTGG - Intronic
1070118689 10:73554201-73554223 CTTTTTGAGCTCAAGGTCTTTGG + Intronic
1070415832 10:76188461-76188483 ATTGCAGTGCACAAGGTGATGGG + Intronic
1070812730 10:79306411-79306433 ATTTCTGTGCTGATGGTGGCAGG + Intronic
1071452536 10:85810781-85810803 ATTTCTGTGGTCAGGGTAATGGG - Intronic
1075281021 10:121138507-121138529 ATTTCTCTGCTGATGGTGTTTGG - Intergenic
1075372965 10:121953471-121953493 ATTTCTGTGCTGAGGGTGGTAGG - Intergenic
1075906661 10:126087521-126087543 ATTTCCTTCCTCAAAGTGTTAGG - Intronic
1078671694 11:13371389-13371411 ATTTCTGAGATCAAACTGTTGGG - Intronic
1079035021 11:17013826-17013848 TTTTGTGTGCCCAAGTTGTTTGG - Intronic
1080165948 11:29237165-29237187 ATTCCTGTATTCAATGTGTTAGG + Intergenic
1080289830 11:30658504-30658526 ATTTCTGTTCCCATGGAGTTGGG + Intergenic
1080691762 11:34564480-34564502 ATTTCTTCACTCAAGGTGTTAGG + Intergenic
1081475627 11:43427768-43427790 GTTTCTGTACTCAAGGAGCTAGG - Intronic
1082887801 11:58106473-58106495 TTTGCTGTGCTGAAGGTATTTGG + Intronic
1084341533 11:68506353-68506375 GTTTCAGTCCCCAAGGTGTTGGG + Intronic
1088014232 11:105039107-105039129 TTTTCTGTGCTCTAGGTGAAGGG + Intergenic
1088329250 11:108633407-108633429 ATCTCTGTCCACAAGGAGTTTGG - Intergenic
1088985602 11:114904583-114904605 ATTTCTGTGAACAATGTGATTGG - Intergenic
1089166966 11:116484786-116484808 ATGTCTGCAATCAAGGTGTTTGG - Intergenic
1089446861 11:118560055-118560077 ATTACTGTGCTTAAGGCATTGGG + Intronic
1089664869 11:120012051-120012073 TTTCCTGTGCTTAAGCTGTTTGG + Intergenic
1091767038 12:3128188-3128210 GTCTCTGTTCTCAAGTTGTTTGG + Intronic
1094010988 12:25809369-25809391 ATTTCTGTGCCATTGGTGTTGGG + Intergenic
1094056813 12:26276592-26276614 ATGTCTGTGATCTGGGTGTTGGG - Intronic
1096858487 12:54504561-54504583 AGTTCTGAGCCCAAGGTGTTTGG + Intronic
1097245063 12:57603509-57603531 ATTCTGGTGTTCAAGGTGTTGGG + Intergenic
1097403887 12:59164381-59164403 ATTTGTGTGATCAATGTGTTGGG + Intergenic
1098096068 12:66957308-66957330 AAGTCTGAGATCAAGGTGTTTGG - Intergenic
1100716948 12:97316024-97316046 CTTTCTTTCCTCTAGGTGTTTGG + Intergenic
1100768183 12:97892248-97892270 ATTTATATGCTTAAAGTGTTGGG - Intergenic
1101555516 12:105805214-105805236 ATTTCTATGCAGAAGGTGATAGG - Intergenic
1105720418 13:23108183-23108205 TTTCCTGTGCTCCAGGTGTGCGG + Intergenic
1107655162 13:42585479-42585501 AGTTCTGTGCTAAAGGGGGTGGG - Intronic
1113038560 13:106078922-106078944 CTCTCTGTGATCAAGGTGCTAGG - Intergenic
1113085555 13:106566998-106567020 ATTCCTGTTGTTAAGGTGTTGGG - Intronic
1113200004 13:107856630-107856652 ACTACTGTGAGCAAGGTGTTAGG + Intronic
1114160832 14:20165240-20165262 ATTTCAATGGTAAAGGTGTTGGG + Intergenic
1114687352 14:24546332-24546354 ATTTCTGTGATGAATGTCTTTGG + Intergenic
1115401835 14:32970617-32970639 AATTCTGAGATCAAGGTGTCGGG + Intronic
1117539815 14:56735978-56736000 ATGTCTTTGCACAAGGGGTTGGG - Intergenic
1117720947 14:58628168-58628190 ATTTCTGTGCTCAGGCAGGTGGG + Intergenic
1118258312 14:64224426-64224448 ATTTCTGTGCTCAACCTTTGGGG + Intronic
1118816043 14:69314652-69314674 ATCTCTGAGCTCAAGGTCTCAGG - Intronic
1121163590 14:91769899-91769921 ATTTCTGTGCCCTAGGAGTAAGG - Intronic
1125391209 15:39195067-39195089 ATTTTAGTGCTAAAGGTCTTTGG + Intergenic
1125717169 15:41825951-41825973 CTTTCTGAGCTCCAGGTATTGGG - Exonic
1125825973 15:42676799-42676821 GACCCTGTGCTCAAGGTGTTTGG - Intronic
1126026596 15:44451927-44451949 AGATCTGTGTTCAAGGTGTTTGG - Intronic
1126268329 15:46781357-46781379 ATTCCTTAGCTTAAGGTGTTAGG - Intergenic
1126600929 15:50426723-50426745 ATTTCTGGGCTCAGGCTTTTTGG - Intronic
1126703740 15:51388740-51388762 ATTTGCGTGCTCAAGGGGCTTGG + Intronic
1127779941 15:62303402-62303424 ATTTCTGATGTCAAGGTGTCAGG + Intergenic
1128729086 15:70008559-70008581 CTTTCTGTGTTCAGAGTGTTTGG + Intergenic
1130824201 15:87527135-87527157 ATTGATGTGCTTAATGTGTTGGG - Intergenic
1132502471 16:290611-290633 CTTTATGTGCTCAAGGTGGCAGG - Intronic
1135045955 16:19155989-19156011 GTTTCTGTGGTCCAGGAGTTGGG + Intronic
1140171970 16:72615103-72615125 ATTTATGTGATAAAGTTGTTAGG + Intergenic
1142822265 17:2479543-2479565 AATTCTGGCCTCAAGGTGTCTGG + Intronic
1149659137 17:58325318-58325340 ATTTCTGTGCTCCAGGCTTGAGG - Intronic
1150158757 17:62875928-62875950 ATTTCTGTGGTGACTGTGTTTGG + Intergenic
1152252013 17:79217198-79217220 ATTTCTGTGCTCATTGTGAAGGG - Intronic
1152846604 17:82603980-82604002 CTTGCTGTGCTCAAGTTCTTGGG - Exonic
1153407788 18:4759774-4759796 ACCTATGTGCTCAAGGGGTTTGG + Intergenic
1153479298 18:5530848-5530870 ATGTCTGTGCTCAGGGTGACAGG + Intronic
1158613464 18:58964305-58964327 ATTTGTGATCTCAAGGTTTTAGG + Intronic
1159748341 18:72268480-72268502 GTATCTGTGCAGAAGGTGTTTGG - Intergenic
1160057797 18:75501737-75501759 TTCTCAGTGCTCAAGGTGCTGGG + Intergenic
1162541326 19:11298127-11298149 GTTTCTGTTCTAAAGGTGTCTGG + Exonic
1167095832 19:47374677-47374699 ATTTCTGGGGTCCCGGTGTTGGG + Intronic
1168712991 19:58512318-58512340 ATTTCTGTGCTCTGAGTGTCTGG - Intronic
925055269 2:852382-852404 GATCCTGTGCTCAAGGTGTTCGG + Intergenic
926564769 2:14456875-14456897 ATTTCTGTGTTCAAGATCTTGGG - Intergenic
926635695 2:15176585-15176607 ACTTCTGAGCTCAAGCTTTTTGG - Intronic
927452723 2:23222814-23222836 ATTATTGTGCTCATGGTGTCTGG - Intergenic
928700769 2:33896432-33896454 AATTGAGTGCTCAAGGTTTTAGG + Intergenic
929042315 2:37757261-37757283 ATTTCTGTGCTGAAGTGGCTGGG - Intergenic
930185893 2:48411671-48411693 ACTTCTGGGCTCAAAGTGATCGG + Intergenic
932033509 2:68215351-68215373 ATTTCTGGTCTCAAGATTTTTGG + Intronic
932315252 2:70776611-70776633 GTCTTTGTGCTCAAGGTGTTTGG + Intergenic
932460745 2:71880377-71880399 ATTTCTGAACTCAGGGTGCTAGG + Intergenic
932860951 2:75290703-75290725 ATTTCTGTGCTCAGAGTAGTGGG - Intergenic
935277072 2:101484223-101484245 TTTTCTCTCCTCAAGGTGTATGG - Intergenic
939007248 2:136803865-136803887 ATGTCTCAGCTCAAGGTGTGAGG + Intronic
943259382 2:185639585-185639607 GTTTCTGTGCTAAAGTAGTTTGG + Intergenic
946370263 2:219277357-219277379 ATCTCTGTGCTCAAGGGGATAGG - Intronic
946728040 2:222681477-222681499 GTTTCTGTCCCCATGGTGTTGGG + Intronic
947468818 2:230381398-230381420 ATTTCTGTACTCACGGTATCAGG - Intronic
1169163838 20:3406589-3406611 ATTTCTGTGCCCTATGCGTTTGG - Intronic
1173250951 20:41364002-41364024 TTTTCTGTGCTTAAGGTGACAGG + Intronic
1173287591 20:41687328-41687350 ATTTCTGTGTTCAAGATCTTGGG - Intergenic
1173460737 20:43241303-43241325 ATTTGTGTGCTCTAGGGGTTAGG - Intergenic
1174376839 20:50131739-50131761 GTTTCTGTTCTCAATCTGTTCGG + Intronic
1174697544 20:52575365-52575387 AATTCTATGTTCAAGGTTTTGGG - Intergenic
1177442749 21:21148549-21148571 ATGTCTGTTCTTAAGGTTTTTGG - Intronic
1177619536 21:23569037-23569059 CTTTATGTTCTCAAGTTGTTTGG + Intergenic
1177780640 21:25619315-25619337 ATGTCTGTGCTCAAGCAGTCAGG + Intergenic
1182626419 22:31649994-31650016 ATGTCTGAGATCAAGGTGTCAGG - Intronic
1203294510 22_KI270736v1_random:28752-28774 ATTTCTGTGCTGAAGTAGCTGGG - Intergenic
949249835 3:1970494-1970516 ATTCCTGGGCTCAAAGTGCTAGG + Intergenic
950563077 3:13747043-13747065 ATTTCAGTGCTCAGAGTCTTTGG + Intergenic
950969734 3:17174296-17174318 AATATGGTGCTCAAGGTGTTTGG + Intronic
951052123 3:18105772-18105794 ACTTCTGTGCCCAAGTTTTTTGG + Intronic
951282370 3:20767860-20767882 ATTTCTGTGAGGAATGTGTTTGG + Intergenic
954364643 3:50139468-50139490 CTGTCTGTGCTCCAGGTGTTAGG - Intergenic
956054065 3:65279799-65279821 GCTTCTGTTCTCAAGGTATTGGG + Intergenic
960376761 3:116912157-116912179 ATTTCTCTGTCCAAGGAGTTAGG - Intronic
960474821 3:118110841-118110863 ATTTGTGTGCTAAAGGTGGGTGG - Intergenic
961372738 3:126441296-126441318 CTTTCTATGCTGAAGGTGGTGGG - Intronic
962598345 3:136969979-136970001 ATTTTTTTGCACAAGGTGTGAGG + Intronic
965010080 3:163076719-163076741 ATTTCTGTGAGGAAGGTCTTTGG - Intergenic
965337658 3:167447835-167447857 ATTGCTGTGCTCAAGGAACTTGG - Intronic
965535135 3:169815160-169815182 ATTTCTGTGAAGAAGGTCTTTGG + Intergenic
965696030 3:171409107-171409129 ATTTCTGTGCTCATACTCTTGGG + Intronic
966046945 3:175563783-175563805 ATTTCTTTGCTCCAGGTGTAAGG - Intronic
969186756 4:5480320-5480342 ATATATGTGCCCAAGGTGGTCGG + Intronic
972277734 4:37572602-37572624 ATTTCTGTTCTCAAGCATTTTGG - Intronic
972436920 4:39044332-39044354 ATTAGTGTGCTCTAGGTGGTGGG - Intergenic
973131720 4:46655650-46655672 ATATCTGAGATCAAGGTGTTGGG - Intergenic
973252146 4:48071761-48071783 ATTTTTGTGCTCCAGGCTTTGGG + Intronic
976046089 4:80949844-80949866 ATTTCTCTGCACAAGATGCTTGG - Intronic
977387247 4:96357344-96357366 GCTTCTGTTCTCAAGATGTTGGG - Intergenic
980230350 4:130039323-130039345 AATTCTGAAATCAAGGTGTTAGG + Intergenic
981396167 4:144252468-144252490 GCTTCTGTGCTCATGGAGTTGGG - Intergenic
982344247 4:154339204-154339226 ATGTCTCAGCTCAAGCTGTTAGG + Intronic
982796536 4:159653025-159653047 ATTTCTGTCCTCTTGCTGTTGGG + Intergenic
983850179 4:172570538-172570560 AATTCTGAGATCAAAGTGTTGGG - Intronic
984332740 4:178347257-178347279 ATTTCAGTGCTCACAGTGTTTGG + Intergenic
986814116 5:11389778-11389800 ATGTCAGTGCTCAAAATGTTTGG - Intronic
987452954 5:18108663-18108685 ATTTTTGTTCTCAATGTATTTGG + Intergenic
988825942 5:34934895-34934917 ATTTCTCTACTCAAGGAATTTGG + Intronic
991268702 5:64753135-64753157 ATTGCTTTCCTCAAAGTGTTAGG + Intronic
992395980 5:76370162-76370184 ACTTCTGTCCTCATGGTATTGGG + Intergenic
994906904 5:105852366-105852388 ATTTCTGTTCTTAAGGGTTTTGG - Intergenic
996681624 5:126233726-126233748 CCTTCTGTTCTCAAGGTATTTGG - Intergenic
997602299 5:135148977-135148999 GTTTCTGTTCTCAAGGAGCTTGG + Intronic
998033340 5:138892141-138892163 AGTCCTGTGCCCAAGGTGCTTGG - Intronic
998770192 5:145534723-145534745 TTTTCTGTGCTCACAGTGTTGGG + Intronic
999050304 5:148516700-148516722 CTTTCTGTGTTCATGGTTTTTGG + Intronic
999907662 5:156161379-156161401 ATTACTATTATCAAGGTGTTTGG - Intronic
1001243795 5:170090544-170090566 ATTTTTGGGCTCCAGTTGTTAGG - Intergenic
1001449752 5:171815610-171815632 CTGTCTGTCCTCAATGTGTTTGG + Intergenic
1001918043 5:175577950-175577972 TTTTCTTTTCACAAGGTGTTGGG + Intergenic
1002633539 5:180596155-180596177 ATTTATGTACTCAAGGCATTAGG - Intergenic
1002922413 6:1581808-1581830 ATTTGTGTCCGCTAGGTGTTTGG - Intergenic
1004104805 6:12656846-12656868 ATTACTGCACTCATGGTGTTAGG + Intergenic
1004566413 6:16802104-16802126 GTTTCTGTGCTCAAGACTTTAGG - Intergenic
1005027195 6:21474570-21474592 AATTCTGTGCTCATGGGGTATGG - Intergenic
1006886847 6:37389090-37389112 ATTCCTGCCCTCAAGGAGTTCGG - Intronic
1007050060 6:38818083-38818105 ATTTCTGAGATTATGGTGTTTGG + Intronic
1008160079 6:48066480-48066502 CTTTCTTTACTCCAGGTGTTTGG + Intronic
1008237416 6:49066967-49066989 ATTTCTGTGAAGAATGTGTTTGG - Intergenic
1009195141 6:60675834-60675856 GTTTCTTTGTTCATGGTGTTAGG + Intergenic
1009508354 6:64515846-64515868 ATTGCTGTTCTCAAGATATTTGG - Intronic
1010688651 6:78881617-78881639 ATAACTGTGCTTAAGGTGATAGG + Intronic
1011404588 6:87005204-87005226 ATTTCTGTGCACAATGTCATTGG - Intronic
1012154207 6:95796081-95796103 AATTCTGTGCTCAAGGCCATTGG - Intergenic
1012828482 6:104177826-104177848 GTCTCTCTGGTCAAGGTGTTGGG - Intergenic
1013882428 6:114921166-114921188 ATTCCTGTGCTCATGAAGTTTGG - Intergenic
1015922353 6:138278808-138278830 AGCTCTGTGCTCACGGTGCTGGG - Intronic
1017034413 6:150254067-150254089 AATTCAGTGTTCAAGTTGTTAGG + Intergenic
1018638285 6:165884027-165884049 ACATCTGTGCTCGAGGTGGTAGG - Intronic
1021031815 7:15746520-15746542 ATTTCTGTGGACAAGGGGATGGG - Intergenic
1021545669 7:21810879-21810901 AATTCTGTGTTTAAGGTTTTGGG - Intronic
1023538221 7:41236704-41236726 ATTTCTGAGTTCAAGGGTTTGGG + Intergenic
1025318877 7:58068954-58068976 ATTCCTGGCCTAAAGGTGTTCGG + Intergenic
1025320754 7:58090811-58090833 CTTTCTCTGCTCAAGGTTTAAGG - Intergenic
1025562396 7:62383540-62383562 CTTTCTCTGCTCAAGGTTTAAGG - Intergenic
1027613104 7:80387448-80387470 ATTGCTATTCTCAAGGTCTTAGG + Intronic
1027641656 7:80741288-80741310 ATTCCTGTGCAAAAGGTGCTTGG + Intergenic
1031357211 7:120801423-120801445 CTTTCTGTGTTCCATGTGTTGGG - Intronic
1031930899 7:127684827-127684849 GTCTGTGTGCTTAAGGTGTTGGG + Intronic
1033330500 7:140413405-140413427 ATTTCTGTGATGAATGTCTTTGG + Intronic
1033575159 7:142674367-142674389 ATTTCTGTCATCAATGTGTGAGG + Intergenic
1035174736 7:157042259-157042281 TTTTCTATGCTCGACGTGTTTGG - Intergenic
1035221360 7:157408299-157408321 GTTTCTGTGTTCAAAGTGTGGGG + Intronic
1035441651 7:158906912-158906934 ACTCCTGTGCTCAAAGTGCTGGG - Intronic
1037751529 8:21685468-21685490 ATTTCTTTTCTCAAGGAGTCTGG - Intergenic
1038394067 8:27233718-27233740 ATTTCTTTGCTTTAGGTGTTCGG - Intergenic
1039455803 8:37705565-37705587 ATTTCTGAAATCAAGTTGTTGGG + Intergenic
1040126849 8:43747355-43747377 ATTTGGGTGCTCAGGGTGTGTGG + Intergenic
1046733846 8:117754805-117754827 ATTTCTGTGCTCAAATCATTAGG + Intergenic
1047630091 8:126697385-126697407 ATCCCTGTCCTCAAGGGGTTTGG - Intergenic
1047682896 8:127273048-127273070 AATTCTTTGTTCAAGGTGCTAGG + Intergenic
1047796220 8:128258317-128258339 ATCTCTGTCCTCAAGTAGTTTGG - Intergenic
1049113092 8:140661830-140661852 ATTCCAGTGCTCCAGCTGTTTGG - Intronic
1049590899 8:143461918-143461940 ATTCCTCTGCTCTAGGTGTATGG - Intronic
1049647771 8:143743455-143743477 ATTTTTGTTCTCAAGGACTTGGG + Intergenic
1056643754 9:88392405-88392427 AATTCTGTGCTGAAGGTATCTGG + Intronic
1056908091 9:90671934-90671956 ATTTCTGTACTCACGGTGGAAGG - Intergenic
1057418339 9:94885611-94885633 GTTCCTGGGCTCAAAGTGTTAGG - Intronic
1057470360 9:95351041-95351063 TCATCTGTGCCCAAGGTGTTTGG - Intergenic
1059655109 9:116350621-116350643 ATATCTGTGGAAAAGGTGTTGGG - Intronic
1060152778 9:121299503-121299525 ATTTTTTTGCTGGAGGTGTTAGG + Intronic
1062239358 9:135527378-135527400 ATTTCTCTGCTCCAGGGCTTAGG + Intergenic
1186153596 X:6702764-6702786 ATTTCTCTGTTGAAGGTTTTTGG - Intergenic
1186534536 X:10332621-10332643 ATCTGTGAGCTCACGGTGTTGGG - Intergenic
1186637533 X:11422493-11422515 ATTTCAGTGCTTAAGCTCTTTGG - Intronic
1188448801 X:30286906-30286928 GTTTCTGTGCTCTAGGAATTGGG - Intergenic
1190230294 X:48576493-48576515 ATTTTTCTGCTCTAGGTGGTGGG + Exonic
1192381673 X:70623388-70623410 ATTTCTGTGCACAATATCTTTGG - Intronic
1193319726 X:80107205-80107227 GGATGTGTGCTCAAGGTGTTTGG - Intergenic
1194389870 X:93303116-93303138 ATTCCTGCTCCCAAGGTGTTGGG - Intergenic
1196568438 X:117236233-117236255 TTTTCTCTTCTCAAGGTGTGTGG - Intergenic
1197315823 X:124964985-124965007 ATTTCTGTGTTCTATGTGCTTGG - Intergenic
1197625622 X:128799032-128799054 ACTTCTCTGTTTAAGGTGTTAGG - Intergenic
1199755801 X:150863982-150864004 AAGTCTGAGATCAAGGTGTTGGG - Intronic
1202179383 Y:22126568-22126590 ATTGCTGTGCTCCAGGTGGTGGG - Intergenic
1202211978 Y:22459826-22459848 ATTGCTGTGCTCCAGGTGGTGGG + Intergenic