ID: 901905639

View in Genome Browser
Species Human (GRCh38)
Location 1:12407162-12407184
Sequence CATTGTCCCAAGAGGGAAAT AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 224
Summary {0: 1, 1: 0, 2: 0, 3: 14, 4: 209}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
901905634_901905639 8 Left 901905634 1:12407131-12407153 CCAGAGAGGGAAATATCCCTGTA 0: 1
1: 0
2: 1
3: 19
4: 131
Right 901905639 1:12407162-12407184 CATTGTCCCAAGAGGGAAATAGG 0: 1
1: 0
2: 0
3: 14
4: 209
901905636_901905639 -9 Left 901905636 1:12407148-12407170 CCTGTAGTTTTAAACATTGTCCC 0: 1
1: 0
2: 0
3: 10
4: 147
Right 901905639 1:12407162-12407184 CATTGTCCCAAGAGGGAAATAGG 0: 1
1: 0
2: 0
3: 14
4: 209
901905635_901905639 -8 Left 901905635 1:12407147-12407169 CCCTGTAGTTTTAAACATTGTCC 0: 1
1: 0
2: 0
3: 15
4: 190
Right 901905639 1:12407162-12407184 CATTGTCCCAAGAGGGAAATAGG 0: 1
1: 0
2: 0
3: 14
4: 209

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
901905639 Original CRISPR CATTGTCCCAAGAGGGAAAT AGG Intronic
900006349 1:56317-56339 CATTGTTCTAAGTGGGAAACTGG - Intergenic
901905639 1:12407162-12407184 CATTGTCCCAAGAGGGAAATAGG + Intronic
902027338 1:13393899-13393921 CATTTTTCTAAAAGGGAAATTGG - Intergenic
902696912 1:18146325-18146347 CTTTGTACCAAGAGGGGGATGGG + Intronic
905510315 1:38514255-38514277 CATTTTACCAGGAGGGAACTTGG + Intergenic
905547016 1:38807945-38807967 CACAATCCCAAGAGGGAAGTAGG - Intergenic
909703559 1:78553743-78553765 CATTGGCCCAAGATGGACTTAGG - Intergenic
910747669 1:90591092-90591114 CTTTGTCCCAAGAGAGACTTTGG - Intergenic
913051494 1:115120396-115120418 CAGTGTCCCAAGATTGCAATGGG + Intergenic
918066156 1:181103178-181103200 CATTGGCCCAGCAGGTAAATGGG - Intergenic
918108049 1:181430002-181430024 CTGTGTCCCAAAAGGGAGATAGG - Intronic
918136684 1:181680293-181680315 CACTGTCACAAGAAGGACATAGG - Intronic
918387238 1:184021902-184021924 CATTGTCTCAAAAGAGACATGGG - Intronic
918992553 1:191716741-191716763 CATTTTCCCAAGATGGGAATAGG - Intergenic
920130935 1:203731333-203731355 CATTTTCCCAGGAGGGAAGATGG - Intronic
921305265 1:213790152-213790174 CAGTGTCCCAAGTGGATAATGGG + Intergenic
924052103 1:240089511-240089533 CATTTTCCCACAAAGGAAATTGG - Intronic
1065084381 10:22160138-22160160 CAAAGTCAAAAGAGGGAAATAGG - Intergenic
1068660585 10:59619470-59619492 CATTGTCCTAAGTGGGATATTGG - Intergenic
1068723534 10:60274416-60274438 CATTGTCCTGAAGGGGAAATGGG - Intronic
1069464044 10:68622265-68622287 CCTTGTCCAAAGAGGGAAGAGGG - Intronic
1070721632 10:78761081-78761103 GATTTTACCAAGAGGGGAATGGG - Intergenic
1071126001 10:82335488-82335510 CATTTTACAAATAGGGAAATTGG + Intronic
1072056715 10:91765570-91765592 CATTGTCCCAACTGGGGAAGGGG - Intergenic
1073002222 10:100294278-100294300 CATTCTCCAAGGATGGAAATGGG - Intronic
1075199158 10:120387770-120387792 CAATGTGCCAAGAGGGGCATGGG + Intergenic
1076568767 10:131417435-131417457 CATTGTCCTCAGAGGGGGATCGG + Intergenic
1077485538 11:2836844-2836866 CAGGGGCCCTAGAGGGAAATGGG + Intronic
1079123170 11:17699405-17699427 CATGGTTCCAAGAGGGATCTTGG - Intergenic
1079175368 11:18135384-18135406 GATTGGCCCAAAAAGGAAATGGG - Intronic
1079775518 11:24520943-24520965 CATTAGCTCCAGAGGGAAATAGG + Intronic
1080270702 11:30448160-30448182 CATTTTCCTAAGAGGGGAAAGGG + Intronic
1080771309 11:35344702-35344724 CATTGTCTGAAGAGGGAGGTTGG - Intronic
1082027503 11:47583705-47583727 AAGTAGCCCAAGAGGGAAATAGG - Intronic
1084377943 11:68791275-68791297 CAGTGTCCCCAAAGGGAAGTGGG - Intronic
1084815240 11:71641921-71641943 CTTGGTCCACAGAGGGAAATGGG + Intergenic
1088919728 11:114252146-114252168 CATGGTCCCCAGAGGGCACTAGG + Intergenic
1090504143 11:127292427-127292449 CAGTGGCGCAAGTGGGAAATTGG - Intergenic
1092057350 12:5519017-5519039 AGTTTTCCTAAGAGGGAAATAGG + Intronic
1092660194 12:10730589-10730611 AATTGTACCAAGAAGGAACTTGG + Intergenic
1093342979 12:18001355-18001377 AATTGTCCCAAGAGAAAATTAGG + Intergenic
1094166577 12:27449723-27449745 CAATGTACCAAGAGGGGAGTGGG - Intergenic
1097581353 12:61460697-61460719 CATATTACCAAGAGGGAAACCGG + Intergenic
1099456740 12:82872194-82872216 CTCTGTCCCAGAAGGGAAATGGG + Intronic
1104019094 12:124980036-124980058 CATTGTACCAGGAAGGAAACAGG + Intronic
1104733767 12:131123450-131123472 CAATGTCCCAAGAGGGCATGAGG - Intronic
1106130488 13:26935428-26935450 CATGTTCTCAAGATGGAAATAGG + Intergenic
1106259867 13:28056951-28056973 CATTTTACCAATAAGGAAATCGG + Intronic
1106925250 13:34606733-34606755 AATTGACCCAAGAGGGAAGGAGG + Intergenic
1107076255 13:36324145-36324167 CATTCTTCCCAGAGGGAAGTGGG + Intronic
1107181872 13:37471150-37471172 CACTGTCCCAGGAGGGAAACTGG + Intergenic
1107397356 13:40031667-40031689 TATTGTCTCATGAGGCAAATGGG + Intergenic
1107491088 13:40880358-40880380 CATTGTCTCGAGAGAAAAATGGG - Intergenic
1107728740 13:43327016-43327038 CATTGTCCCAATTTGGAACTTGG - Intronic
1111581458 13:90228901-90228923 CAATTTACCAAGAAGGAAATGGG - Intergenic
1115121351 14:29941614-29941636 CAGAGGCCTAAGAGGGAAATAGG + Intronic
1115183551 14:30657297-30657319 CATTGTCAGAAGAGGAAATTGGG + Intronic
1115645027 14:35363298-35363320 CATTGTCTCGAAAAGGAAATTGG - Intergenic
1115999907 14:39231968-39231990 TATTTTCCCAAGAATGAAATAGG + Intronic
1117185498 14:53235997-53236019 CTTTGTCCTAAGAATGAAATAGG + Intergenic
1117273497 14:54169031-54169053 CATTTTCCCAAGAGGAAAAGAGG + Intergenic
1117285654 14:54283334-54283356 CATTGTCCAAAGACAGAAAAGGG + Intergenic
1119705656 14:76781234-76781256 CATTGACCCCAGGGGGAACTTGG - Exonic
1120526732 14:85585098-85585120 CATTTTACAAAGAGGGAAACTGG - Intronic
1120994856 14:90409360-90409382 CATTCTCCCAGGACGGAAATAGG + Intergenic
1121928774 14:97953038-97953060 CATGGTCCCTTGAGGGAAACAGG - Intronic
1122133768 14:99620820-99620842 GGGTGTCCCCAGAGGGAAATGGG - Intergenic
1122191171 14:100044879-100044901 CACTGTCCCCAGTGGGAAAGTGG - Intronic
1123874488 15:24609892-24609914 GTTTGTCTCAAGAGGGAAAAGGG + Intergenic
1126233755 15:46357791-46357813 CAATGTCCCAAGAGTGAACCAGG + Intergenic
1126771914 15:52066269-52066291 CATTAACCCAAGAGTGAAACAGG - Exonic
1127127192 15:55823148-55823170 CAATGTCCCCAGATGGAGATAGG + Intergenic
1127498163 15:59531782-59531804 CATTTGCCCAAGAGGGAACTAGG - Intergenic
1128202284 15:65819454-65819476 CTTTTTCCCAAGTGGGGAATAGG - Intronic
1130179442 15:81610216-81610238 CATGTTTCCAAGAGGGAATTTGG - Intergenic
1131760425 15:95616736-95616758 CATTCTCCCCACAGGGTAATAGG - Intergenic
1132447172 15:101934641-101934663 CATTGTTCTAAGTGGGAAACTGG + Intergenic
1134356903 16:13490664-13490686 CATTGCACCAAGAAGAAAATTGG - Intergenic
1134892529 16:17853785-17853807 CACTGGCCCAAGTGGGAAATAGG - Intergenic
1135135127 16:19881803-19881825 CATTTTCGCAACAGGAAAATGGG - Intronic
1135889493 16:26344501-26344523 CATTATCCCAGGAGTCAAATTGG - Intergenic
1138625668 16:58249627-58249649 CATTCTCCCAATAAGGAAACTGG - Intronic
1140792944 16:78409843-78409865 GATTGTGGCTAGAGGGAAATGGG - Intronic
1143316849 17:6039358-6039380 CAGTGTCTCAAGAGACAAATAGG - Intronic
1143508156 17:7380960-7380982 CCTTGTCCCACTAGGGAACTCGG + Exonic
1143607757 17:7999488-7999510 CATGGACCCTAGAGGAAAATTGG + Intergenic
1144052008 17:11504896-11504918 CTGTGTCCCAAGAGGCAACTGGG + Intronic
1144182028 17:12761491-12761513 CATTGTAGCAAGAGGGAAGAAGG + Intronic
1144332528 17:14237174-14237196 CAAGGCCCCAAGAGGGACATAGG - Intergenic
1145161680 17:20579381-20579403 CAAGGCCCCAAGAGGGACATAGG + Intergenic
1146537753 17:33667810-33667832 GATGGTCCCAAGGGGAAAATGGG + Intronic
1150548562 17:66188355-66188377 CATTGTGGCAAGAGGGAAGTGGG - Intronic
1151378594 17:73708977-73708999 CATTTTCTCCAGAGGGAAGTTGG - Intergenic
1155235743 18:23817013-23817035 CTGGGTCCCAAGAGGGAAACAGG - Intronic
1155857945 18:30858262-30858284 CATTGTACAAAGAGAGAAAAAGG - Intergenic
1156037259 18:32778930-32778952 CAATGTCCCCAGCGGGAAAAGGG - Intergenic
1157302230 18:46487329-46487351 GGTTGTACCAAGAGGGAAAGGGG + Intronic
1160638104 19:97892-97914 CATTGTTCTAAGTGGGAAACTGG - Intergenic
1162241994 19:9362731-9362753 AAATGTCCCCAGAGGAAAATTGG - Intronic
1162282620 19:9711461-9711483 CAATGTCCCAAGTGAGAAAGAGG + Intergenic
1165585508 19:36911773-36911795 TCTAGTCCAAAGAGGGAAATAGG - Intronic
925838263 2:7966411-7966433 AATTGTCCCAAAAGGGAAGGAGG + Intergenic
925839265 2:7975898-7975920 CATTTTCCAAAGAGTGACATGGG + Intergenic
927077264 2:19591155-19591177 CACTCTCCCAACAGGGCAATTGG + Intergenic
928112828 2:28524446-28524468 CATTTTACCAAGGGGGAAATCGG + Intronic
930217801 2:48714875-48714897 CATTTTGCAAAGAAGGAAATAGG + Intronic
931229130 2:60359230-60359252 CATTATTCCAAGAGAGAAAAAGG + Intergenic
932816492 2:74866119-74866141 TAGGGTCCCAAGAGGGAAAACGG - Intronic
933665935 2:84964959-84964981 CATGGTCACAAGAGAGGAATGGG + Intergenic
933878342 2:86643035-86643057 CACTGTCAGAAGAGGGAAAAAGG - Intronic
937548441 2:123055004-123055026 CACTGTTACAAGAGAGAAATAGG - Intergenic
937606879 2:123811218-123811240 CATTCTCCCAAGACTGAAACAGG + Intergenic
939256946 2:139756857-139756879 CATCTTCACAAGAGGAAAATAGG - Intergenic
943374249 2:187055317-187055339 CTTTGTCCCCAGAGGGGATTTGG + Intergenic
946089004 2:217203962-217203984 AGTTGTCTTAAGAGGGAAATAGG + Intergenic
946496257 2:220199013-220199035 TGTTTTCCCAAGAGAGAAATTGG + Intergenic
947947697 2:234120644-234120666 GGTTGTCCCAAGAGAGCAATAGG + Intergenic
1172826281 20:37789582-37789604 CATTGTCCCTGGAGGGAGACTGG + Intronic
1173906162 20:46631366-46631388 GGTTGTCCCAAGAAGGAAAGTGG + Intronic
1174708480 20:52681193-52681215 GATTGTCCTCAGATGGAAATGGG + Intergenic
1179300683 21:40106683-40106705 CACTCTCCCAAGACTGAAATAGG - Intronic
1183236616 22:36623491-36623513 CATTTTCCAGAGAGGGAAACTGG - Intronic
949329753 3:2908584-2908606 CATTATCTCAAGGTGGAAATGGG - Intronic
951441272 3:22726688-22726710 CATTTTCCAAAGAGAGCAATAGG - Intergenic
953465221 3:43113994-43114016 CCTTTTCCCAAGAGGGAGGTGGG + Intergenic
954586249 3:51739321-51739343 CATGGTCAAAAGAAGGAAATTGG + Intergenic
954831301 3:53423521-53423543 CATTGTACAGAGAGGGAAAAAGG - Intergenic
955205036 3:56888189-56888211 CATTGGTCCAAGTGGGACATTGG + Intronic
957072467 3:75577815-75577837 CTTGGTCCACAGAGGGAAATGGG - Intergenic
957857251 3:85894647-85894669 CATTGTCCTAGAAGGGAAATAGG + Intronic
960677052 3:120205451-120205473 CATTTTCTCAATAGGGAAAACGG - Intronic
962684260 3:137831431-137831453 CATGGTTCCAAGAAGGAAAGAGG + Intergenic
964888126 3:161508231-161508253 TATTTTTCCAAGATGGAAATAGG - Intergenic
964919429 3:161878349-161878371 CAATATCCCAAGAGTGAATTGGG + Intergenic
965487662 3:169298126-169298148 GATTTTTCCAAGAAGGAAATTGG - Intronic
965969724 3:174539946-174539968 CATTTTGCCAAGAGAGAATTAGG + Intronic
969393938 4:6908942-6908964 CATTGTACAAAGCGGGAAACGGG - Intergenic
969737891 4:9003219-9003241 CTTGGTCCACAGAGGGAAATGGG + Intergenic
970822881 4:20239433-20239455 CATTGTACCAGGAGGGAAGAGGG + Intergenic
971877381 4:32323957-32323979 CATTGTCCCATGATGGAACCAGG - Intergenic
972025856 4:34376205-34376227 CATGGTTCAAAGTGGGAAATAGG + Intergenic
972280588 4:37598578-37598600 CATTTTCCCATGTGTGAAATGGG - Intronic
973021581 4:45209325-45209347 CATGGTTCCAAGAGGGAGAATGG - Intergenic
974084501 4:57244868-57244890 AATTGTTCAAAGAGGGAATTGGG - Intergenic
974205879 4:58702816-58702838 CATTGTCACAAGAGCAGAATGGG + Intergenic
975552584 4:75628718-75628740 CACTGTTCCAATAGAGAAATAGG - Intronic
976379421 4:84382351-84382373 CATTGTGCCAACAAGGGAATGGG - Intergenic
976904310 4:90217527-90217549 TATTGTCCCAAAAGAGAGATAGG + Intronic
978115091 4:105009781-105009803 CATTGTCCCAAGACTGAACTTGG - Intergenic
978171844 4:105681042-105681064 CTTTGACCCCAAAGGGAAATTGG + Intronic
978772574 4:112472649-112472671 CAATGGTCCAAGAGGAAAATGGG - Intergenic
980686056 4:136230081-136230103 CATGGGCCTAAGAGGAAAATTGG - Intergenic
981311726 4:143304179-143304201 CATGGTCCCAAGATGGCGATGGG + Intergenic
982706766 4:158718706-158718728 CGTTGTCCCAAGATGTAATTGGG - Intronic
983695014 4:170517713-170517735 CATTGTGCCAGGAGGGGAAAAGG + Intergenic
983974051 4:173910738-173910760 TATTGTCCTAAGAAGGAAAAGGG - Intergenic
986964579 5:13254919-13254941 CATTTTCCCAAGAAGGCTATGGG + Intergenic
994219229 5:97175515-97175537 CATTTTCCCAAAAGGGTAGTAGG - Intronic
995116002 5:108479998-108480020 CATTTTACCAAGAATGAAATAGG - Intergenic
996697860 5:126418842-126418864 CAGTGTCCAAAGAAGAAAATAGG - Intronic
997165705 5:131658701-131658723 CATTCTCCTTAGAGAGAAATGGG + Intronic
997504473 5:134405737-134405759 TTTTATCCCAAGAGGGAAAATGG - Intronic
998761120 5:145433431-145433453 CATTGTGTCAATAGGGAAACTGG + Intergenic
999246511 5:150157841-150157863 CTTTGTGGCAACAGGGAAATAGG + Intergenic
999737849 5:154526218-154526240 CATTCTACCAATGGGGAAATGGG - Intergenic
1000286810 5:159833931-159833953 CCTTGCCTCAGGAGGGAAATGGG + Intergenic
1001994746 5:176147547-176147569 CAGAGTCCCAAGAAGGAACTCGG - Intergenic
1002287959 5:178177840-178177862 CATTGTGCCAGGAGGCAAAAGGG + Intergenic
1003575274 6:7287470-7287492 CATTGTCCCAGGAGAGGAAAAGG - Exonic
1003637893 6:7850583-7850605 AATTGTCCCAGGAGAGAAAAGGG + Intronic
1004060585 6:12193251-12193273 CACTGTCCAAAATGGGAAATAGG - Intergenic
1004169371 6:13283964-13283986 CATAACCCCAGGAGGGAAATAGG + Intronic
1004190075 6:13456037-13456059 CATCATCCCAAGAAGGACATGGG + Intronic
1004528590 6:16432277-16432299 CATCATCCCAAGAGGTAAAAAGG + Intronic
1004817310 6:19325975-19325997 TATTTTCCCATGAGGAAAATAGG + Intergenic
1005789847 6:29287420-29287442 CACTGTCCCAGGTGAGAAATGGG + Intergenic
1007269855 6:40628235-40628257 CAGAGTCACAAGAGGGAAACCGG + Intergenic
1008318935 6:50082786-50082808 ACTTGTCCCAAGAGGGATATCGG - Intergenic
1008516883 6:52326926-52326948 CAATATCCAAAGAGGGAAAGTGG + Intergenic
1014095060 6:117450841-117450863 CATTTCCCCAGGAGGGAAAAAGG - Intronic
1017998206 6:159553428-159553450 CATTGTCCCACTTGGAAAATGGG - Intergenic
1018747615 6:166774638-166774660 AATTGTACAAACAGGGAAATTGG - Intronic
1019103177 6:169648660-169648682 CATTGTCCGAGGAGAGATATGGG - Intronic
1019791159 7:3014766-3014788 CATTGCCGCAAGCGGGAAAATGG + Intronic
1019966791 7:4506055-4506077 CATTTTCCAAAGAAGGAACTGGG + Intergenic
1021177875 7:17471083-17471105 CATTGTCCTAACAGAGAAACAGG - Intergenic
1022261087 7:28705594-28705616 CATTTTCCCCAGAGGGACTTGGG - Intronic
1023327382 7:39074940-39074962 CATTTTCCCGAGAGGAAAATGGG - Intronic
1027939321 7:84653520-84653542 CATAAGCTCAAGAGGGAAATGGG + Intergenic
1028158129 7:87455741-87455763 CATGGTCCTAGGAGAGAAATTGG + Intronic
1029025401 7:97411964-97411986 CAATATTCCAAGAGGGAAGTGGG + Intergenic
1030929575 7:115505239-115505261 TATTGGTCAAAGAGGGAAATAGG + Intergenic
1032110213 7:129069460-129069482 CATTGGAGGAAGAGGGAAATTGG - Intergenic
1032958859 7:137006357-137006379 CAGTGTCATAAGGGGGAAATGGG - Intronic
1043083982 8:75804095-75804117 CATTTTACAAATAGGGAAATTGG - Intergenic
1043165025 8:76892988-76893010 CATTGTCCCAGGAGTGCAAAGGG - Intergenic
1044461890 8:92455158-92455180 CACTGTCCCAGGAGGGACACTGG + Intergenic
1044581326 8:93829142-93829164 CATTGCCCTAGGAGGAAAATAGG + Intergenic
1044779113 8:95724872-95724894 CACTGAACCAAGAGGGAATTTGG - Intergenic
1046096628 8:109570377-109570399 CACTGACCCAAAATGGAAATGGG + Intergenic
1047570239 8:126089875-126089897 CTATGTTCCAAGAGGAAAATTGG - Intergenic
1048988791 8:139749420-139749442 CATTGTCACATGAGAGCAATGGG + Intronic
1048996697 8:139799019-139799041 CATTTTTCTAAGAGGGAGATGGG - Intronic
1050122682 9:2323957-2323979 AAATGTCCCAACAGAGAAATGGG - Intergenic
1050526874 9:6553829-6553851 CACTTTCCCAAGATGGACATAGG + Intronic
1056197636 9:84243931-84243953 CATTTTACAAAGAGGGAACTGGG - Intergenic
1056868163 9:90249892-90249914 CAATGTCACAAGAAGGCAATAGG + Intergenic
1059099621 9:111457488-111457510 CATTGTAACAGGAGGGAAACAGG + Intronic
1062554988 9:137109841-137109863 CACTGTCCCCAGAGGGACACAGG - Intergenic
1185743249 X:2550853-2550875 TATTCTCCCTGGAGGGAAATGGG + Intergenic
1187207043 X:17192559-17192581 CAGTGTCCCATGAGGTGAATGGG + Intergenic
1189331809 X:40148770-40148792 CATTGGCAAAGGAGGGAAATGGG + Intronic
1189602172 X:42638939-42638961 CATTTTTCCAACAAGGAAATTGG + Intergenic
1189704013 X:43742011-43742033 CATGATCCCAGGAGGGAAGTAGG - Exonic
1192152313 X:68719887-68719909 CATTGTCCCAGAGGAGAAATGGG - Intronic
1195405986 X:104513912-104513934 CAGTGACCCAAAAGGGAAATAGG - Intergenic
1195474147 X:105264837-105264859 CATTGTCTCTAGAGGGATGTTGG + Intronic
1196372908 X:114998825-114998847 CTTTGTCCCAAGGGGGACTTTGG - Intergenic
1196388133 X:115181179-115181201 CAGTGTAACTAGAGGGAAATGGG + Intronic
1198333374 X:135642942-135642964 CATTATGCCAAGAGGTAAAAAGG - Intergenic
1198361923 X:135903876-135903898 CATTATGCCAAGAGGTAAAAAGG + Intronic
1198427162 X:136531750-136531772 CATTGGCCAAAGAGGGAGAAAGG - Intergenic
1201078845 Y:10213835-10213857 CATTGAGCCAAGGGTGAAATAGG - Intergenic
1201265314 Y:12200908-12200930 CTTTGTCCTAAGTTGGAAATAGG - Intergenic