ID: 901909915

View in Genome Browser
Species Human (GRCh38)
Location 1:12448374-12448396
Sequence AAACAGGAGCTCTCATGGGG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 181
Summary {0: 1, 1: 0, 2: 0, 3: 15, 4: 165}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
901909910_901909915 -7 Left 901909910 1:12448358-12448380 CCTTGTTAGAATGGCAAAACAGG 0: 1
1: 0
2: 2
3: 19
4: 154
Right 901909915 1:12448374-12448396 AAACAGGAGCTCTCATGGGGTGG 0: 1
1: 0
2: 0
3: 15
4: 165

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
901909915 Original CRISPR AAACAGGAGCTCTCATGGGG TGG Intronic
901909915 1:12448374-12448396 AAACAGGAGCTCTCATGGGGTGG + Intronic
905020543 1:34808049-34808071 ACACAGCAGCTCTCAAGGGCTGG + Intronic
907269570 1:53282932-53282954 AAACAGAACCTCTCAAGGGAGGG + Intronic
907916269 1:58872731-58872753 ATACTGGAGCTCCCATGGAGAGG - Intergenic
908549279 1:65192961-65192983 ACTCAGCAGCTCTCATGGGTTGG + Intronic
908740330 1:67320894-67320916 AACCAGGGCCTGTCATGGGGTGG - Intronic
911987384 1:104645146-104645168 AAGAAAGAGCTCTCATGGTGAGG + Intergenic
912326194 1:108765321-108765343 AAACAGGAGCCTCCATGGGTAGG + Intronic
912774533 1:112497115-112497137 ACACAGCAGCTCTTATGGGTTGG + Intronic
914323659 1:146589856-146589878 GAACATGAGCTCTCAGTGGGTGG + Intergenic
916515347 1:165511512-165511534 AAGATGGAGCTCTCATGGGTGGG + Intergenic
916520833 1:165562059-165562081 AAACAGGAGCTATTGTGGAGAGG - Intronic
916649273 1:166819767-166819789 ACACAGCTGCTCTCATGGGCTGG + Intergenic
919015033 1:192021740-192021762 AACCTGGAGCTCTCATTGGCAGG - Intergenic
919770141 1:201153475-201153497 AAAAATGAGCTATCTTGGGGAGG - Intronic
920282982 1:204858264-204858286 TAAAAGGAGCTCACATGGGTAGG - Intronic
920684515 1:208099177-208099199 AAACTGGATCTCTCATGTTGGGG - Intronic
921596311 1:217056955-217056977 AAACAACAGCTCTCACTGGGAGG + Intronic
921828935 1:219705298-219705320 ACTCAGGAGCTCTGATGGAGAGG + Intronic
923745024 1:236692286-236692308 GCCCAGGAGCTCTAATGGGGAGG - Intronic
924172082 1:241352960-241352982 AAACAGGAGGTGTCATGAGGAGG + Intronic
1064008823 10:11718963-11718985 AAACTGGAACTCTCATGCAGTGG - Intergenic
1067581763 10:47450827-47450849 AAACAGGAGATACCATGAGGAGG + Intergenic
1067740487 10:48891758-48891780 AAACAGTAGCTCTCAAAGTGTGG - Intronic
1068299563 10:55121077-55121099 ACACAGCAGCTCTCATGGGTTGG - Intronic
1070191183 10:74113228-74113250 AAAGAGGAGCTTTCATGAGAGGG + Intronic
1070373093 10:75804115-75804137 AAACAGGAGCCTCCTTGGGGAGG - Intronic
1073611286 10:104946512-104946534 TCACAGGAGCTTTCATGAGGAGG + Intronic
1074053320 10:109899599-109899621 AAACAGGCTTTCTCTTGGGGTGG - Intronic
1074619862 10:115107512-115107534 ACATAGCAGCTCTCATGGGTTGG + Intronic
1075408331 10:122209524-122209546 AAACAGGAGGACTCCTGGGGAGG - Intronic
1075894000 10:125978724-125978746 AAGAAGGAGCTCCCAGGGGGAGG - Intronic
1082196556 11:49313550-49313572 AACCAGGGCCTGTCATGGGGTGG + Intergenic
1084012824 11:66362213-66362235 AAGGAGGAGCTATCCTGGGGAGG + Intronic
1086659269 11:89394658-89394680 AACCAGGGCCTGTCATGGGGTGG - Intronic
1088230776 11:107671580-107671602 AAACAGGAGCTGGCATGGAGAGG + Intergenic
1088746571 11:112809177-112809199 TAACAGGGGTTCTCATGGGGGGG - Intergenic
1088810746 11:113390165-113390187 AAACAGACACTCTCATGGAGTGG - Intronic
1089878209 11:121746516-121746538 ACACAGAAGCTCTCAGGGGTTGG - Intergenic
1095164929 12:38960726-38960748 AAATAGGACCTCTCAAGTGGAGG - Intergenic
1096113117 12:49040580-49040602 GCACAGCAGCTCTCAGGGGGCGG + Exonic
1100589425 12:96012035-96012057 AAACAGGAGCTCAGGTAGGGAGG - Intronic
1102346431 12:112163891-112163913 AAACAGCAGCTCTGAGGCGGCGG - Intronic
1104432944 12:128731641-128731663 AAAGTGGAGCTCTCATGAGTGGG - Intergenic
1105324957 13:19362267-19362289 ATCCAGGAGCTCTGATGGAGAGG - Intergenic
1105868328 13:24481279-24481301 ATCCAGGAGCTCTGATGGAGAGG + Intronic
1107750875 13:43565121-43565143 AAGCAGGTGCTGTCATGGGGTGG + Intronic
1110025662 13:70535656-70535678 ATACTGGAGTTTTCATGGGGAGG - Intergenic
1110172975 13:72524377-72524399 AACCAGAAGCTCTCAAAGGGTGG - Intergenic
1113801337 13:113088019-113088041 ACACATGAGCTCCCCTGGGGAGG - Intronic
1114540828 14:23457054-23457076 AAGGAGGAGCTCTCATGGCCTGG - Intergenic
1116911488 14:50470610-50470632 AAACAGGAACTCTCTTTGAGTGG - Intronic
1118648747 14:67867678-67867700 AAACTGGGGCTCTCATAGCGAGG + Intronic
1121584056 14:95050808-95050830 AAAAGGGGCCTCTCATGGGGTGG + Intergenic
1122170542 14:99870843-99870865 ATCCAGGAGCTCTGATGGAGCGG + Intronic
1124607141 15:31178180-31178202 AAACAGAAGCTCCCAGGGCGGGG - Intergenic
1130911453 15:88273726-88273748 AAAAAGGAGCTCTGTTGGGCAGG - Intergenic
1131222945 15:90600356-90600378 AAACAGGAGCCTTGATGGAGTGG - Intronic
1132251710 15:100340268-100340290 GAACAGGTGCTCCCAGGGGGAGG - Intronic
1135812495 16:25601337-25601359 ACACTGGACCTGTCATGGGGTGG - Intergenic
1137327880 16:47460529-47460551 AAACAGGTGATTCCATGGGGAGG + Intronic
1139118129 16:63981950-63981972 AAAAAGGAGCTTTCCAGGGGTGG + Intergenic
1140009904 16:71120993-71121015 GAACATGAGCTCTCAGTGGGTGG - Intronic
1144999160 17:19291371-19291393 AAACAGGATTTCTCAGGGAGTGG + Intronic
1146644751 17:34569761-34569783 CACCAGGAGCTGTCATTGGGTGG - Intergenic
1146655198 17:34630883-34630905 AATCTGGAGCCCTCTTGGGGAGG - Intronic
1147550199 17:41436358-41436380 AAGCAGGAGCTCTCAGAGGAAGG + Intergenic
1147928307 17:43959795-43959817 AAACAGGAGCATTCATGTGGAGG - Intronic
1150234519 17:63582043-63582065 TACCAGGAGCTGTCATTGGGGGG + Intronic
1151484697 17:74391373-74391395 AGAAAGGAGCTTTCAGGGGGAGG + Intergenic
1151556612 17:74849961-74849983 AAAAAGGGGCTCCCGTGGGGTGG + Intronic
1163289486 19:16370150-16370172 CACCAGGAGCTCCCATGGTGGGG + Intronic
1163389780 19:17023331-17023353 AGACAGGAGCTCAGGTGGGGAGG - Intronic
1163688334 19:18725002-18725024 CAACAGGAGCGCTCCTGGGTGGG - Intronic
1165287445 19:34853595-34853617 AGACACGTGCTCTGATGGGGAGG + Intergenic
925217529 2:2110417-2110439 AAACAGAAGCTAACATGGGTTGG - Intronic
927522435 2:23707515-23707537 ATAGAGGATCTCTCCTGGGGTGG + Exonic
929149463 2:38734536-38734558 AAACAGGAGCTATTAGGGTGAGG + Exonic
932006617 2:67933790-67933812 ACACAGCAGCTCTCATGAGTTGG - Intergenic
935313895 2:101812185-101812207 AAACTAGAACTCTCATGGGGTGG - Intronic
936648137 2:114395340-114395362 CAGCAGGACCTGTCATGGGGTGG + Intergenic
937509987 2:122584411-122584433 CACCAGGACCTGTCATGGGGTGG + Intergenic
939985919 2:148829827-148829849 CAGCAGGGGCTCTCAGGGGGAGG + Intergenic
941373597 2:164699699-164699721 AAACATTAGCTTTCATGTGGTGG + Intronic
1170538610 20:17365914-17365936 ATGCAGCAGCTCTCATGGGGTGG + Intronic
1170706001 20:18745403-18745425 ACCCAGGACCTGTCATGGGGAGG + Intronic
1171071918 20:22078380-22078402 CACCAGGACCTGTCATGGGGTGG - Intergenic
1171889827 20:30700488-30700510 CACCAGGGCCTCTCATGGGGTGG + Intergenic
1172110660 20:32542993-32543015 AAACACGAGCTCTCTTGCTGTGG + Intronic
1174914897 20:54644029-54644051 AATCAGGAGCTCTGAGGGTGGGG + Intronic
1175339540 20:58219291-58219313 ACACAGGAGGTTTCATGGGGTGG - Intronic
1179361584 21:40714344-40714366 ACCCAGCAGCTCTCATGGGTTGG - Intronic
1179560580 21:42213603-42213625 ATACTGCAGCTCTCATGGGCTGG - Intronic
1181844380 22:25694784-25694806 TTTCAGGAGCTCTCATGTGGAGG - Intronic
1184435714 22:44473873-44473895 ACACAGCAGCTCTCATGGGTTGG - Intergenic
949500943 3:4679469-4679491 AACCTGGAGCTCTGATGGGCAGG + Intronic
951690123 3:25386347-25386369 TAACAGGAGCTAGCATGGGAGGG + Intronic
952368100 3:32692747-32692769 AAAGAGTAGCTCTCCTGGGCTGG + Intronic
952871710 3:37906542-37906564 AAACAGGAGCTCCAAAGGGCTGG - Intronic
953674037 3:44986195-44986217 ACACAGGAGCACCCATGGGTGGG + Intronic
954486838 3:50860739-50860761 AAGAAGGAGCTCCCAGGGGGAGG - Intronic
959039339 3:101402822-101402844 ACCCAAGAGCTCTGATGGGGAGG + Intronic
960121349 3:113951077-113951099 ACACTGCAGCTCTCATGGGTTGG + Intronic
961325824 3:126108688-126108710 AAGCAGGAGCTCTCCAGGTGGGG + Intronic
962432991 3:135337628-135337650 AAGAAGGAGCAATCATGGGGTGG + Intergenic
962953232 3:140240873-140240895 AAAAAGGTTCTCTCATGGAGAGG - Intronic
963052887 3:141157703-141157725 AAGAAGGAGCTCTTAGGGGGAGG + Intergenic
966261881 3:177988102-177988124 AAAAAGAAGTTCTCATGGAGTGG + Intergenic
966340809 3:178923616-178923638 AAAAAGGAGCTCCCAGGGGAGGG + Intergenic
966622970 3:181985667-181985689 AAACAGGTGTTCTGGTGGGGAGG - Intergenic
966988498 3:185204263-185204285 AAAGAAGAGAGCTCATGGGGTGG + Intronic
970730662 4:19099912-19099934 AACCATCAGATCTCATGGGGGGG - Intergenic
976835381 4:89366815-89366837 AAACAAGAGCTCTGATGGAGAGG + Intergenic
980798360 4:137714678-137714700 AAACTGGTGATCTCAGGGGGTGG + Intergenic
982187222 4:152814885-152814907 AAACAGAAACTCTGGTGGGGAGG - Intronic
986428046 5:7654274-7654296 CAAGAGGAGCTCTGGTGGGGTGG + Intronic
986805667 5:11306449-11306471 CTCCAGGAGCTATCATGGGGTGG + Intronic
987237541 5:15958069-15958091 CATCAGGAGCCCTCATGGGTGGG - Intergenic
988516832 5:31912327-31912349 AAAGAGGAGCGCTCATGAGTGGG - Intronic
991941773 5:71860328-71860350 AAAGAGGGGCTCTCAGGGGCTGG + Intergenic
995683702 5:114747804-114747826 AACCAGGAGCTTCCTTGGGGAGG + Intergenic
996399477 5:123046177-123046199 AAACAGTAGTTTTCATGGGCAGG + Intergenic
1000243752 5:159432107-159432129 AACCTGGAGCTCTCAGGGAGGGG - Intergenic
1000462532 5:161540747-161540769 ACACATGAGCTCTGATGGAGAGG - Intronic
1003016864 6:2475141-2475163 CAACACGGGGTCTCATGGGGAGG - Intergenic
1003635643 6:7829175-7829197 CAACAGTTTCTCTCATGGGGTGG - Intronic
1004905005 6:20229336-20229358 AAACATGGGCTCTCAGGAGGAGG - Intergenic
1005156401 6:22812045-22812067 AGAAATGAGCTGTCATGGGGCGG + Intergenic
1006434920 6:34021076-34021098 AAACAGGAGCGCTTAGGGGCTGG - Intronic
1006863460 6:37189431-37189453 AAACAGGAGCTATTATGAGAAGG + Intergenic
1007224834 6:40305877-40305899 AAACTACAGCTCCCATGGGGTGG - Intergenic
1008342331 6:50382568-50382590 CAGCAGGACCTGTCATGGGGTGG - Intergenic
1011062223 6:83283406-83283428 CACCAGGACCTCTCATGGGGTGG + Intronic
1011269611 6:85563927-85563949 CACCAGGACCTGTCATGGGGTGG - Intronic
1012429115 6:99145732-99145754 TAACAGGAGCTATGGTGGGGTGG - Intergenic
1013763003 6:113540070-113540092 AAACAGGAGCTGGTGTGGGGAGG - Intergenic
1017213281 6:151880475-151880497 AAACAAAACCTCTCATGGGCCGG - Intronic
1019165971 6:170097774-170097796 AAACAGCAGCTCCCGTGGGCGGG + Intergenic
1019494809 7:1332727-1332749 GAAAAGGAGCTCTAATGAGGGGG - Intergenic
1019814350 7:3188710-3188732 AAACCGGGGCTCCCCTGGGGTGG + Intergenic
1020005938 7:4783847-4783869 GCACAGGAGCTCTCAGGGAGGGG - Intronic
1020520944 7:9186309-9186331 AAACCGGGCCTGTCATGGGGTGG - Intergenic
1023343885 7:39251651-39251673 AAACAGGAGCTCAGCTGGGCTGG - Intronic
1023565555 7:41520895-41520917 AAACAGGAGCCTTCCTGGGCAGG + Intergenic
1024261850 7:47579360-47579382 CAGCAGGAGCTATCATGGGAAGG - Intronic
1031627292 7:124005317-124005339 AAGAAGGAGCTCCCAGGGGGAGG - Intergenic
1032599041 7:133273405-133273427 AAACAGGATCTCTCATGTAAAGG + Intronic
1032888862 7:136171609-136171631 AACCAGGAGCTCTGATGTTGAGG + Intergenic
1034056042 7:148035801-148035823 ACATAGGAGCTCTCATGGGTTGG - Intronic
1034236396 7:149573967-149573989 CACCAGGACCTGTCATGGGGTGG - Intergenic
1034529766 7:151688420-151688442 AAACAGCAGATCTCATGTGAGGG + Intronic
1037092898 8:14945122-14945144 AAACAGGAGCTGACATGGTTAGG + Intronic
1037756754 8:21715240-21715262 GAACAGCAGCTCCCCTGGGGTGG + Intronic
1039016306 8:33153195-33153217 AAACAGGTGCTCTAATTGGCAGG - Intergenic
1040556222 8:48479424-48479446 AACCGGGAGCTCTGATGGGCAGG + Intergenic
1043191148 8:77224926-77224948 AAAATGGAGCTCTCAGGGGAAGG - Intergenic
1046597272 8:116274873-116274895 AATCAGGAGGTCTCAGGGAGGGG + Intergenic
1046854098 8:119009382-119009404 AACAACCAGCTCTCATGGGGAGG - Intronic
1047177459 8:122555061-122555083 AAACAGGAGGGATAATGGGGGGG - Intergenic
1047758981 8:127940037-127940059 CAACAGTTGCCCTCATGGGGAGG + Intergenic
1048413653 8:134202296-134202318 AAACAGGAACTCTGATCTGGGGG + Intergenic
1052837163 9:33259766-33259788 AAACAGGAGCGCTCAATTGGAGG - Intronic
1054359264 9:64097720-64097742 CACCAGGGCCTCTCATGGGGTGG - Intergenic
1055394521 9:75859937-75859959 AAACAGCAGCTCTCTTCAGGGGG + Intergenic
1055664939 9:78544001-78544023 TAACAGGAGCTGCCATGGGTAGG + Intergenic
1056413978 9:86358737-86358759 AACCAGGGCCTCTGATGGGGAGG + Intergenic
1057380827 9:94566044-94566066 AAGCAGGAGCATTCATGTGGTGG - Intronic
1058501702 9:105625885-105625907 AAACAGGAGCTATGATCGTGAGG - Intronic
1060230181 9:121820142-121820164 AAACATCAGCTCTCCTGGTGAGG - Intergenic
1060483860 9:124034836-124034858 AAATAGGAGCTATCTTGGGAGGG - Intergenic
1061881275 9:133570442-133570464 AAACACGTGCTCTCCTCGGGAGG - Exonic
1187944838 X:24416023-24416045 AAGCAGCAGCTCTCATGGGTTGG - Intergenic
1189431345 X:40950249-40950271 ACACAGCTGCTCTCATGGGCTGG + Intergenic
1192081881 X:68055938-68055960 CACCAGGACCTGTCATGGGGTGG + Intronic
1192618118 X:72649088-72649110 GAACAAGATCTCTCATGGGAAGG + Intronic
1193800859 X:85934431-85934453 CACCAGGACCTGTCATGGGGTGG - Intronic
1194753473 X:97709536-97709558 AAAAAGAAGCTCTCAGGGAGGGG - Intergenic
1198795383 X:140388994-140389016 AAAGGGGACCTCTCATTGGGGGG + Intergenic
1199708610 X:150452001-150452023 AAGCAGGAGCTCTCAGGGTCAGG - Intronic
1199987292 X:152961978-152962000 AACCAGGTGCTCTGATGGAGAGG + Intronic
1200536545 Y:4404535-4404557 AAACTGAAGCTCTTATGGGTGGG + Intergenic