ID: 901898123

View in Genome Browser
Species Human (GRCh38)
Location 1:12332609-12332631
Sequence ACCCTCTCCCACCCAACTCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 475
Summary {0: 1, 1: 0, 2: 5, 3: 38, 4: 431}

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
901898123_901898136 21 Left 901898123 1:12332609-12332631 CCTGGAGTTGGGTGGGAGAGGGT 0: 1
1: 0
2: 5
3: 38
4: 431
Right 901898136 1:12332653-12332675 GATGGTAGGGAATGGCCCTTGGG 0: 1
1: 0
2: 0
3: 6
4: 97
901898123_901898129 -8 Left 901898123 1:12332609-12332631 CCTGGAGTTGGGTGGGAGAGGGT 0: 1
1: 0
2: 5
3: 38
4: 431
Right 901898129 1:12332624-12332646 GAGAGGGTTGGTGGGAAGGAGGG 0: 1
1: 0
2: 13
3: 357
4: 3765
901898123_901898135 20 Left 901898123 1:12332609-12332631 CCTGGAGTTGGGTGGGAGAGGGT 0: 1
1: 0
2: 5
3: 38
4: 431
Right 901898135 1:12332652-12332674 AGATGGTAGGGAATGGCCCTTGG 0: 1
1: 0
2: 0
3: 11
4: 167
901898123_901898131 3 Left 901898123 1:12332609-12332631 CCTGGAGTTGGGTGGGAGAGGGT 0: 1
1: 0
2: 5
3: 38
4: 431
Right 901898131 1:12332635-12332657 TGGGAAGGAGGGGAATGAGATGG 0: 1
1: 1
2: 12
3: 180
4: 1952
901898123_901898132 7 Left 901898123 1:12332609-12332631 CCTGGAGTTGGGTGGGAGAGGGT 0: 1
1: 0
2: 5
3: 38
4: 431
Right 901898132 1:12332639-12332661 AAGGAGGGGAATGAGATGGTAGG 0: 1
1: 0
2: 4
3: 51
4: 494
901898123_901898133 8 Left 901898123 1:12332609-12332631 CCTGGAGTTGGGTGGGAGAGGGT 0: 1
1: 0
2: 5
3: 38
4: 431
Right 901898133 1:12332640-12332662 AGGAGGGGAATGAGATGGTAGGG 0: 1
1: 0
2: 8
3: 132
4: 1588
901898123_901898128 -9 Left 901898123 1:12332609-12332631 CCTGGAGTTGGGTGGGAGAGGGT 0: 1
1: 0
2: 5
3: 38
4: 431
Right 901898128 1:12332623-12332645 GGAGAGGGTTGGTGGGAAGGAGG 0: 1
1: 0
2: 13
3: 169
4: 1526
901898123_901898134 13 Left 901898123 1:12332609-12332631 CCTGGAGTTGGGTGGGAGAGGGT 0: 1
1: 0
2: 5
3: 38
4: 431
Right 901898134 1:12332645-12332667 GGGAATGAGATGGTAGGGAATGG 0: 1
1: 1
2: 6
3: 157
4: 2593
901898123_901898130 -7 Left 901898123 1:12332609-12332631 CCTGGAGTTGGGTGGGAGAGGGT 0: 1
1: 0
2: 5
3: 38
4: 431
Right 901898130 1:12332625-12332647 AGAGGGTTGGTGGGAAGGAGGGG 0: 1
1: 0
2: 6
3: 126
4: 1251

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
901898123 Original CRISPR ACCCTCTCCCACCCAACTCC AGG (reversed) Intronic
900004617 1:36523-36545 AGCCTCTCCCACCCAAGTGCTGG + Intergenic
900024340 1:207042-207064 AACCTCTACCACCCAAGTGCTGG + Intergenic
900265089 1:1753303-1753325 GCCCACCCCCACCCACCTCCTGG - Intronic
900788190 1:4662920-4662942 ACCCTCTCCCCTCCACCTCCAGG - Intronic
901039197 1:6354141-6354163 ACTCTCAGCCACCCCACTCCCGG + Intronic
901501664 1:9656140-9656162 CTCCTCCCCCACCCTACTCCTGG - Intronic
901898123 1:12332609-12332631 ACCCTCTCCCACCCAACTCCAGG - Intronic
902195678 1:14796268-14796290 ACCCTCTCCCCACCCACACCCGG + Intronic
902477743 1:16697137-16697159 ATCCTCCCCCACCCTACTCACGG + Intergenic
902659826 1:17893264-17893286 CCCCTCTCCCATACAACCCCTGG - Intergenic
903020887 1:20393281-20393303 CCCCTCTCTCACCCCAATCCTGG + Intergenic
904145961 1:28391474-28391496 CTCCACTCCCACCCAGCTCCTGG - Intronic
904752853 1:32751756-32751778 ACCCTCCAGCACACAACTCCAGG - Intronic
905639246 1:39577035-39577057 ACACCCTCCCACCCATCACCCGG + Intergenic
905975873 1:42173191-42173213 ACCTTCTCCCACCTGAGTCCTGG + Intergenic
906527105 1:46500385-46500407 CCCCTCCCCCACCAAACTCAGGG - Intergenic
906611921 1:47209505-47209527 ACCCTTTCCCACCCTATGCCTGG - Intergenic
907216603 1:52869964-52869986 ACCCCCCCCCACCCCCCTCCCGG + Intronic
907381955 1:54098268-54098290 ACCCTCAGCCAACCAAGTCCTGG + Exonic
907642303 1:56203293-56203315 GCCCTCTCTCACACAACTCGTGG - Intergenic
907853739 1:58281270-58281292 CCCCACCCCCACCAAACTCCAGG + Intronic
909041463 1:70657789-70657811 ACCCCTTCCCACCCAGCTCCTGG - Intergenic
909581007 1:77234767-77234789 TCTCTCTCCCATCCAACTCCTGG - Intergenic
911063082 1:93764450-93764472 CCCCTCTCCCACCCCAGCCCAGG + Intronic
911925656 1:103828452-103828474 TCCCTCTCCCCTCCAACCCCTGG + Intergenic
912634460 1:111279045-111279067 AAACTCTGCCCCCCAACTCCAGG + Intergenic
912860489 1:113209713-113209735 CCCCTCTCTCACCCCACTGCAGG - Intergenic
913198732 1:116478715-116478737 ACCCTCTCCTCCCCACCTGCAGG + Intergenic
913231535 1:116744283-116744305 ACCCCCTCCCCCCCAACCACTGG - Intergenic
913615936 1:120559106-120559128 ACCCTCCCCCACCCACATCAAGG - Intergenic
914574343 1:148951796-148951818 ACCCTCCCCCACCCACATCAAGG + Intronic
914677745 1:149917284-149917306 CCCCCCACCCACCCAAGTCCAGG + Intronic
915829585 1:159114351-159114373 ACCCTTTCCCACTAAACTCAAGG - Intronic
915913746 1:159929451-159929473 AGACTCTCTCACCCAACACCAGG + Intronic
916055457 1:161066233-161066255 CCCTAATCCCACCCAACTCCTGG - Intronic
916465994 1:165075291-165075313 ACCCTCTCCCTGCCAAAGCCTGG - Intergenic
916822984 1:168417842-168417864 TCCCTCTCACCCCCAATTCCTGG + Intergenic
917167314 1:172127063-172127085 ACCCACTCTCACTCAACTACTGG + Intronic
919746125 1:201010218-201010240 GCCCTCCCCCGCCCAACTCCTGG - Intronic
919943456 1:202304049-202304071 GCCCTCTCCAGCCCAGCTCCTGG + Intronic
919982496 1:202650987-202651009 TGCCCCTCCCACCCCACTCCCGG - Intronic
920416356 1:205801333-205801355 ACCCTTCCCCACCCACCTCCAGG - Intronic
921152192 1:212411613-212411635 CCCCTCTCCCTCCCAATTCAGGG - Intronic
921256903 1:213349959-213349981 ATCCTGTCTCACCCAACTCATGG + Intergenic
922752543 1:228077306-228077328 CCTCTCTCGCACCCACCTCCAGG + Intergenic
1063724212 10:8619401-8619423 ACCCACACAGACCCAACTCCAGG - Intergenic
1064507868 10:16053230-16053252 CCCCTCACCCACCCAACAACTGG + Intergenic
1065210541 10:23398266-23398288 AGCCCCTCCCATCCACCTCCAGG - Intergenic
1066380912 10:34900583-34900605 ACCTTCTCCCACCCACCTAGAGG + Intergenic
1067732193 10:48820431-48820453 ACCTTTTCCAACCCACCTCCAGG - Exonic
1068960047 10:62858590-62858612 AGCCTCTCCCACCCTCCTCCAGG + Intronic
1069530193 10:69212506-69212528 AACCTCTGCCACCCAAGGCCAGG + Intergenic
1069604870 10:69732711-69732733 GCCCTCTCCCTGCCAACCCCAGG - Intergenic
1070772108 10:79088529-79088551 ACCCTCTCACTGGCAACTCCCGG - Intronic
1071859066 10:89654432-89654454 AGCCTCACCCACCAACCTCCAGG + Intergenic
1072845469 10:98825602-98825624 ACCCCCGCCCCCCCAACCCCGGG - Intronic
1072999833 10:100277591-100277613 ACCCCCTCCCACCTCCCTCCCGG - Intronic
1073134443 10:101212368-101212390 ACCTGCTCCCACCCAACTGCAGG - Intergenic
1073778760 10:106814516-106814538 AACCTCTCCTACCCACCTCATGG + Intronic
1074102284 10:110363299-110363321 ATCCAATCCCACCCAAATCCAGG + Intergenic
1075721882 10:124592321-124592343 ACCCTCACTCACCCAGCCCCGGG + Intronic
1076078401 10:127555994-127556016 ACCCTCTACCGTCCAACACCAGG + Intergenic
1076338695 10:129728107-129728129 TCCCTCTCTCACCCAGCACCTGG - Intronic
1076615433 10:131751518-131751540 ACCCTCTCCCACCTGACCTCTGG + Intergenic
1077079700 11:719792-719814 ATCCTCACCCGCCCACCTCCTGG - Intronic
1077549734 11:3194677-3194699 ACTCTCCCCCACCCACATCCTGG - Intergenic
1079117850 11:17651921-17651943 ACCCACCCCCACCCAATCCCTGG - Intergenic
1079535887 11:21514905-21514927 CACCTACCCCACCCAACTCCTGG - Intronic
1080042557 11:27774423-27774445 ACCCCCTCACCCCCAAATCCAGG + Intergenic
1081289270 11:41305264-41305286 ACCCTCCCCCACCTCCCTCCCGG - Intronic
1081732857 11:45383867-45383889 GCCCCCTCCAACCCCACTCCTGG + Intergenic
1082263518 11:50096207-50096229 AGCCTCACCCACTGAACTCCAGG + Intergenic
1083073641 11:60014254-60014276 CCCTCCTTCCACCCAACTCCTGG + Intergenic
1083166428 11:60890972-60890994 ACCCTCATCCATGCAACTCCAGG - Exonic
1083261243 11:61524252-61524274 ACCCTCTCCCACAGCCCTCCTGG + Intronic
1083614951 11:64021645-64021667 GCCCCCACCCCCCCAACTCCTGG - Intronic
1083669302 11:64291510-64291532 CTCCTCTGCCACCCACCTCCCGG + Intronic
1083779073 11:64908940-64908962 ACCCCCTCCCGCCCACCGCCCGG - Intronic
1083959139 11:66004323-66004345 ACCCTCTCCCACATCACTCGGGG - Intergenic
1084318028 11:68356767-68356789 TCCCTCTCCTCTCCAACTCCTGG + Intronic
1084934726 11:72580796-72580818 ACTCGCTCCCACCCATCTTCAGG + Intronic
1085446165 11:76602595-76602617 AGCCTTTCCCACCCAGCCCCAGG - Intergenic
1085449208 11:76622028-76622050 AGCCACTCCTCCCCAACTCCAGG + Intergenic
1085522030 11:77144607-77144629 ATCCCCTCCCTCCCAACTCCAGG + Intronic
1086148224 11:83579100-83579122 AACCTCTTCCACAAAACTCCAGG + Intronic
1086599718 11:88617861-88617883 AGCCTCTCCCACCCACCTCCTGG - Intronic
1087165059 11:94994775-94994797 TCTCTCTCCCACCCAACCCCAGG - Intronic
1088379155 11:109173916-109173938 ACACTATCCCAGCCAACACCAGG - Intergenic
1088648398 11:111936796-111936818 TCCCTTTCCCACCCACCTTCTGG + Intronic
1088689346 11:112311801-112311823 ACCCTCTCCTCCCCACTTCCTGG - Intergenic
1088807507 11:113365751-113365773 AGCCTCTCTCACTCAGCTCCCGG - Intronic
1088895977 11:114078687-114078709 ACCCCCTCCCCCTCAATTCCTGG - Intronic
1089202105 11:116730794-116730816 ATCCCCTCTCACCCAAATCCTGG + Intergenic
1089496153 11:118909597-118909619 ACCCCCTCCCACCCTACTGTGGG - Intronic
1089597580 11:119590853-119590875 CCCCTCTCCCTTCCACCTCCAGG - Intergenic
1089762828 11:120740796-120740818 GGCCTCTCCCACCCTTCTCCTGG + Intronic
1089795477 11:120977149-120977171 ACGCTCTCCCCACAAACTCCTGG - Intronic
1090212715 11:124934066-124934088 CCTCTCTGCCACCCAACTCCAGG + Intronic
1091130088 11:133138688-133138710 AACATCTCCCACCCCACTCCTGG + Intronic
1091378037 12:38577-38599 AACCTCTACCACCCAAGTGCTGG + Intergenic
1091697369 12:2637017-2637039 TCCCTCTCCCACACAACTGATGG + Intronic
1091710890 12:2739631-2739653 GCCCTCTCCCAGCCAAGCCCTGG + Intergenic
1092241575 12:6839275-6839297 ACACTCTCCTCCCCAACCCCAGG + Exonic
1093376069 12:18429472-18429494 ACCCTCTCCCAGCCACCATCTGG + Intronic
1095420314 12:42018157-42018179 ACCCTTTCCCACTCATGTCCAGG - Intergenic
1095420446 12:42018971-42018993 ACCCTTTCCCACTCATGTCCAGG + Intergenic
1096102039 12:48975700-48975722 ACCCTCTTGCCCCCTACTCCTGG + Intergenic
1096656600 12:53096481-53096503 ACCCACACCCACCCAACTCTGGG - Intergenic
1098335457 12:69399959-69399981 TCCCTTCCCCACCCATCTCCTGG - Intergenic
1099727541 12:86452350-86452372 ACCCTCCCCCACCCCACAACAGG + Intronic
1100075741 12:90780802-90780824 ACCATCTCCAACCCAATTCCAGG + Intergenic
1100243096 12:92729476-92729498 TTCATCTCCCACCCCACTCCTGG + Intronic
1100735596 12:97526179-97526201 ACCATCCCCCACCCCACTTCCGG + Intergenic
1100996048 12:100302213-100302235 CACCTCCCCCACCCAACCCCAGG - Intronic
1101085961 12:101236604-101236626 CCCCTCTTCCACCAAATTCCAGG - Intergenic
1102436127 12:112925355-112925377 CCCCTCTCCCAGCCAACCGCAGG + Intronic
1102437980 12:112940032-112940054 ACCCCCTCCCACCCCTTTCCAGG - Intronic
1102890345 12:116553790-116553812 ACCCTCATCCCTCCAACTCCTGG - Intergenic
1103716314 12:122947385-122947407 GCCATCTCCCACCCAGCCCCCGG - Intronic
1103931157 12:124451839-124451861 ACCCCCGCCCACCCATCCCCAGG + Intronic
1104236256 12:126940314-126940336 CCCCTCTCACCCCCAATTCCTGG - Intergenic
1104602092 12:130161425-130161447 ACTCCATCCCACCCTACTCCGGG + Intergenic
1107068041 13:36238112-36238134 ACCCCCTTCCACTAAACTCCTGG - Intronic
1107739943 13:43439122-43439144 AACCTCTGCCTCCCACCTCCCGG + Intronic
1107958622 13:45540437-45540459 ACCCACCTCCACCCCACTCCAGG - Intronic
1108199435 13:48028109-48028131 CCCCTCTCCTGCCCAATTCCAGG - Intergenic
1110639367 13:77804372-77804394 TCCCCCTCCCACCCTACTCTTGG + Intergenic
1111128823 13:83947993-83948015 CCCCTCTCCCACCCCAGTCCAGG + Intergenic
1111446739 13:88355833-88355855 ACCACCTTCCCCCCAACTCCTGG + Intergenic
1111706942 13:91761874-91761896 AGCCCCTCCCACCAACCTCCAGG - Intronic
1111763175 13:92492337-92492359 CCCCTCTCCCACCCCACAACAGG - Intronic
1112585745 13:100716879-100716901 ACCCCCTCTCTCCCCACTCCAGG - Intergenic
1112656195 13:101454402-101454424 CCCCCCCCCCCCCCAACTCCTGG + Intronic
1113540167 13:111100948-111100970 ACCCTATCCAACCCCACTGCTGG + Intergenic
1113578940 13:111414453-111414475 AACATCTACCACCCACCTCCAGG + Intergenic
1113864452 13:113512019-113512041 ACCCTCTCCCTCTCCAGTCCCGG - Intronic
1113864468 13:113512094-113512116 ACCCTCTCCCTCTCCAGTCCCGG - Intronic
1113864502 13:113512240-113512262 ACCCTCTCCCTCTCCAGTCCCGG - Intronic
1113864518 13:113512315-113512337 ACCCTCTCCCTCTCCAGTCCCGG - Intronic
1113906656 13:113822432-113822454 ACCCTCTCACACCCAACCTGGGG - Intronic
1113964393 13:114144480-114144502 ACTCTCGCCCACCCAGGTCCAGG + Intergenic
1114194529 14:20465557-20465579 ACCCAATCCCACCCAACCCCCGG - Intergenic
1115025176 14:28736303-28736325 ACCCTCTCACAGCCACCTCAAGG + Intergenic
1115644455 14:35358452-35358474 AGCCTCTACCACCCAGCACCAGG + Intergenic
1115766071 14:36624878-36624900 ACCCTCACCCACCCTGCTCTGGG - Intergenic
1116538345 14:46064554-46064576 CCACTCTCCCTCCCAACCCCTGG + Intergenic
1117338605 14:54775425-54775447 ACCTTCTGCCACCCAAATCTGGG + Intronic
1117846805 14:59920156-59920178 ACCCTCTCCCGCCCCAGGCCTGG - Intronic
1117865287 14:60142081-60142103 CCCCTCGCCCACCCCATTCCAGG - Exonic
1119037758 14:71245248-71245270 GCCCTCTCTCACCTAACTTCTGG - Intergenic
1119620817 14:76130805-76130827 CCCCTTTCCCACCCACCTTCTGG + Intergenic
1122325020 14:100876715-100876737 ACCCCCTCCCACCCTTTTCCTGG + Intergenic
1123697849 15:22891918-22891940 GCCCTCTCCATCCCAGCTCCAGG + Intronic
1125325764 15:38534636-38534658 CTTCTCTCCCACCCAACTGCTGG + Intronic
1125845308 15:42846790-42846812 AGCCTCACCCACCAACCTCCAGG + Intronic
1125868500 15:43076760-43076782 ACCCCCTCCCACCTCCCTCCCGG - Intronic
1128041864 15:64581963-64581985 ACCCTCTCCAACACTATTCCTGG + Intronic
1129074207 15:72977497-72977519 TCCCTCTTTCACCCAAATCCAGG - Intergenic
1129394275 15:75235705-75235727 AGCCTCTCCCACCAGGCTCCTGG + Intergenic
1129737039 15:77972302-77972324 ACCCTCTTCCTTCCACCTCCTGG - Intergenic
1129849041 15:78781333-78781355 ACCCTCTTCCTTCCACCTCCTGG + Intronic
1130074158 15:80674442-80674464 AGCCTCACCCACCAACCTCCAGG + Intergenic
1130107473 15:80939723-80939745 ACCCCCTATAACCCAACTCCTGG - Intronic
1130295888 15:82647108-82647130 ACCCTCTCCCGCCCATGACCAGG + Intronic
1131625799 15:94119352-94119374 ACCCCCTCCAGCCCAACTTCTGG + Intergenic
1132448891 15:101954420-101954442 AGCCTCTCCCACCCAAGTGCTGG - Intergenic
1132872632 16:2122547-2122569 ACCCTGTCCCACCCCACGGCGGG - Intronic
1132954018 16:2581435-2581457 GCCCTCCCCCACCCACCTCGAGG - Intronic
1132960327 16:2618728-2618750 GCCCTCCCCCACCCACCTCGAGG + Intergenic
1133218077 16:4305526-4305548 ACCCACTCCTGCCGAACTCCAGG - Intergenic
1133910463 16:10061306-10061328 ACCCTCAACCACCTACCTCCAGG + Intronic
1134551729 16:15141747-15141769 ACCCTGTCCCACCCCACGGCGGG - Intergenic
1135187234 16:20325881-20325903 ACCCTCTCCCACCCTCCTCCAGG + Intronic
1137751388 16:50863497-50863519 ACCCTCTCCCACCCCTGCCCCGG - Intergenic
1137788564 16:51155478-51155500 GCTCTGTCCCACCCACCTCCGGG - Intergenic
1141144315 16:81518308-81518330 TCTCTCTGCTACCCAACTCCAGG - Intronic
1141167975 16:81673131-81673153 AGCCACTTCCACCCAAATCCTGG - Intronic
1141186425 16:81790765-81790787 TGCCTCTCCCTCCCTACTCCAGG + Intronic
1141951045 16:87339590-87339612 ACCCTCACCCTGTCAACTCCCGG + Intronic
1141985565 16:87577502-87577524 ACCCTCTCCCACTCATCCACTGG + Intergenic
1143131280 17:4679106-4679128 ACCCTCTGCCTCCCAGCTTCAGG + Intronic
1143172452 17:4938113-4938135 GCACCCTCCCACCCACCTCCAGG + Intronic
1143300022 17:5902180-5902202 GCCTTCTCACACCCAACCCCTGG - Intronic
1143385309 17:6525989-6526011 ATCCTCATCCACTCAACTCCTGG - Intronic
1143509988 17:7390097-7390119 ACTCTCTCCCACCCCCTTCCAGG - Exonic
1143515016 17:7415145-7415167 GCCCTCTCCCACCCCATACCGGG - Exonic
1143527908 17:7483018-7483040 TCCCTGTCCCTCCCAACCCCCGG - Exonic
1144682887 17:17206754-17206776 ACCCTCCACCCCCCAACGCCAGG + Intronic
1145013907 17:19384756-19384778 ACCCTCTCCCGGCCAGCTCGGGG - Intronic
1145397704 17:22508134-22508156 TCCCTCTCCTACCCCACCCCTGG + Intergenic
1146399183 17:32489926-32489948 ACCCTCTGCCTCCCCACCCCAGG - Exonic
1146730852 17:35193252-35193274 TCCCTGTCCCTCCCAACCCCCGG + Exonic
1146845416 17:36179010-36179032 GCCCCCTCCCACCCTGCTCCAGG - Intronic
1146873631 17:36390853-36390875 GCCCCCTCCCACCCTGCTCCAGG - Intronic
1146880990 17:36441941-36441963 GCCCCCTCCCACCCTGCTCCAGG - Intergenic
1146927729 17:36756578-36756600 TCCCTCCCCCCCCCAGCTCCTGG + Intergenic
1147065757 17:37922020-37922042 GCCCCCTCCCACCCTGCTCCAGG + Intergenic
1148491506 17:48026475-48026497 AACCTCCCCCACCCCACCCCAGG - Exonic
1148740626 17:49890580-49890602 GCCCTCCCCCAGCCAGCTCCGGG + Intergenic
1149454519 17:56777136-56777158 GACCCCTCCCACCCTACTCCAGG + Intergenic
1149562691 17:57620003-57620025 ACCCTATCCAGCCCAACCCCAGG + Intronic
1149865627 17:60149709-60149731 CCCCTCCCCCATCCTACTCCTGG - Intergenic
1150534394 17:66021081-66021103 ACCCTATCCCTCCCAAGCCCTGG + Intronic
1151670880 17:75571113-75571135 ACCCCCTGCCCCCCAACCCCAGG - Intronic
1152288590 17:79426044-79426066 TCCCTCTCCTCCCCAGCTCCAGG - Intronic
1152597269 17:81243863-81243885 ACCCCCTCCCAGCCTCCTCCCGG + Intergenic
1152724865 17:81940172-81940194 AGCCTCTCCCACCCACGTCCGGG - Exonic
1155160698 18:23193076-23193098 ACACTCCCCCACCCAACTCTAGG - Intronic
1155248775 18:23936385-23936407 CCCCTCCCCCACCCCACTACAGG + Intronic
1155767382 18:29652701-29652723 ACCACCTCTCCCCCAACTCCAGG + Intergenic
1156499233 18:37546522-37546544 ACCCTTTCCCTCCCAGCTCAGGG - Intronic
1157274987 18:46304125-46304147 ACCCGCTACCTCCCACCTCCTGG + Intergenic
1159768748 18:72522783-72522805 ACCCTCCCCCACCCAACCCCAGG - Intergenic
1159774110 18:72584423-72584445 AGCCTCAGCCTCCCAACTCCAGG + Intronic
1160134405 18:76260302-76260324 ACCCCCTCCCCCCCACCCCCAGG - Intergenic
1160427486 18:78788121-78788143 CCCCACTCCCATCCACCTCCTGG + Intergenic
1160636369 19:78132-78154 AGCCTCTCCCACCCAAGTGCTGG + Intergenic
1161129337 19:2579006-2579028 TCCCTCTCCCAGCCATTTCCTGG - Intronic
1161139223 19:2637947-2637969 CCTCTCTCCCTCCCAACTCAGGG - Intronic
1161270681 19:3387801-3387823 ACCCTCTCCCGCCCCACCCCCGG - Intronic
1161395704 19:4043844-4043866 ACCCCCCCCCCCCCACCTCCAGG + Intergenic
1161450299 19:4342198-4342220 AGCCTCTTGCACCCAAATCCTGG - Intronic
1162067220 19:8133153-8133175 ACCCTCTCTCTCCCTCCTCCAGG + Intronic
1163722202 19:18903628-18903650 CCCACCTCCCACCCAGCTCCCGG + Intronic
1165760679 19:38319729-38319751 ACCCTCTCCGAACGAACACCTGG + Intergenic
1166222893 19:41376903-41376925 GCCCTCTCATCCCCAACTCCAGG - Intronic
1166833229 19:45650901-45650923 ATCCCCTGCCTCCCAACTCCAGG - Intergenic
1168209584 19:54880969-54880991 CTCCTCTCCCACCCAAGTGCTGG + Intronic
1168291837 19:55360957-55360979 ACCTTCTCCCACCCACCCACCGG + Intronic
1168695108 19:58399923-58399945 TCCCTCTCCCACCCAACCTAGGG + Intergenic
1168724041 19:58570982-58571004 ACACTCACTCACCCATCTCCGGG + Exonic
1202711760 1_KI270714v1_random:22963-22985 ATCCTCCCCCACCCTACTCACGG + Intergenic
925033720 2:671268-671290 GCCCTCCCACACCCAGCTCCAGG - Intronic
925152165 2:1622470-1622492 ATCCACACCCACCCAACCCCTGG - Intergenic
926573216 2:14552569-14552591 ACTCTTTCCCACACAAGTCCAGG + Intergenic
927841562 2:26448369-26448391 ACACTCTCCCTCCCACTTCCTGG + Intronic
928170389 2:28999490-28999512 CCCCTCACCCACCCACTTCCAGG + Intronic
928264608 2:29800963-29800985 CCCCTCTCTCACCCAAATCGGGG + Intronic
930053911 2:47237538-47237560 CCCCTCTCCCTCCTACCTCCAGG - Intergenic
931312603 2:61096398-61096420 CCCTTCTCCAAACCAACTCCTGG + Intronic
932812193 2:74834727-74834749 ACCCGCTTCCTCCCTACTCCGGG + Intronic
934558305 2:95299152-95299174 ACCCTCCCACAACCAGCTCCTGG + Intronic
935106666 2:100051209-100051231 ACCCACTCCCACCCCAGCCCTGG + Intronic
935667736 2:105526640-105526662 ACCCTTTGCCACCCTGCTCCCGG + Intergenic
936272208 2:111057559-111057581 CCCCTCTCCCTCTCTACTCCTGG - Intronic
936565111 2:113576917-113576939 AACCTCTACCACCCAAGTGCTGG - Intergenic
937273464 2:120669854-120669876 ACCCGCCCTCACCCCACTCCCGG - Intergenic
937276959 2:120691060-120691082 CTCCACTCCCACCCACCTCCAGG + Intergenic
937447909 2:121974460-121974482 ACCTGTACCCACCCAACTCCTGG - Intergenic
938342913 2:130547363-130547385 ACCCTCTGCCTCACACCTCCTGG + Intronic
938346920 2:130573359-130573381 ACCCTCTGCCTCACACCTCCTGG - Intronic
938790444 2:134671322-134671344 ACCCACCCCTCCCCAACTCCTGG + Intronic
940228316 2:151423770-151423792 ACCCCCTACCACCCAAAACCTGG - Intronic
941688728 2:168475913-168475935 ACCCTCTCACATGCAAGTCCGGG + Intronic
943830741 2:192458624-192458646 ACTTCCTCCCACCCAGCTCCTGG + Intergenic
944480108 2:200148444-200148466 TCCCTCTCACACCCAGATCCCGG - Intergenic
945254127 2:207789868-207789890 AACCTCTGCCCCCCAACCCCAGG - Intergenic
945845026 2:214933700-214933722 ACCCTGTCCAACCCTAATCCAGG + Intronic
945859245 2:215101950-215101972 ACCATCTCCCACACAGCTGCAGG + Intronic
945887053 2:215386766-215386788 ACCCTCACCAACCTCACTCCAGG - Exonic
946236315 2:218326643-218326665 ATACTCTCCCACCCAACTCCAGG - Intronic
946307612 2:218865118-218865140 GACCTCTCCCCACCAACTCCTGG - Intronic
946416977 2:219544621-219544643 TCCCTCTCCCACCCCCATCCTGG + Intronic
947640915 2:231707560-231707582 CCCTTCTCCCACCCCACTGCTGG - Intronic
947661811 2:231875087-231875109 ACCCTCTCCCAGCTACCTCTTGG - Intergenic
948178457 2:235961909-235961931 ACCCTCGCTCACCCAGCACCCGG - Intronic
948393815 2:237630433-237630455 CCCCTTTCTGACCCAACTCCTGG - Intronic
948517154 2:238511142-238511164 ACCATCTGCCAGCCAACCCCAGG - Intergenic
1168942320 20:1723311-1723333 ACCTTCCCCAACCCTACTCCAGG - Intergenic
1169032170 20:2417960-2417982 GCCCTCTCCCACAGAACACCTGG - Intronic
1169162023 20:3388778-3388800 TCCCTCTCCCATCCAGCACCTGG - Intronic
1169197714 20:3692469-3692491 ACCCTCCACCACCCTCCTCCTGG + Intronic
1169975303 20:11319089-11319111 CTCCTCTCCCACCCAGCCCCTGG + Intergenic
1170590521 20:17767859-17767881 ACCCTGCCCCACCCTACACCTGG - Intergenic
1172207688 20:33176101-33176123 CCCCTCTCCCTCCCAACTGGAGG - Intronic
1172808530 20:37630802-37630824 CCCTTCTCCCTCCCAACTCCTGG - Intergenic
1173053041 20:39583727-39583749 CCCCTCTCCCTCCCATCCCCTGG - Intergenic
1173579563 20:44137477-44137499 ACCCACTCGCACCCCACCCCAGG + Intronic
1174640535 20:52040119-52040141 TGCCTCCCCCGCCCAACTCCAGG - Intergenic
1174832435 20:53825167-53825189 ACCCCCTCCCACCCTTCCCCCGG - Intergenic
1175859686 20:62143562-62143584 ACCCCCTCGCACCCAGCGCCCGG - Intergenic
1175913748 20:62416265-62416287 CCCCTGTCCCCCCCAACCCCTGG - Intronic
1175917304 20:62432528-62432550 TCCCTCTCCCAGCCAGCTCTTGG + Intergenic
1176019704 20:62956411-62956433 CTCCTCTGCCACCCATCTCCTGG + Intronic
1176045132 20:63088579-63088601 ACCCTCTCCCAGCAAGCTCCGGG - Intergenic
1176085791 20:63294853-63294875 TCCCACTCCCACCCCACTCTTGG - Intronic
1176237280 20:64059467-64059489 TCCCTCTCCCTCCCAACTCTGGG + Intronic
1176293097 21:5056463-5056485 ACCCCCTCACACCCACCTGCAGG - Intergenic
1176861468 21:14013556-14013578 ACCCTGTCCCTCACCACTCCTGG - Intergenic
1178470252 21:32886062-32886084 ACCCTCTCCAACCTACCTCAAGG - Intergenic
1179496809 21:41776886-41776908 TCCCACTCCCAGACAACTCCAGG - Intergenic
1179864163 21:44207187-44207209 ACCCCCTCACACCCACCTGCAGG + Intergenic
1180153961 21:45968648-45968670 GCCCTGCCCCACCCACCTCCTGG - Intergenic
1180155889 21:45977316-45977338 ACCCTCTCCCTTCCCACACCTGG + Intergenic
1180199352 21:46215398-46215420 TCCCCCTCCCACCCACCCCCAGG + Intronic
1180684047 22:17651073-17651095 AACCTCTGCCTCCCAAGTCCCGG + Intronic
1181517782 22:23425631-23425653 CCCATCACCCCCCCAACTCCAGG + Intergenic
1181766793 22:25098067-25098089 ACCCTCTGCCTACCAAATCCTGG - Intronic
1182072529 22:27473854-27473876 ACCCTCTCCCTACCAAGACCCGG - Intergenic
1182551306 22:31102248-31102270 TCCCTCTCCCTCCCACCCCCAGG - Intronic
1183186913 22:36297141-36297163 AGACACTCGCACCCAACTCCTGG + Intronic
1183327729 22:37203540-37203562 AGCCACTCCCACCCAACGCTGGG + Intergenic
1183686314 22:39363212-39363234 ACCTTCCCCCACCAAACGCCAGG - Intronic
1184067075 22:42127134-42127156 ACCCTCTCCGACCCCACAGCAGG + Intronic
1184069800 22:42140838-42140860 ACCCTCTCCGACCCCACAGCAGG + Intergenic
1184534651 22:45078096-45078118 AGCCTCTCCCTCCCCAGTCCAGG - Intergenic
1184831328 22:46990652-46990674 ATCCCCTTCCACCCAACCCCTGG + Intronic
1185096401 22:48808398-48808420 ACCCTCCCTCTCCCCACTCCCGG - Intronic
949888004 3:8711662-8711684 ACCCCCACCCCCCCAATTCCTGG - Intronic
949947532 3:9202424-9202446 ACCCTCTAAGCCCCAACTCCAGG + Intronic
950878984 3:16306136-16306158 ACCCTTTCCCAGCCTACTCAAGG + Intronic
951259972 3:20495873-20495895 ACCATCTCTCCCCCAACCCCAGG - Intergenic
951811175 3:26701701-26701723 ACACTCTGCCTCCCAACTCCAGG + Intronic
952082846 3:29781822-29781844 ACCCTCTCCCACACAGCCCACGG - Intronic
953540616 3:43814519-43814541 CCAATCTCCCAGCCAACTCCTGG - Intergenic
953901492 3:46846288-46846310 TCCCACTCCCACCCACATCCCGG - Intergenic
953980522 3:47410872-47410894 ACCCTCTGCCAGCCCACTCAGGG + Exonic
954354972 3:50077273-50077295 CCCCACTCCCACCCATCTCTGGG - Intronic
955745428 3:62135727-62135749 ACGCTCTCCCCACCAACCCCTGG - Intronic
956124400 3:65997781-65997803 ACCCTCTCCCCCTCGACACCAGG + Intronic
957484809 3:80845810-80845832 ACCCTCTGCCCCACAGCTCCTGG + Intergenic
957672480 3:83323787-83323809 ACCATCTCTCCTCCAACTCCAGG - Intergenic
957750030 3:84403221-84403243 ACCTTCCCCCACCCAACAACAGG + Intergenic
957906973 3:86569904-86569926 ACCCTGTCCCTCCCAAGCCCTGG + Intergenic
959781457 3:110239047-110239069 AGCCTCACCCACCAATCTCCAGG - Intergenic
960069228 3:113410296-113410318 CCCCTCTCCCACCCCACGACAGG + Intronic
961482550 3:127193367-127193389 GCACTCTCCCACCCAACTCCTGG + Intronic
961658658 3:128456991-128457013 ACCCTCCCCCAGCCCCCTCCAGG + Intergenic
961661928 3:128473531-128473553 TCTCTATCCCACCCAACTCAGGG - Intergenic
962460710 3:135609987-135610009 CCCTTCTCCCACCCAACAACAGG - Intergenic
962754328 3:138456741-138456763 ACCATTTCCCACCCCACCCCCGG + Intronic
962866869 3:139454384-139454406 GCCCTGTCCCACCCTCCTCCAGG + Intronic
963260536 3:143187297-143187319 TCCCACTCCTCCCCAACTCCTGG - Intergenic
963281165 3:143385958-143385980 ACCCCCTCCCTCCAAACTCCAGG + Intronic
965872093 3:173276170-173276192 ACTCTCTTCCACCCAAAACCCGG + Intergenic
966327997 3:178778749-178778771 ACACCCTCCAACCCGACTCCTGG + Intronic
968489907 4:884394-884416 TCCCTCTCCCAGCCCACTCCTGG - Intronic
968500729 4:948609-948631 ACCCTTTCCCGCTCACCTCCAGG - Intronic
968520687 4:1033506-1033528 CCCCTCTCCGGCCCGACTCCTGG + Intergenic
968939597 4:3631056-3631078 CCCCCCTCCCACCCCACCCCAGG - Intergenic
969376830 4:6768563-6768585 GCCCTTTCCCACCCAGCTCTGGG - Intergenic
969618034 4:8265074-8265096 ACCCCCTCCCTCCCAAGTCCTGG - Intergenic
970148854 4:13068019-13068041 ACCCTCACCCATCTAACTTCTGG - Intergenic
972336444 4:38111000-38111022 AGCCCCTCACACCCAACTCAAGG - Intronic
973312507 4:48724563-48724585 GCCCCCCCGCACCCAACTCCTGG - Intronic
974047177 4:56908049-56908071 ACCCTCTGCAGCCCCACTCCTGG + Exonic
976265974 4:83186185-83186207 ACCCCCCCCCACCCCGCTCCCGG + Intergenic
976481816 4:85555571-85555593 ATCCTCTCCCACTCAAGTCCTGG + Intronic
977735353 4:100408643-100408665 ATCCTCTCCCACTCAAGTGCTGG + Intronic
978220372 4:106265754-106265776 TCCCTCTCCACCCCATCTCCAGG + Intronic
981527067 4:145717164-145717186 GCCCCCACCCACCCAACTTCAGG - Intronic
982198405 4:152937367-152937389 GCCGTCTCCCACCCAACTTCTGG + Intronic
983186833 4:164709969-164709991 ACCCTCTGCCACCCACCTCTAGG - Intergenic
983254207 4:165379564-165379586 ACCCTCTGCCGCCCCCCTCCGGG - Intronic
984563709 4:181301914-181301936 ACCCTCTTCACCCCAACGCCAGG + Intergenic
985708252 5:1413995-1414017 ACCCTCTCGGAGACAACTCCAGG + Intronic
988039134 5:25865299-25865321 CCTCTCTCCAACCCAACTCCTGG + Intergenic
992105403 5:73446707-73446729 ACCCTCTTCCTCCCTACCCCAGG + Exonic
995191472 5:109322906-109322928 ACCCTCTCCCTCCCACTGCCTGG + Intergenic
995461733 5:112410668-112410690 CCCCACTCCCACCCAGCTTCAGG + Intronic
996228903 5:121036745-121036767 CCCCTCTCCCACCCCACAACAGG + Intergenic
996238791 5:121169302-121169324 AACCTCACCCTCCCAAATCCAGG - Intergenic
997213214 5:132089972-132089994 ACCCTGTACCATCCAACTCCAGG - Intergenic
997370008 5:133353492-133353514 ACACTCTCCTGCCAAACTCCAGG - Intronic
998181411 5:139948072-139948094 CTCCTCCCCCACCCAACCCCTGG + Intronic
998524688 5:142831686-142831708 ACCCTCTGCCACCCATCCCTGGG + Intronic
1000998029 5:167978606-167978628 ACTCTCTCACTCCCAGCTCCTGG - Intronic
1001275598 5:170348791-170348813 ACTCACCCCCACCCAACTCTAGG + Intergenic
1002173960 5:177391087-177391109 AGCCTCTCCTACCCCACCCCAGG + Intronic
1002571315 5:180140751-180140773 ACCCTCACCCAGCCCATTCCAGG - Intronic
1002636463 5:180611290-180611312 GCTTTCTCCCACCCTACTCCTGG + Intronic
1002668655 5:180846791-180846813 ATCCTCTCCCACCCAGTACCTGG + Intergenic
1002720943 5:181261237-181261259 CCCCCAGCCCACCCAACTCCCGG - Intergenic
1005830528 6:29667565-29667587 ACCCTCCCACACCCAGCGCCTGG - Intronic
1006750468 6:36373578-36373600 CCTCCCTCCCACCCACCTCCAGG - Exonic
1006767578 6:36522333-36522355 CCCCTCTGCCACCCTGCTCCTGG - Intronic
1006902285 6:37510980-37511002 TCACTCTCTCACCCTACTCCTGG + Intergenic
1008278063 6:49563903-49563925 ACCATCTCCCTCCCCACCCCTGG + Intergenic
1009771641 6:68151281-68151303 ACACAGTCCAACCCAACTCCAGG + Intergenic
1011191557 6:84735080-84735102 ACCCTTTCCCCACCAAATCCAGG + Exonic
1011945210 6:92891357-92891379 TCCTTCTCCCTCCCAACCCCAGG - Intergenic
1011988999 6:93488679-93488701 AGGCTCTCCCACTCAAATCCTGG - Intergenic
1012757748 6:103253117-103253139 CCCCTCTCCCACCCCACGACAGG - Intergenic
1013933741 6:115568536-115568558 CCCCTCTCCCACCCTCCCCCCGG - Intergenic
1014557100 6:122849407-122849429 ACCCCCTCCCACCTCCCTCCCGG + Intergenic
1014754989 6:125292619-125292641 TCCCTCGCCACCCCAACTCCTGG - Intronic
1016899420 6:149086894-149086916 ACCCACTACCACCCACCCCCAGG + Intergenic
1018012455 6:159683969-159683991 ACCCTCTGCCAGACAACTCATGG + Intronic
1019664782 7:2246386-2246408 ACACTCTCCCAGCCAACGTCAGG - Intronic
1019705256 7:2494429-2494451 CCCCTGCCCCACCCACCTCCTGG - Intergenic
1020247112 7:6438196-6438218 CTCCTCCCCCACCCAACTACAGG - Intronic
1020707355 7:11561998-11562020 CCCAGTTCCCACCCAACTCCTGG + Intronic
1022296215 7:29056348-29056370 TCCCTCCCTCCCCCAACTCCTGG + Intronic
1022516039 7:30975593-30975615 ACCCCCGCCCCCCCATCTCCAGG + Intronic
1023301906 7:38782230-38782252 AGCCTCTCACACCTAACTGCAGG + Intronic
1023818306 7:43966399-43966421 ACCCCCTCCCACCCTCCTCTGGG - Intergenic
1023861395 7:44219558-44219580 CCCCTCTCCCATCCACCCCCAGG + Intronic
1023864330 7:44231766-44231788 AGACTCTCCCACCCTGCTCCAGG + Intronic
1024717213 7:52093045-52093067 ACCCTCTCCCAGACAGCACCTGG - Intergenic
1026633092 7:72055226-72055248 ACCCTGCCCCACCCAGCCCCAGG - Intronic
1026895503 7:74007934-74007956 GCCCACTCCCACCTCACTCCAGG + Intergenic
1026973954 7:74485098-74485120 ACCCTAAGCCACCCAGCTCCGGG - Intronic
1028121284 7:87059280-87059302 GCCCTCCCCCAGCAAACTCCAGG + Intronic
1028301905 7:89210489-89210511 CCCATCCCCCACCCAACCCCTGG + Intronic
1028684278 7:93575077-93575099 CCCCTCTCCCTCCCTACTCAAGG - Intergenic
1029181532 7:98705432-98705454 CCCCTCTCCCTCCCCACTCTTGG + Intergenic
1029742936 7:102501231-102501253 ACCCCCTCCCACCCTCCTCTGGG - Intronic
1029746252 7:102517281-102517303 ACCCCCTCCAACCCCACCCCGGG + Intronic
1029760926 7:102600392-102600414 ACCCCCTCCCACCCTCCTCTGGG - Intronic
1029764190 7:102616260-102616282 ACCCCCTCCAACCCCACCCCGGG + Intronic
1032320676 7:130883873-130883895 TCTCTCAACCACCCAACTCCCGG - Intergenic
1033728866 7:144153077-144153099 CCCCACTCCCACCCAGCTCTGGG + Intergenic
1034106807 7:148497250-148497272 ACTCACCCCCACCCACCTCCTGG - Intergenic
1034395898 7:150824817-150824839 GCCCTCCCCCACCCCACTCCCGG + Intronic
1034446580 7:151116882-151116904 AGCCTCGCCCCCCCAGCTCCAGG - Intronic
1036412533 8:8515606-8515628 ACTCTCTCTCACCCACGTCCTGG - Intergenic
1036737683 8:11332140-11332162 TCCCTGTCCCTCCCAACCCCCGG - Exonic
1036784144 8:11674440-11674462 AACCTCTGCCTCCCAAGTCCCGG - Intergenic
1038165960 8:25085286-25085308 CCCCTCCCCCACCCAAATACAGG + Intergenic
1040603785 8:48910137-48910159 GCCTCCTCCCACCCACCTCCTGG + Intergenic
1041740982 8:61156253-61156275 ACCCTCACCCTCCCATCACCTGG + Intronic
1042876830 8:73448143-73448165 ATCCTCTCCCTCCCAGCTGCAGG + Intronic
1044341272 8:91048986-91049008 AACCTCCCCCACCCTACCCCTGG + Intergenic
1044623641 8:94215475-94215497 CCCCTCTGCCCCCCAACTGCAGG - Intronic
1044952147 8:97445192-97445214 ATCCTCTCCCACGAAAATCCTGG - Intergenic
1045815583 8:106272242-106272264 CCCCACTCTCACCCAACGCCGGG - Intronic
1046547383 8:115668771-115668793 CCCCTCTCCCACCCGGCACCGGG - Exonic
1046889684 8:119409064-119409086 AACCTCTCCCACCCAGTTTCTGG - Intergenic
1047220677 8:122916011-122916033 GCCATCTCTCACCCAAGTCCAGG + Intronic
1049663928 8:143834781-143834803 CCTCTCTCCCACTCCACTCCTGG - Exonic
1049887312 9:36306-36328 AGCCTCTCCCACCCAAGTGCTGG + Intergenic
1051342773 9:16127201-16127223 CCCCACTCCCTCCCACCTCCTGG + Intergenic
1051835766 9:21335502-21335524 ACCCTCGCCCTCCCGCCTCCCGG - Intergenic
1052166719 9:25339420-25339442 TCCCTCTCACACCCCAGTCCTGG - Intergenic
1053073418 9:35114501-35114523 ACCCTCTCCCAGCCAGCCCAGGG + Intronic
1053157277 9:35790512-35790534 ATACACTCCCACCCCACTCCAGG + Intergenic
1053284679 9:36842475-36842497 ACCCACTCCCTCCCAAAGCCAGG + Intronic
1054451175 9:65404276-65404298 TCCCCCTCCCACCCCACCCCAGG + Intergenic
1054903491 9:70393548-70393570 TCCCTGCCCCACCCAAGTCCAGG + Intronic
1054916949 9:70503492-70503514 GTCCTGTCCCCCCCAACTCCCGG + Intergenic
1055658226 9:78473739-78473761 TCCCTCTCCCACATAGCTCCTGG + Intergenic
1055765732 9:79661912-79661934 ACCCTCCTCCTCCCAACCCCTGG + Intronic
1058017241 9:100048164-100048186 CCCTCCACCCACCCAACTCCTGG - Intronic
1058053860 9:100430602-100430624 ACCCTCTTCCACACAACTACAGG - Intronic
1058840519 9:108903224-108903246 ACCCTCCCCCACCCCACGACAGG + Intronic
1058852584 9:109027186-109027208 CCCATCTCCCACCCTACTTCCGG - Intronic
1060362219 9:122970282-122970304 ACACTATCACACCCAACTCATGG - Intronic
1060445584 9:123684402-123684424 TCCCTCTCCCTCCTAACTCGAGG + Intronic
1061482344 9:130903302-130903324 CCCATCCCCCACCCAGCTCCCGG - Exonic
1061628500 9:131856537-131856559 CCCCCCCCCCACCCCACTCCGGG + Intergenic
1061727667 9:132590295-132590317 CCCCTCTCCCATCCCTCTCCTGG + Intergenic
1061796008 9:133086366-133086388 GCCCTTTGCCACCCCACTCCGGG + Intronic
1062026878 9:134344596-134344618 GCCCTCTCCTCCCCACCTCCCGG + Intronic
1062388348 9:136324136-136324158 ACTGTCTCCCTCCCCACTCCCGG + Intergenic
1185579400 X:1198469-1198491 ACACCCTCCCTCCCACCTCCCGG + Intronic
1186435571 X:9540191-9540213 ACCCTCTAGAACCCAAATCCTGG - Intronic
1186437742 X:9557516-9557538 TCCCTCTCCCATCCCTCTCCTGG - Intronic
1187035236 X:15531627-15531649 ATCCTCTCCTGCCCCACTCCAGG + Intronic
1187391725 X:18890651-18890673 ATCCTCCCCCACTCCACTCCAGG + Intergenic
1188854836 X:35181175-35181197 ATCCTCTCCCCCCCAGCTTCTGG + Intergenic
1189259902 X:39670851-39670873 CCTCTCTCCCACCTAACTCCTGG + Intergenic
1190618413 X:52262107-52262129 ACACTCTCCCAGCCAGCCCCTGG + Intergenic
1191840930 X:65513284-65513306 TCCCTCCCACACCCAACACCTGG + Intronic
1191971135 X:66817406-66817428 TCCCTCCCCCGCCCAACCCCAGG - Intergenic
1192464448 X:71344129-71344151 TCCCTCTTCCCCCCAACCCCTGG - Intergenic
1192547372 X:72025422-72025444 CACCTCACCCTCCCAACTCCAGG + Intergenic
1195798415 X:108679714-108679736 CCCCTCAGCCACCCAACTACAGG - Intronic
1196683814 X:118494904-118494926 GCCCACCCCCACCCCACTCCTGG + Intergenic
1196683832 X:118494975-118494997 GCCCACCCCCACCCCACTCCTGG + Intergenic
1197641835 X:128976001-128976023 ATCCTCACCCTCCCAACTCAAGG + Intergenic
1197767684 X:130069711-130069733 AAGGTCTCCCACCCAGCTCCCGG - Intronic
1199627058 X:149750579-149750601 AACCACCCCCACCCAAATCCAGG + Intergenic
1199629232 X:149764650-149764672 CCCCTCACCCACCCAACCCCTGG + Intergenic
1202379822 Y:24266833-24266855 GGGCTCTCCCACCCAACTCGCGG + Intergenic
1202490960 Y:25403288-25403310 GGGCTCTCCCACCCAACTCGCGG - Intergenic