ID: 901892614

View in Genome Browser
Species Human (GRCh38)
Location 1:12280452-12280474
Sequence TACATCACATGCTAGATTTA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 135
Summary {0: 1, 1: 0, 2: 1, 3: 13, 4: 120}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
901892614_901892616 28 Left 901892614 1:12280452-12280474 CCTTAAATCTAGCATGTGATGTA 0: 1
1: 0
2: 1
3: 13
4: 120
Right 901892616 1:12280503-12280525 TTTTTTTTTTTTTTTTGAGACGG 0: 83672
1: 60776
2: 74199
3: 114646
4: 163091

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
901892614 Original CRISPR TACATCACATGCTAGATTTA AGG (reversed) Intronic
901892614 1:12280452-12280474 TACATCACATGCTAGATTTAAGG - Intronic
908614563 1:65904848-65904870 TACATGAGATGATAGATTTAGGG + Intronic
909128178 1:71701911-71701933 TACATTACTTGATAGATTTGTGG - Intronic
910265590 1:85333894-85333916 TAAATCTCTTGCTAGACTTAGGG - Intronic
910711588 1:90187540-90187562 TTCATCACATGCATGATTTCAGG + Intergenic
922333581 1:224600038-224600060 TACATTGCATTCTAGAGTTATGG - Intronic
922333819 1:224602231-224602253 TACATTGCATTTTAGATTTATGG - Intronic
922946301 1:229518547-229518569 TACATCACAGTATAGTTTTATGG - Intronic
1063658613 10:8016786-8016808 TTCAGCCCATGCTACATTTAAGG + Intergenic
1064600022 10:16984272-16984294 TACATCCCATGTTAGATCTATGG - Exonic
1066600711 10:37103537-37103559 CACAGGACATGCTAGATTTATGG - Intergenic
1066601489 10:37112697-37112719 CACAGGACATGCTAGATTTATGG + Intergenic
1067908662 10:50321194-50321216 TACATCAAATGTTAAATATAAGG + Intronic
1070725533 10:78785360-78785382 TACTTCACATGCAAAATGTAAGG - Intergenic
1071802561 10:89080029-89080051 TTCATCACATGCTACATATTAGG - Intergenic
1072852481 10:98910700-98910722 TACATCACATACTGCATTTAAGG + Intronic
1074216913 10:111394239-111394261 TACGGCACATGCTTGATTTGGGG + Intergenic
1081290638 11:41321391-41321413 TGCCCAACATGCTAGATTTAAGG + Intronic
1085339269 11:75720701-75720723 TATACCACATGCCAGAGTTAGGG - Intronic
1085889671 11:80563372-80563394 CACAGGACATGCTAGATTTATGG + Intergenic
1086309019 11:85515558-85515580 TTGATCACTTGCTAGATTCAAGG - Intronic
1087840719 11:102918206-102918228 AACATCACGTGCTAGATTAAAGG + Intergenic
1088234415 11:107707277-107707299 TACCTCAAATGCTAGAAATACGG + Intergenic
1092763897 12:11835435-11835457 TACATAACTTGCTTTATTTACGG - Intronic
1107156063 13:37168089-37168111 TACATCACCTTATAGATTTTTGG + Intergenic
1112536331 13:100260235-100260257 TCCATCACATTGTTGATTTAGGG - Intronic
1116678182 14:47932601-47932623 TAAATCAAATGATGGATTTATGG + Intergenic
1117941348 14:60969346-60969368 TACAACAGATGTTAGTTTTATGG + Exonic
1118668822 14:68100711-68100733 TTCATAACATTCTAGATATATGG + Intronic
1123957932 15:25359240-25359262 TACATCAAAAGCTAGAGCTAAGG + Intronic
1125878841 15:43174589-43174611 TACCTCACATGATTGTTTTAAGG - Intronic
1127472155 15:59300004-59300026 TACATTACATTAAAGATTTAGGG - Intronic
1128487082 15:68103301-68103323 TACAAAACATGGTAGATTCAAGG - Intronic
1131341427 15:91605348-91605370 AACATCAGAGGCTAGGTTTAAGG - Intergenic
1136638324 16:31540141-31540163 TACTCCACATGCTATATTTCTGG + Intergenic
1139121118 16:64018397-64018419 TACATTAGATGCTAGATTCTGGG + Intergenic
1144228942 17:13180194-13180216 CACATCAATTGCTAGATTTGTGG + Intergenic
1155590537 18:27422336-27422358 TACATCACATGTTCACTTTAGGG - Intergenic
1158078189 18:53556448-53556470 TACATCACATGGTAGAGAGAAGG - Intergenic
1159477420 18:68941118-68941140 TACAACATATGCTAAATATAAGG - Intronic
1160065157 18:75567367-75567389 TACCTCACAGGCTGGTTTTATGG - Intergenic
1167821936 19:51936264-51936286 TTCATCACATGATTGATTTCTGG + Intronic
927082058 2:19640325-19640347 TGCATCACAGCCTAGATGTATGG + Intergenic
928569179 2:32585758-32585780 TACAATGCATGCTTGATTTAGGG - Intronic
931431703 2:62213700-62213722 TAAATAACTTGCTAGACTTAGGG - Intronic
931612478 2:64117201-64117223 TAAATCAAAAGCTTGATTTATGG + Intronic
931650247 2:64462174-64462196 TTACTCACATGCTAGATCTAGGG + Intergenic
932927388 2:75992767-75992789 TAAATCTCTTGCTAGATTTGGGG + Intergenic
932990699 2:76782174-76782196 TGCAACACATGTAAGATTTACGG + Intronic
934734122 2:96679699-96679721 TACATCAGAGGCTCCATTTATGG + Intergenic
935537879 2:104315421-104315443 TACATCACAAGCTTATTTTAGGG + Intergenic
937054363 2:118920179-118920201 AATATCACATGGTAGGTTTATGG - Intergenic
937517762 2:122674645-122674667 TATGTCTCATGCTATATTTAGGG - Intergenic
937714269 2:125013744-125013766 TACATCAGAGGCTAGGTTTGTGG - Intergenic
939078507 2:137631321-137631343 TTCATGATATGCTAAATTTAGGG - Intronic
939111022 2:138007672-138007694 TGCAGCACATGCAAGATTTGGGG - Intronic
939950047 2:148459579-148459601 TACATCACAAGAAAGATTTATGG - Intronic
940062801 2:149591276-149591298 TACAGAAAATGCTAGATATAAGG + Intergenic
940141568 2:150496980-150497002 TACCATACATGCTAGATTTGGGG + Intronic
940546216 2:155089733-155089755 AACATCACTTGATAGATTTAAGG - Intergenic
940583334 2:155609840-155609862 TTCATCACATAATACATTTATGG + Intergenic
942009728 2:171748539-171748561 TATACCACATGGTATATTTAGGG - Intergenic
1169960677 20:11156391-11156413 TAAATCTCATGGTAGATTTAGGG + Intergenic
1170262185 20:14422605-14422627 TATATAACATTCTAAATTTATGG + Intronic
1170745791 20:19097940-19097962 CACATCCCATGCTTGATTTGGGG + Intergenic
1173387356 20:42601095-42601117 TACATAACATGGTAGATGTGGGG - Intronic
1177661854 21:24094726-24094748 TCTACCACTTGCTAGATTTATGG + Intergenic
1177718737 21:24876594-24876616 TACATCAGAAGCTATATTTCAGG + Intergenic
1184576459 22:45371406-45371428 TAGACCAGATACTAGATTTAGGG - Intronic
951918369 3:27825987-27826009 TACATTACATGCTGGGTTTGGGG + Intergenic
956312549 3:67897410-67897432 TTCATCAAAAACTAGATTTATGG - Intergenic
957934980 3:86930882-86930904 TACATCACATGTTAAAGTAATGG - Intergenic
960502710 3:118456348-118456370 TACATCACAGGGTAGATGTGAGG + Intergenic
962319751 3:134380793-134380815 GACATGACATGCCAGATTGAAGG - Intergenic
963481988 3:145887562-145887584 CACATCACATTCTAGTTTAATGG - Intergenic
964708847 3:159649701-159649723 TACATCATATGGAAGATTGATGG + Intronic
965915471 3:173841351-173841373 TACTTCAGATGCAAGATTCAAGG - Intronic
966005064 3:175000815-175000837 TACCTCTCATGGTAGTTTTAAGG - Intronic
968291536 3:197543270-197543292 CACATCACATGCGGGATTCATGG - Intronic
971769339 4:30876555-30876577 AATATCACATGCAAGTTTTATGG + Intronic
973930437 4:55788263-55788285 TACATCCCAATCTAGTTTTAAGG - Intergenic
974283288 4:59827704-59827726 TAAAGCACATGCTACAATTAAGG - Intergenic
974334341 4:60520961-60520983 GACAGCACATGCTTGATTTAAGG - Intergenic
976263814 4:83171638-83171660 TATGTCACATGCAATATTTAAGG + Intergenic
977470093 4:97432362-97432384 TAAATCCCATGCCAAATTTAGGG + Intronic
978335412 4:107662621-107662643 TATATCTCATGCTAGATTTAAGG - Intronic
978827371 4:113041574-113041596 TATATAACATCCTAGTTTTAGGG + Intronic
979358372 4:119732355-119732377 TGCATCACATACTATATTAATGG + Intergenic
980274499 4:130632209-130632231 TACATCTAAGACTAGATTTATGG - Intergenic
980817195 4:137963719-137963741 TACTTCACATGGTAGCTTAAAGG + Intergenic
981967639 4:150624719-150624741 TACATCACATGCTTTTTTTGTGG - Intronic
984955834 4:185044732-185044754 GACAGCACATGCTGCATTTATGG + Intergenic
987831298 5:23099157-23099179 TACATCATATGTTACATGTAGGG + Intergenic
988273092 5:29042526-29042548 TACAGCAGATCCTAGATTAATGG - Intergenic
989167023 5:38442041-38442063 TACCACACATGCAACATTTAGGG + Intronic
989227488 5:39047022-39047044 TACAGGACATGCTAAATTTGAGG - Intronic
989490408 5:42046310-42046332 TATACAACATGCTAGATCTAAGG - Intergenic
992816875 5:80450736-80450758 CACATAAAATGCTAGTTTTAAGG - Intronic
992946497 5:81816496-81816518 AACACCACATGCTATGTTTAGGG + Intergenic
994698542 5:103103586-103103608 TACAACAACTGCTAGACTTAAGG - Intronic
995999176 5:118337986-118338008 TATATCAAATGGTAGTTTTAAGG - Intergenic
1000156556 5:158558089-158558111 GACATCACATGCTGGTTGTAAGG + Intergenic
1000163848 5:158627929-158627951 TACATTACAATCTAGATTCAAGG + Intergenic
1000684092 5:164225118-164225140 CACAGCACATTCTAGATTTTAGG + Intergenic
1001591718 5:172870112-172870134 TACTTCACGTTCAAGATTTAAGG + Intronic
1002685455 5:181005798-181005820 TACATCGCATGCTGGATATAGGG - Exonic
1004795346 6:19076981-19077003 TACATCACATAATAGAATGAAGG + Intergenic
1006286034 6:33095037-33095059 TAAATCACATGCCAGAAGTAGGG + Intergenic
1011384928 6:86785504-86785526 TAGATGACAGGCTACATTTATGG - Intergenic
1012468621 6:99544382-99544404 TATATAACAAGATAGATTTATGG - Intronic
1014460394 6:121687896-121687918 TGCATCACAGGCTTGTTTTAAGG - Intergenic
1016306205 6:142686454-142686476 TACATCACAGGCTTGTTTTGAGG - Intergenic
1021275829 7:18649700-18649722 TTCATCACTTGCTGGTTTTATGG + Intronic
1025638132 7:63341878-63341900 TACAGCACATGGTAGATACAAGG + Intergenic
1025644564 7:63406221-63406243 TACAGCACATGGTAGATACAAGG - Intergenic
1025714187 7:63939612-63939634 TACAGCACATGGTAGATACAAGG - Intergenic
1031692776 7:124811094-124811116 TAGATCACATGTTAGATGAAAGG + Intergenic
1033825280 7:145182229-145182251 AACAACACATGCTATATTTTAGG - Intergenic
1043082289 8:75782008-75782030 AATATCAAATGCTAGTTTTAAGG - Intergenic
1043707695 8:83373318-83373340 TACATCACATTCTTCATTTTTGG - Intergenic
1044478033 8:92651464-92651486 TCAATCTAATGCTAGATTTATGG - Intergenic
1046034828 8:108828000-108828022 TACATCAGATGTTAGAGTTTGGG + Intergenic
1046086181 8:109438106-109438128 TACATGACATAGTAGTTTTATGG - Intronic
1047447812 8:124935507-124935529 TTCATCACAGGTCAGATTTAGGG + Intergenic
1048487700 8:134864016-134864038 AACATCACATTCTGGATTTGGGG + Intergenic
1051848477 9:21479863-21479885 TACATAAAATGCTACATTTGGGG - Intergenic
1052472154 9:28913224-28913246 TACATCACATGTTATAATAATGG - Intergenic
1053174369 9:35911598-35911620 TAAATGCCATGCTATATTTAAGG + Intergenic
1059916459 9:119107985-119108007 TACATCACATCAAAGAATTAAGG + Intergenic
1188379183 X:29470581-29470603 TAAATAAAATGGTAGATTTATGG - Intronic
1188731007 X:33646844-33646866 TCCATCACATGATAGTTTCATGG - Intergenic
1189282974 X:39832235-39832257 AACTTCACATACTGGATTTAAGG + Intergenic
1189898026 X:45676209-45676231 TGGATCACAAGCTAGATTAATGG + Intergenic
1197238742 X:124098854-124098876 TACATAAAATTCTAGATTTATGG + Intronic
1201557119 Y:15274386-15274408 TACAACAAATGATATATTTAAGG - Intergenic