ID: 901896292

View in Genome Browser
Species Human (GRCh38)
Location 1:12315689-12315711
Sequence CCTATCAGGTGTCTCGTCAT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 42
Summary {0: 1, 1: 0, 2: 0, 3: 2, 4: 39}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
901896287_901896292 3 Left 901896287 1:12315663-12315685 CCATGATGTTTCCAACAGTCTTT 0: 1
1: 0
2: 3
3: 19
4: 259
Right 901896292 1:12315689-12315711 CCTATCAGGTGTCTCGTCATTGG 0: 1
1: 0
2: 0
3: 2
4: 39
901896285_901896292 25 Left 901896285 1:12315641-12315663 CCTGGGTATGTGATGTTAAAGCC 0: 1
1: 0
2: 0
3: 9
4: 111
Right 901896292 1:12315689-12315711 CCTATCAGGTGTCTCGTCATTGG 0: 1
1: 0
2: 0
3: 2
4: 39
901896286_901896292 4 Left 901896286 1:12315662-12315684 CCCATGATGTTTCCAACAGTCTT 0: 1
1: 0
2: 4
3: 14
4: 208
Right 901896292 1:12315689-12315711 CCTATCAGGTGTCTCGTCATTGG 0: 1
1: 0
2: 0
3: 2
4: 39
901896289_901896292 -8 Left 901896289 1:12315674-12315696 CCAACAGTCTTTGGACCTATCAG 0: 1
1: 0
2: 0
3: 6
4: 110
Right 901896292 1:12315689-12315711 CCTATCAGGTGTCTCGTCATTGG 0: 1
1: 0
2: 0
3: 2
4: 39

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
901896292 Original CRISPR CCTATCAGGTGTCTCGTCAT TGG Intronic
901896292 1:12315689-12315711 CCTATCAGGTGTCTCGTCATTGG + Intronic
907755273 1:57304846-57304868 CATATCAGATTTCTCATCATAGG - Intronic
908996494 1:70162328-70162350 CCTCTCAGATGTCTCCTCAGGGG - Intronic
915147516 1:153803793-153803815 CCTTTCTGGAGTCTTGTCATTGG - Intergenic
915865010 1:159490212-159490234 CCTGCCAGGTCTCTAGTCATTGG + Intergenic
1074144405 10:110703745-110703767 CCTGCCAGGTGTTTCGTCAAAGG - Intronic
1092215311 12:6677977-6677999 CATGTCAGGTGTCCCATCATAGG - Intronic
1098103150 12:67040522-67040544 CCACTCAGGTGTCCCTTCATGGG + Intergenic
1133665570 16:7964348-7964370 CCTATCTGGTGACTCGTTAATGG - Intergenic
1137061095 16:35792312-35792334 CCTAGGAGGTGTCTGTTCATGGG + Intergenic
1141133061 16:81447894-81447916 CCAACCAGGTGTCTCATGATGGG - Intronic
1143388431 17:6545852-6545874 CCTACCAGGTGTCTGCTCAGGGG - Intronic
1144568514 17:16380271-16380293 ACCATCAGGTGTCTCGATATCGG + Intergenic
1157027300 18:43860720-43860742 TCTATGATGTGTCTTGTCATGGG + Intergenic
1168371975 19:55843302-55843324 CCTATAATGTGTCTAGACATGGG + Intronic
925849245 2:8064926-8064948 CATATCAGGTGTCTTCTCTTGGG + Intergenic
926275876 2:11402822-11402844 CCCATCTGGTCTCTTGTCATTGG - Intergenic
932540932 2:72651423-72651445 CCTTTCAGGTGTCTTTTCAAAGG - Intronic
932660215 2:73645021-73645043 CCCATCAGGTGTGTCCTCCTGGG - Intergenic
932666786 2:73704704-73704726 CCCATCAGGTGTGTCCTCCTGGG - Intergenic
932668724 2:73718720-73718742 CCCATCAGGTGTGTCCTCCTGGG - Intergenic
937775450 2:125770382-125770404 CCTATCAGGTTTCTCTTCCACGG - Intergenic
938599766 2:132825211-132825233 CCTCTCCGGTGTCTCTACATAGG + Intronic
1179109374 21:38433239-38433261 CCACTCGGCTGTCTCGTCATGGG - Intronic
1180063117 21:45396647-45396669 CCCATCAGGGGTCACGTCCTGGG - Intergenic
1180913852 22:19471842-19471864 CCGAACAGGTGTCCCTTCATAGG - Intronic
1181624639 22:24114862-24114884 TCTATCAGGTGTCCCCTAATGGG - Intronic
954535318 3:51355369-51355391 CCTATCAGGGCTCTTGTCACAGG + Intronic
962878634 3:139554985-139555007 CCTATCATATGTCCTGTCATTGG + Intergenic
975175740 4:71286478-71286500 CCTAGCATGTGTCTCTTCTTGGG + Intronic
977840667 4:101699798-101699820 CCTATCAGGTCCCACGTAATTGG + Intronic
987116799 5:14732137-14732159 TCTATCAGATGTCTAGTCAGAGG + Intronic
995446755 5:112253248-112253270 CCTCTCAGGTGTCTCATCTGGGG - Intronic
1003662983 6:8081494-8081516 CCTGTCAGGTGTGTTTTCATAGG + Intronic
1019164952 6:170091850-170091872 TGTATCAGGTGCCTCATCATCGG + Intergenic
1030569907 7:111210199-111210221 CCTATCAGGGGTCTCTTCCTAGG - Intronic
1048253535 8:132887192-132887214 CCTTTCAGGTGTCTGCTCACAGG - Exonic
1054156246 9:61642698-61642720 CTTATCAGCTGTGTCGTCTTAGG + Intergenic
1056900790 9:90597458-90597480 CCCATCAGGTGCCGCGTCATGGG + Intergenic
1058940921 9:109812086-109812108 CCCATGAGGTTTCTGGTCATAGG + Intronic
1059922841 9:119177605-119177627 CCTTTCTCGTGTCTCATCATTGG + Intronic
1195050847 X:101095440-101095462 CATATCAGGATTCTCTTCATAGG - Exonic