ID: 901906759

View in Genome Browser
Species Human (GRCh38)
Location 1:12419127-12419149
Sequence ATATAGATCCAGGATGAGGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 158
Summary {0: 1, 1: 0, 2: 0, 3: 12, 4: 145}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
901906759_901906767 -10 Left 901906759 1:12419127-12419149 CCACCCTCATCCTGGATCTATAT 0: 1
1: 0
2: 0
3: 12
4: 145
Right 901906767 1:12419140-12419162 GGATCTATATGAAGGCCTGGGGG 0: 1
1: 0
2: 0
3: 7
4: 103
901906759_901906769 13 Left 901906759 1:12419127-12419149 CCACCCTCATCCTGGATCTATAT 0: 1
1: 0
2: 0
3: 12
4: 145
Right 901906769 1:12419163-12419185 CAGTGATAATACATTTGATTTGG 0: 1
1: 0
2: 0
3: 14
4: 218

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
901906759 Original CRISPR ATATAGATCCAGGATGAGGG TGG (reversed) Intronic
901906759 1:12419127-12419149 ATATAGATCCAGGATGAGGGTGG - Intronic
903315598 1:22502461-22502483 ATATGAATTCAGGAGGAGGGAGG - Intronic
903467584 1:23562727-23562749 ATATAGATAAAGGAAGAAGGTGG - Intergenic
905012312 1:34755666-34755688 GTGTGGATCCTGGATGAGGGTGG - Intronic
907336859 1:53705337-53705359 ATTTAGATGCAGAGTGAGGGAGG - Intronic
909914040 1:81295499-81295521 ATATTGCTCCAGGATGGGGCAGG - Intergenic
910922978 1:92369593-92369615 AAATAAATCCAGGATGGGAGTGG - Intronic
912139392 1:106703514-106703536 ACATACATCAAGGAAGAGGGAGG - Intergenic
912484588 1:110015419-110015441 CTATAGATCCTGGATGATGGGGG + Exonic
912696664 1:111847305-111847327 ATATTGATTGAGGAGGAGGGAGG + Intronic
915057357 1:153146465-153146487 ATATAGAGCAAGGATGAAAGCGG + Intergenic
915473749 1:156140503-156140525 ATATAGACCCAGTCTGAGGGTGG + Intergenic
916144982 1:161730361-161730383 ATTTAGAACTAGGATGCGGGGGG + Intergenic
919417152 1:197325209-197325231 ATTTAGTTCCAGGATTGGGGTGG - Intronic
919524257 1:198627580-198627602 TCATAGCACCAGGATGAGGGAGG - Intergenic
923309060 1:232717578-232717600 ATCTAGACCCATGATGATGGAGG - Intergenic
1063153429 10:3356617-3356639 ATATGGAGCCAGGATGCTGGGGG + Intergenic
1066569941 10:36760472-36760494 AAATAGATGCAGGCTGAGGGAGG - Intergenic
1066747557 10:38616183-38616205 ATAAAAATCCAGGAGGCGGGGGG + Intergenic
1067795247 10:49316527-49316549 ATATAAACCCAGGATCAGGTAGG + Intronic
1070727083 10:78799831-78799853 ACGAACATCCAGGATGAGGGGGG + Intergenic
1072026548 10:91465221-91465243 ATATAAATATGGGATGAGGGAGG + Intronic
1072145748 10:92635022-92635044 ATATAAATCAAGTATGAAGGAGG - Intronic
1077481375 11:2816235-2816257 ATAAAGATTCAGGTTGTGGGAGG + Intronic
1077712937 11:4554155-4554177 ATATGGGTACAGGATTAGGGGGG - Intergenic
1079214456 11:18495810-18495832 ACATAGATCAAGGCTGAGGCAGG + Intronic
1080610948 11:33903147-33903169 TTAAAGATCCAGGGAGAGGGAGG + Intergenic
1081826978 11:46064430-46064452 AGATAGAGCTAGGATGAGAGAGG + Intronic
1082286295 11:50321559-50321581 AAATAGATTCAGGCTGAGCGTGG + Intergenic
1088417098 11:109601166-109601188 ATATAGAGGAATGATGAGGGAGG - Intergenic
1088827276 11:113506641-113506663 GTAAAGATCCCGGATGAAGGAGG + Intergenic
1088908310 11:114171362-114171384 ATAGAGATTCTGGATGGGGGTGG - Intronic
1089639164 11:119835832-119835854 AGATAGATCCAGGATCCAGGAGG - Intergenic
1096196432 12:49651788-49651810 ATATAAAATCAGGGTGAGGGAGG - Intronic
1096730088 12:53602756-53602778 ACACAGCCCCAGGATGAGGGGGG + Intronic
1096985073 12:55750782-55750804 ATATAGATCCTGGATGTTGAGGG - Exonic
1098678038 12:73315806-73315828 ATCTATGTCCAGGATGAGTGGGG + Intergenic
1099494987 12:83335742-83335764 TTATAGACACAGGATGGGGGTGG + Intergenic
1100555425 12:95688443-95688465 AGATAGATCCATGCTGAGGGTGG + Intronic
1102415396 12:112758027-112758049 ATACAGCACCAGCATGAGGGTGG - Intronic
1105287619 13:19018722-19018744 GTATAGATCCAGGAAGGTGGAGG - Intergenic
1106841948 13:33693145-33693167 ATATAGACACAGGATGGTGGTGG + Intergenic
1108157895 13:47605414-47605436 ATAAATATCCAGGAACAGGGAGG + Intergenic
1109958642 13:69602782-69602804 ATATGGGTACAGGATGCGGGGGG - Intergenic
1110371028 13:74740433-74740455 ATAAAGACCAAGGATGAGAGAGG - Intergenic
1111182580 13:84687800-84687822 TTATAGACACAGGATGAGGTGGG + Intergenic
1114398873 14:22391313-22391335 ATATAGATCCATGATCTGGGAGG + Intergenic
1117398816 14:55339383-55339405 GCATAGATCCAGGATTGGGGGGG - Intronic
1118983171 14:70732384-70732406 ATACAGATCTGGGATCAGGGAGG - Intronic
1119132526 14:72187582-72187604 ATATCAATCCAGCATGAAGGAGG + Intronic
1124336225 15:28859127-28859149 ATATAGCCCCAGGCTGAGGTGGG - Intergenic
1133940840 16:10307802-10307824 ATATAGCTTCAGGATGGGGTTGG - Intergenic
1133982600 16:10644576-10644598 AAATAGATCCAGGAAGAAAGGGG - Intronic
1134556933 16:15173516-15173538 AGATAGATTCAGGATGGGGCTGG - Intergenic
1134917512 16:18085234-18085256 AGATAGATTCAGGATGGGGCTGG - Intergenic
1137482439 16:48863839-48863861 ATAAAGATCAAGGAGGAGGCCGG - Intergenic
1141087317 16:81105520-81105542 AGATAGCTTCAGGATGAGGCAGG + Intergenic
1143201882 17:5118865-5118887 TTATAGGCACAGGATGAGGGTGG + Intronic
1143499042 17:7328339-7328361 AGAAAGATCCAGGGTGAGGGAGG - Intronic
1146723870 17:35142064-35142086 GTGCAGTTCCAGGATGAGGGCGG - Exonic
1149714246 17:58772166-58772188 ATATAGATGCAGGCTGGGCGCGG + Intronic
1151862007 17:76771163-76771185 ATAGAGCTTCAGGATGAGGCTGG - Intronic
1156744840 18:40377341-40377363 AAATATATCCAGTTTGAGGGAGG - Intergenic
1156905573 18:42348495-42348517 TTATAGACACAGGATGGGGGTGG - Intergenic
1157871195 18:51231544-51231566 ATATAGATCAAGTAAGAAGGTGG + Intergenic
1159755420 18:72358232-72358254 AGATGGTTCCAGGATGATGGAGG - Intergenic
1161041877 19:2114717-2114739 ATATGGGTTCAGGGTGAGGGTGG - Intronic
1165998731 19:39864514-39864536 AACTAGAACCAGGCTGAGGGAGG - Intronic
1168102796 19:54149843-54149865 AGAGAGATCCAGAAAGAGGGTGG - Intronic
928333826 2:30378322-30378344 ATTAGGATCCATGATGAGGGTGG - Intergenic
931023762 2:58083748-58083770 ATATAGATCCAAAATGTGGGGGG - Intronic
931373747 2:61688869-61688891 ATAATGCTCCAGGAGGAGGGTGG + Intergenic
932529561 2:72514067-72514089 ATATACACCCTAGATGAGGGTGG + Intronic
933548395 2:83742740-83742762 ATATAGATACAGGGAGAGTGAGG + Intergenic
940173159 2:150850167-150850189 TTATAGGCCCAGGATGGGGGTGG + Intergenic
941112569 2:161431708-161431730 ATAAAGATTCAGGTTCAGGGTGG - Intronic
942960722 2:181827571-181827593 ATATAGATCCAGGTTTATGGCGG + Intergenic
943299369 2:186178675-186178697 ATATAGTTGCAGATTGAGGGTGG - Intergenic
943642141 2:190371324-190371346 ATACAGATCCAGGAAGCGGCTGG + Exonic
944978992 2:205092313-205092335 AAACAGCTCCAGGATGAGAGTGG + Intronic
947322902 2:228942277-228942299 AGAAAGATCCAGGTTGCGGGGGG + Intronic
1168891264 20:1296563-1296585 AAATAGTTCCAGGAGGAGGCAGG - Intronic
1169320679 20:4631002-4631024 ATATAAAGACAAGATGAGGGAGG - Intergenic
1169781109 20:9311658-9311680 AAACAGCTCCAGGATGAGGAGGG - Intronic
1171351184 20:24504509-24504531 ACCTAGAGCCAGGGTGAGGGTGG - Intronic
1173172155 20:40736154-40736176 ATATAGATACAGGTTGGGGTTGG + Intergenic
1174273846 20:49389145-49389167 AGCTAGATCCAGGGGGAGGGAGG + Intronic
1177089155 21:16744394-16744416 ATATATATTCAGGATGAGGAAGG - Intergenic
1178049339 21:28731074-28731096 AAATAAATCCTGAATGAGGGAGG + Intergenic
1179414435 21:41186861-41186883 AGATACTTCTAGGATGAGGGTGG + Intronic
1179803881 21:43825354-43825376 ATAAACATCCAGGAGGAGGAGGG - Intergenic
1184669332 22:46004547-46004569 AAATAGATCCAGATAGAGGGAGG - Intergenic
953026609 3:39148721-39148743 ATATAGATGGAGGAAGAGAGAGG - Intronic
958051190 3:88349000-88349022 AAATAGAGCCTGGATTAGGGTGG - Intergenic
959132953 3:102380660-102380682 CTATGAATCCAGGATGAGGATGG - Intronic
960522702 3:118674027-118674049 ATTTAAATCCAGGATTAGAGAGG + Intergenic
961402338 3:126656115-126656137 ACACATGTCCAGGATGAGGGGGG + Intergenic
962071399 3:132036969-132036991 AAATAAATCCAGGGTGTGGGCGG + Intronic
966194497 3:177299601-177299623 ATAAAGATCCAGGCTGGGTGCGG + Intergenic
966240710 3:177752770-177752792 ATATAGAACCAGGTAAAGGGTGG - Intergenic
967070923 3:185961638-185961660 ATATGGATACAGGATAGGGGTGG + Intergenic
971023596 4:22565636-22565658 AGATAGCTCCAGGATGGTGGCGG + Intergenic
971112998 4:23609993-23610015 AGATAGATACATGCTGAGGGAGG - Intergenic
971636811 4:29071668-29071690 ATAAATATCCAGGTTGAGGAAGG - Intergenic
972327752 4:38033718-38033740 AAAAAGATCAAGGATTAGGGAGG - Intronic
973543700 4:51959479-51959501 ATAATGACCCAGGATGAGAGTGG - Intergenic
981423759 4:144580865-144580887 TTATAGGTCCGGGATGCGGGGGG - Intergenic
983850109 4:172569956-172569978 ATATAGTACCAGGAGGAAGGAGG + Intronic
985401801 4:189600547-189600569 AAATAGTTTCAGGAGGAGGGGGG + Intergenic
986778683 5:11044715-11044737 ATACAGATCCAGGAGCAGAGTGG + Intronic
988197613 5:28025370-28025392 ATATAAATTCAGGATGAAGGAGG + Intergenic
995599461 5:113779945-113779967 ACATAGCTTCAGGATGAGGTTGG + Intergenic
996561943 5:124840291-124840313 ATATAGGTCCAAGATGAGTAAGG - Intergenic
998179842 5:139928987-139929009 ATAGAGAACCAGGATAAAGGGGG - Intronic
1000771865 5:165364587-165364609 AGATAGCTTCAGGATGAGGATGG - Intergenic
1000972591 5:167730581-167730603 ATTTAGTTCCAGGATGACGGGGG - Intronic
1003485682 6:6576450-6576472 ATATTAATCCAGGAGGAGGTGGG + Intergenic
1005685275 6:28247955-28247977 ATGTAGATCTAGGATAGGGGTGG + Intronic
1006674122 6:35749863-35749885 ACAGAGACCCAGGTTGAGGGAGG + Intergenic
1006832975 6:36979951-36979973 AGAAAGACCCAGAATGAGGGAGG - Intronic
1008156545 6:48022142-48022164 AGATAGAACAAGGAAGAGGGAGG - Intronic
1008157501 6:48034532-48034554 TTATAGAACAAGGCTGAGGGTGG + Intronic
1008702135 6:54113987-54114009 ATATAAATCCAGGAACAGTGAGG - Intronic
1008737946 6:54569976-54569998 AAATAGATGCAGAATGAGTGAGG - Intergenic
1010036342 6:71329747-71329769 AAATAGATACAGGAATAGGGTGG - Intergenic
1012270044 6:97197905-97197927 ATAGAGATGCAGGGTGGGGGAGG - Intronic
1012593992 6:101019467-101019489 GAATAAACCCAGGATGAGGGTGG - Intergenic
1016671048 6:146708723-146708745 ATATATATCCAGGTAGAGGAAGG - Intronic
1017020398 6:150135502-150135524 ATATAGATCCAATCTGGGGGTGG - Intergenic
1018654802 6:166024962-166024984 TTATAGACACAGGATGGGGGTGG + Intergenic
1021626575 7:22599301-22599323 ATATAGATCAGGGCTGAGGTGGG - Intronic
1022940841 7:35237569-35237591 ATATAGAGAGAGGAAGAGGGAGG + Intronic
1025813963 7:64892699-64892721 TTATAGATGCCTGATGAGGGGGG + Intronic
1027777350 7:82483347-82483369 ATATACATCCAGGCTGGGCGTGG - Intergenic
1029577367 7:101412303-101412325 GTAAACTTCCAGGATGAGGGTGG - Intronic
1030696122 7:112587709-112587731 ACATAGCCCCAGGAAGAGGGCGG + Intergenic
1030851990 7:114499323-114499345 ATATAGATCCATTATAATGGTGG - Intronic
1033881340 7:145887356-145887378 ATATGGGTACAGGATGGGGGAGG + Intergenic
1036490007 8:9216155-9216177 ATGTGGATCCAGGATAAGGCAGG - Intergenic
1037549701 8:19958339-19958361 AAATAGAACCATGATGATGGAGG - Intronic
1037736563 8:21571661-21571683 ACATGGCTCCAGGATGAGGCTGG + Intergenic
1038330597 8:26605173-26605195 ATATTGCTCCCTGATGAGGGAGG + Intronic
1039191499 8:34981304-34981326 ATATATATCTAGCATGAGGCTGG - Intergenic
1039586197 8:38709142-38709164 ATAATGAGCCAGGAGGAGGGTGG - Intergenic
1039842189 8:41302088-41302110 CTATAGATACAGATTGAGGGTGG - Intronic
1040615735 8:49036518-49036540 ATAAAAATCCTGGATGAGGCCGG + Intergenic
1044871883 8:96627838-96627860 ATATAGATGCTGGAAGAGTGAGG - Intergenic
1048260107 8:132938040-132938062 AGACAGAGCCAGGAAGAGGGAGG - Intronic
1049678615 8:143904972-143904994 AGAAATTTCCAGGATGAGGGTGG - Intergenic
1052696163 9:31881748-31881770 AAATAGAGCCAGGAGGAAGGGGG - Intergenic
1055096736 9:72421860-72421882 TTATAGATGAAGGATGAGAGTGG + Intergenic
1057530590 9:95842220-95842242 AAAGAGCTCCAGGATGAGGGGGG - Intergenic
1058445691 9:105052903-105052925 ACATAGATCCAGGATCAACGTGG - Intergenic
1061216490 9:129224786-129224808 GTACAGACCCAGAATGAGGGGGG - Intergenic
1193492307 X:82165186-82165208 ATATAGAAGCAAAATGAGGGAGG + Intergenic
1195263155 X:103153747-103153769 ATATACAGACAGGATGTGGGAGG + Intergenic
1200129536 X:153833483-153833505 AGATAGAGACAGGGTGAGGGCGG + Intergenic
1201478842 Y:14414943-14414965 ATCTAAATCCTGGTTGAGGGAGG + Intergenic