ID: 901911125

View in Genome Browser
Species Human (GRCh38)
Location 1:12459112-12459134
Sequence CTGTGGATATGGAGAGCTGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 303
Summary {0: 1, 1: 1, 2: 5, 3: 29, 4: 267}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
901911125_901911131 8 Left 901911125 1:12459112-12459134 CCATCAGCTCTCCATATCCACAG 0: 1
1: 1
2: 5
3: 29
4: 267
Right 901911131 1:12459143-12459165 AACCATGGATGGAAAATATTTGG 0: 3
1: 36
2: 125
3: 237
4: 565
901911125_901911136 12 Left 901911125 1:12459112-12459134 CCATCAGCTCTCCATATCCACAG 0: 1
1: 1
2: 5
3: 29
4: 267
Right 901911136 1:12459147-12459169 ATGGATGGAAAATATTTGGGGGG 0: 1
1: 5
2: 6
3: 39
4: 400
901911125_901911134 10 Left 901911125 1:12459112-12459134 CCATCAGCTCTCCATATCCACAG 0: 1
1: 1
2: 5
3: 29
4: 267
Right 901911134 1:12459145-12459167 CCATGGATGGAAAATATTTGGGG 0: 1
1: 11
2: 35
3: 105
4: 340
901911125_901911132 9 Left 901911125 1:12459112-12459134 CCATCAGCTCTCCATATCCACAG 0: 1
1: 1
2: 5
3: 29
4: 267
Right 901911132 1:12459144-12459166 ACCATGGATGGAAAATATTTGGG 0: 3
1: 14
2: 83
3: 164
4: 473
901911125_901911135 11 Left 901911125 1:12459112-12459134 CCATCAGCTCTCCATATCCACAG 0: 1
1: 1
2: 5
3: 29
4: 267
Right 901911135 1:12459146-12459168 CATGGATGGAAAATATTTGGGGG 0: 1
1: 7
2: 18
3: 61
4: 321
901911125_901911127 -7 Left 901911125 1:12459112-12459134 CCATCAGCTCTCCATATCCACAG 0: 1
1: 1
2: 5
3: 29
4: 267
Right 901911127 1:12459128-12459150 TCCACAGATTCAGCCAACCATGG 0: 2
1: 8
2: 43
3: 166
4: 424
901911125_901911129 -3 Left 901911125 1:12459112-12459134 CCATCAGCTCTCCATATCCACAG 0: 1
1: 1
2: 5
3: 29
4: 267
Right 901911129 1:12459132-12459154 CAGATTCAGCCAACCATGGATGG 0: 1
1: 1
2: 8
3: 37
4: 203

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
901911125 Original CRISPR CTGTGGATATGGAGAGCTGA TGG (reversed) Intronic
900146142 1:1159608-1159630 CTGTGGACATGGAGAGTGGCGGG - Intergenic
900800862 1:4736203-4736225 CTGTGGTTTAGGAGAACTGATGG - Intronic
900911740 1:5601503-5601525 TCGTGGATAAGGAGGGCTGAAGG + Intergenic
900943778 1:5817866-5817888 CTGTGGAGCTGGACAGATGAGGG - Intergenic
901911125 1:12459112-12459134 CTGTGGATATGGAGAGCTGATGG - Intronic
902450038 1:16491092-16491114 ATGTGGGGATGGGGAGCTGATGG + Intergenic
903176706 1:21585851-21585873 CTGTGGAAATGGAGAGGGGAGGG + Intergenic
903573073 1:24320689-24320711 CTGTGAACATGAAGAGCTGAAGG - Intronic
903651711 1:24926692-24926714 CTGTGGAGTTGGGGAGCAGAGGG + Intronic
905361074 1:37420836-37420858 CTGTGGATACTGAGGGATGATGG - Intergenic
907946182 1:59138657-59138679 CTGTGGATGTGCAGAGTTGGAGG + Intergenic
908626342 1:66047924-66047946 CTGTGGGTATGAAGAGCTAATGG + Intronic
909579490 1:77218390-77218412 CAGTGGAACTGGAGAGGTGAGGG + Intronic
910535404 1:88292119-88292141 CAGAGCATATGAAGAGCTGAAGG - Intergenic
910758088 1:90712112-90712134 GTGGGGAGATGGAGAGCAGAGGG + Exonic
910981672 1:92964572-92964594 GAGTGGATATGGAGAGTTTAAGG + Intergenic
913583519 1:120250310-120250332 ATGTGGATAGGGAGAGCTGGAGG - Intergenic
913624657 1:120648009-120648031 ATGTGGATAGGGAGAGCTGGAGG + Intergenic
914565506 1:148862147-148862169 ATGTGGATAGGGAGAGCTGGAGG - Intronic
914607319 1:149268102-149268124 ATGTGGATAGGGAGAGCTGGAGG + Intergenic
914678259 1:149920338-149920360 CCATGGATATGGAGGACTGATGG - Intergenic
916231373 1:162544468-162544490 ATTTGGGTATGGACAGCTGAGGG - Intergenic
916395995 1:164387868-164387890 CTTTGGAGATGAAGAGCTCAAGG - Intergenic
916502896 1:165401665-165401687 CTGTGAATGAGGGGAGCTGAGGG - Intronic
918445049 1:184609124-184609146 CTCTGGAGAGGGAGAGGTGAGGG - Intronic
919479858 1:198074944-198074966 CTGTAGAGAAGGAGTGCTGATGG + Intergenic
920185081 1:204154438-204154460 CAGTGGATAAGGACAGCTGAGGG + Intergenic
920308754 1:205035685-205035707 CTGTGGATCTGGAGAGTGAATGG + Intergenic
920678518 1:208055405-208055427 CTGAGGATGGGGAGAGATGAAGG + Intronic
923369338 1:233295274-233295296 CTGTGGGTATGGAGGGAAGAAGG - Intronic
923427017 1:233881012-233881034 CTCTGGTTTTGCAGAGCTGAGGG + Intergenic
923467442 1:234261951-234261973 CTGTGGAGATAGAAAGGTGAAGG - Intronic
924133735 1:240940372-240940394 CTGTGGATCTGGAGACCAGGTGG - Intronic
924811022 1:247402160-247402182 CTGATGAGATGGAGAGGTGAAGG + Intergenic
1063731814 10:8706378-8706400 CTCTAGATTTTGAGAGCTGAGGG + Intergenic
1063957731 10:11282042-11282064 CAGTGGATATGGGGACCTGGGGG + Intronic
1067842207 10:49690043-49690065 CTCTGGACTTGGTGAGCTGAAGG + Intronic
1067850373 10:49750512-49750534 CTGTGGACAAGGAGAGGTGGAGG - Intronic
1068100545 10:52547207-52547229 CCATGGGTATGGAGGGCTGACGG - Intergenic
1069746027 10:70715575-70715597 CTGCTGAGGTGGAGAGCTGAAGG + Intronic
1069985584 10:72280724-72280746 CTGTGGCTATGTGGAGCTGGCGG + Intergenic
1070640423 10:78164944-78164966 CTGTCCATATGGACAGCAGAAGG - Intergenic
1070647570 10:78212389-78212411 CAGTGGAGCTGGAGAGCAGAAGG - Intergenic
1071293002 10:84200925-84200947 CTGGGGATGTGGAGGGCTGAGGG - Intronic
1073231435 10:101974440-101974462 CTGTGGCTTTTGAGACCTGATGG - Intronic
1073799851 10:107029465-107029487 CTGTGGTTATGGAGAATTGCAGG - Intronic
1076034080 10:127184456-127184478 ATGGGGGAATGGAGAGCTGAGGG - Intronic
1076772667 10:132675055-132675077 CTTTGGGTATGGAGGACTGAGGG - Intronic
1078597621 11:12702056-12702078 CTGTGTAAATGGAGAGCTGAAGG + Intronic
1079331058 11:19533463-19533485 GTGTGGACATGGTCAGCTGATGG - Intronic
1079406134 11:20147631-20147653 CTGTGGATTTTGATATCTGAAGG + Intergenic
1082131459 11:48494869-48494891 CTGTGTATTTGAAGAGCAGATGG + Intergenic
1083140118 11:60714740-60714762 CTTTGGGTGTGGAGACCTGAGGG - Intronic
1085234087 11:74998602-74998624 CTGTGGATATGAAGATTTAATGG - Intronic
1085816198 11:79739736-79739758 CTTTGGACATGGAGAGATGCAGG - Intergenic
1085858136 11:80198977-80198999 CTATGGAGAGGGAGAGATGAGGG - Intergenic
1086952419 11:92904875-92904897 CTTTCAAGATGGAGAGCTGAGGG + Intergenic
1087266067 11:96062683-96062705 CTTTGGATAAGGAGAGCTGCTGG - Intronic
1089098845 11:115942914-115942936 CTGTTGTTTTGGAGAGCTGAAGG - Intergenic
1089494219 11:118900258-118900280 CTGTGGATATGGGGAGGTTTAGG + Intronic
1089824075 11:121257017-121257039 CTCTGGAAATGCAGAGGTGATGG + Intergenic
1090903031 11:131049122-131049144 CTGTGGAATTTGAGAGATGATGG - Intergenic
1090923737 11:131231435-131231457 CTGAGGTTTTGGGGAGCTGAAGG - Intergenic
1091204253 11:133808722-133808744 CTGTGGAGATGCAGTGATGATGG - Intergenic
1091280639 11:134379842-134379864 CTGTGGCTCTGAAGAGCTGCAGG + Intronic
1091755064 12:3045982-3046004 CTGAAGATTTGGAGAGATGAAGG - Intergenic
1091796911 12:3302756-3302778 CTGTGGATATGGAGGGCTGATGG + Intergenic
1092283900 12:7117667-7117689 CTGTTGAAAAGGAGAGCAGATGG + Intergenic
1097081150 12:56432026-56432048 CTGTGGATATGCTGGGCAGAGGG + Intronic
1097825500 12:64171405-64171427 CACTGGGGATGGAGAGCTGATGG + Intergenic
1097893185 12:64799145-64799167 ATGTGCCTCTGGAGAGCTGATGG + Intronic
1098614193 12:72502856-72502878 ATGTGAATATGGAGAAATGAGGG + Intronic
1098705465 12:73684072-73684094 ATGTGGATATGTAAAGGTGATGG + Intergenic
1100014028 12:89987234-89987256 GTGTGGGTATGGAGAGACGAAGG + Intergenic
1100388886 12:94129724-94129746 CTTCCGATATGGAAAGCTGATGG - Intergenic
1102805381 12:115774993-115775015 CTGTGGATATGGATGGGAGAAGG - Intergenic
1103587706 12:121968428-121968450 GTGTGGATATGTGGAGCAGAGGG - Intronic
1104329714 12:127833537-127833559 TGGTGGACATGGAGAGATGATGG + Intergenic
1106578427 13:30997545-30997567 CTGCCGAAATGGGGAGCTGAGGG + Intergenic
1106674240 13:31940986-31941008 CTGAGAAAATAGAGAGCTGAAGG - Intergenic
1106756193 13:32825351-32825373 CTGTAGATCTGGAAGGCTGATGG - Intergenic
1109623259 13:64939323-64939345 ATGTGGTTTTGGAGGGCTGAAGG + Intergenic
1111291541 13:86177508-86177530 CTGTGGATATGGAGGGCCACTGG + Intergenic
1111628739 13:90823003-90823025 CTATGGAGATGGAGAGTAGAAGG - Intergenic
1111827528 13:93286452-93286474 CAGAGGATATGGGGAGCTGGAGG + Intronic
1113591727 13:111506237-111506259 CTTTGCATCTGGAGAGCTGAAGG + Intergenic
1114567835 14:23645477-23645499 GTGTGGGTCTGGGGAGCTGAAGG + Exonic
1120706588 14:87752233-87752255 CTGAGAACAGGGAGAGCTGATGG + Intergenic
1121522845 14:94598258-94598280 CTGTGGAGATGGAGAGTGGGTGG + Intronic
1121554381 14:94825214-94825236 CTGTGGAAATGGAGTGCAGTGGG + Intergenic
1122870539 14:104636176-104636198 CTGGGGATTGGGAGAGCTGCTGG - Intergenic
1124004653 15:25786074-25786096 GTGGGGAGAAGGAGAGCTGAGGG + Intronic
1124047248 15:26161674-26161696 AGGTGGATATGGACAGCTGCAGG + Intergenic
1124370850 15:29103886-29103908 CTGCGGAGTTGGCGAGCTGATGG - Intronic
1126365440 15:47889507-47889529 CTGTGGAGATAGAGAGTAGAAGG + Intergenic
1128469685 15:67941744-67941766 CTGTGGATATGGAGTGGTCAGGG + Intergenic
1128533482 15:68471270-68471292 CTGTGGATATGGGGTGGTGCTGG - Intergenic
1129890754 15:79070206-79070228 CTTTGGAGATGGAGAGCACATGG + Intronic
1130367659 15:83254676-83254698 CTGTGAATATGGAGAGTTGGTGG + Intergenic
1131673632 15:94648681-94648703 CTGTGTTGATGGAGAGGTGAAGG - Intergenic
1132302766 15:100786805-100786827 ATGTGGATATGGAGAGAGGGCGG + Intergenic
1132471217 16:104435-104457 CTATGGGTATGGAGAAATGAGGG + Intronic
1133256316 16:4518545-4518567 ATGTGGATATGGAGGGGTGAGGG - Intronic
1137268891 16:46889829-46889851 CTGGGGATAAGAAGTGCTGAAGG + Intronic
1137836020 16:51593562-51593584 ATGTGGGTATGGTGAGCTGGAGG + Intergenic
1140302667 16:73773390-73773412 CAGTGGAGATGGAGAACAGATGG + Intergenic
1142016372 16:87750320-87750342 CTGTGGAGATGCAGCACTGAGGG - Intronic
1142493731 17:294984-295006 CTGTAGAAATGGAAAGCAGAGGG + Intronic
1142652562 17:1364822-1364844 CTGTGGATAAGGGGGGATGATGG + Intronic
1144447817 17:15347386-15347408 CTATAGATATGGAGGGCTGATGG + Intergenic
1144770733 17:17758019-17758041 CTCTGGAAAGGGAGAGATGAGGG - Intronic
1146307473 17:31741633-31741655 CTTTGGATATGGAGGGCTCTGGG + Intergenic
1146312242 17:31778461-31778483 CTGTGTGGATGCAGAGCTGAGGG - Intergenic
1147757733 17:42779947-42779969 CTGTGGCCAAGGGGAGCTGAGGG + Intergenic
1148758906 17:49989378-49989400 CTTTGGAGACGGAGAGCTGGAGG - Intergenic
1148856593 17:50582350-50582372 CCCTGGAAATGGAGAGCAGAGGG + Intronic
1149219305 17:54397749-54397771 CTGAGAATCAGGAGAGCTGATGG - Intergenic
1149797144 17:59531016-59531038 CTGTGGATATGGAAATATTAAGG + Intergenic
1150359536 17:64519244-64519266 CTGAGGACCTGGAGAGCTGCTGG - Intronic
1150941251 17:69696943-69696965 CTCTGGATATTGAGAGCAGCAGG + Intergenic
1152534390 17:80942000-80942022 CTGTGCATCTGAAGAGCTGGCGG + Intronic
1153030540 18:709400-709422 CTGAGGGTAAGGACAGCTGAAGG + Intronic
1154000327 18:10477157-10477179 GTGTGGATTTGCAGAGGTGATGG + Intronic
1154308915 18:13252780-13252802 CTGTGGATGTGGAGGGCCGACGG - Intronic
1154326769 18:13396865-13396887 CTGTGGATACAGAGGGCTGACGG + Intronic
1157630754 18:49092960-49092982 CAGTGAATAAGGAGAGTTGAAGG + Intronic
1158735445 18:60074528-60074550 CTGGGAATCAGGAGAGCTGATGG - Intergenic
1158906054 18:62012910-62012932 CTGTGGTTATGGAGAGAGCAGGG - Intergenic
1159146707 18:64463683-64463705 CACTGGATATGAAGAGCTGGGGG + Intergenic
1159225171 18:65523835-65523857 CTGTGGAAATGGAGTGATGGTGG + Intergenic
1160237981 18:77100928-77100950 CTGTGGATCTGCTGAGCTGTGGG - Intronic
1160866717 19:1259482-1259504 CTGTGGCTGGGGAGAGCTGGTGG - Exonic
1162125649 19:8498398-8498420 CCGTGGATATGCAGAGCTTTCGG - Exonic
1164585371 19:29467988-29468010 CTGCTGGTATGGAGAGCTAAAGG - Intergenic
1165495237 19:36148854-36148876 CTGTGGGTATGGACACCTGAGGG + Intronic
1168151715 19:54452605-54452627 CTGTGGATTTGGGCTGCTGACGG + Intronic
1168375614 19:55876866-55876888 CTGTGGATATGGAGGACTGACGG + Intronic
1168483034 19:56737306-56737328 CTGTGTCCATGCAGAGCTGAGGG + Intergenic
925833360 2:7918154-7918176 AAGAGGACATGGAGAGCTGATGG - Intergenic
926404600 2:12538315-12538337 CTGAGGATATATAGAGCAGAAGG - Intergenic
927847924 2:26480821-26480843 CTGTGGAGCTGGTGAGCTCAGGG + Exonic
928672772 2:33619411-33619433 GTCTGGATCTGGAGAGCTGATGG + Intergenic
928769473 2:34689354-34689376 CTGTGTATCTTGAGAGCTGAAGG - Intergenic
933862011 2:86479123-86479145 CTGTGTTTATGCAGAGTTGAAGG + Intronic
935066503 2:99652896-99652918 TTCTTGATAAGGAGAGCTGAGGG + Intronic
935327307 2:101948547-101948569 CTGTGGAGGTGGAGAGTGGATGG + Intergenic
935716851 2:105946951-105946973 CTTTCCATATGGACAGCTGAAGG + Intergenic
936267311 2:111020395-111020417 CTCTGGGGATGGAGAGCTGGTGG + Intronic
937712559 2:124995145-124995167 CTGTGCTTTTGGAGAGATGATGG - Intergenic
937916891 2:127103678-127103700 CTGGGGAGAAGGACAGCTGAGGG - Intronic
939461604 2:142503450-142503472 CAGTGGATAAGGAGAGCTTCAGG - Intergenic
940906284 2:159172877-159172899 CGGTGGAGCTGGAGAGCTGCTGG + Intronic
944486752 2:200214770-200214792 CTTTGGATGTGGAGCGCTGGAGG - Intergenic
944594329 2:201247421-201247443 CTGGGGAAATGTGGAGCTGAGGG - Intronic
945779135 2:214146220-214146242 ATGTGGAGATGGAGAGATGTGGG - Intronic
947781675 2:232771429-232771451 TTGTGAATTTGGAGAGCTCATGG + Intronic
948904759 2:240973550-240973572 CTGGGGATGTGGGGAGCTGGGGG - Intronic
1169732335 20:8799742-8799764 CTGTGGATTTGGGTATCTGAGGG - Intronic
1169735812 20:8836386-8836408 CTGAGAATGAGGAGAGCTGATGG + Intronic
1170793817 20:19529482-19529504 TTGTGGAGATGGAGAGGAGATGG - Intronic
1171002310 20:21426815-21426837 CAGTGGAGAGGGAGAGCAGAAGG - Intergenic
1171022879 20:21602698-21602720 CTGTGGGTAGGGAGGGCTGGAGG + Intergenic
1172864541 20:38085691-38085713 CTTTGGGTCTGGAGAGATGAAGG - Intronic
1176217290 20:63954235-63954257 CTGTGGAAGTGGGGAGCAGAGGG - Intronic
1178281002 21:31282839-31282861 CTGTGGATATGGAAAGTTCTGGG - Intronic
1178415772 21:32403868-32403890 CTGTGGATACGGGGTGGTGATGG + Intergenic
1179546040 21:42112813-42112835 CTCTGGATGTGTAGAGCAGATGG - Intronic
1179608149 21:42531619-42531641 GTGTGGCTATGCAGAGGTGAGGG + Intronic
1180700722 22:17780246-17780268 CTGTGCATCTGGAGGGCAGAGGG + Intergenic
1181973304 22:26710237-26710259 CTGTGGCTACTGAGAGCTGGAGG - Intergenic
1182789404 22:32937155-32937177 ACGTGGAAATGGAGAGATGATGG + Intronic
1185210451 22:49567976-49567998 CTGTGGCCGTGGAAAGCTGAAGG + Intronic
1185363261 22:50422231-50422253 CTGTGGATGAGGAAAGCAGATGG - Intronic
949838044 3:8290653-8290675 CTGTGGACAAGGATAGCTGGAGG + Intergenic
949959427 3:9299920-9299942 ATTTGGCTATGGAGAGCTAAGGG - Intronic
950552490 3:13675224-13675246 CTGGGGATGTGGACACCTGATGG - Intergenic
952189892 3:31011610-31011632 CTGTGGATGTTGGTAGCTGAGGG - Intergenic
954330960 3:49890061-49890083 CTGTGGAAAGGGGGAGGTGAGGG + Intronic
954672098 3:52296692-52296714 CTGTGGAAGTGGGGAGCTCAGGG + Intergenic
955572879 3:60326876-60326898 CTGTGATCATGGAAAGCTGAGGG - Intronic
956491592 3:69778053-69778075 CTGTGGAGATGGAGAGGAGGTGG + Intronic
957315393 3:78569876-78569898 CTGTGCATATGGACAGCCCAAGG - Intergenic
960947213 3:122974927-122974949 TTGTGGAAAAGGAGAGCTGGGGG - Intronic
961061630 3:123833491-123833513 CTGAGGATAGGGAGAGCAGCAGG - Intronic
961109159 3:124268942-124268964 CTGTGGATGTGGAGGGCTCTCGG + Exonic
962962182 3:140321238-140321260 CTATGGATATGGAGAGTCCAGGG - Intronic
966432486 3:179846785-179846807 CTGAGGACCAGGAGAGCTGATGG - Intronic
966504464 3:180684017-180684039 CAGTGGAGATGGAGAGCAGTAGG - Intronic
967873892 3:194253219-194253241 CTGGGGATCTAGAGTGCTGAAGG + Intergenic
968345043 3:197996394-197996416 AAGTGCATCTGGAGAGCTGAAGG - Intronic
968614993 4:1573735-1573757 CTGAGGATGGGGGGAGCTGAGGG - Intergenic
969182132 4:5450326-5450348 CTGTGGATATGGTCAGGGGAAGG - Intronic
969261230 4:6035427-6035449 CTGAGCACATGGGGAGCTGAGGG - Intronic
969696301 4:8737028-8737050 CTGTGTTTCTGGACAGCTGATGG - Intergenic
970021050 4:11568798-11568820 CTGAGAATATGTAGAGCTCAGGG + Intergenic
971561525 4:28084457-28084479 CTGTGGATATGAAGAAGTCAAGG - Intergenic
977080376 4:92519766-92519788 CTGAGAATAAGGAGAGCTGATGG + Intronic
978340347 4:107715917-107715939 ATGAGGATATTGAGAGATGAAGG + Intronic
978436645 4:108692795-108692817 CTGTGGATAGGGTGAGATCAAGG - Intergenic
978445471 4:108776149-108776171 CTCTGGAGATGGAGGGCTCAAGG + Intergenic
979388164 4:120094668-120094690 CTGTTTCTATGGAGTGCTGAAGG + Intergenic
980228852 4:130021897-130021919 TCGTGGATAAGGAGGGCTGATGG + Intergenic
980493087 4:133555115-133555137 CTGTGGATGTTGAGAGCCGGAGG - Intergenic
981510791 4:145555904-145555926 AGTTGGATTTGGAGAGCTGAAGG + Intronic
982391450 4:154868726-154868748 CTGAGAATCAGGAGAGCTGATGG - Intergenic
983085165 4:163434308-163434330 CCATGGATATGGAAGGCTGATGG - Intergenic
984184252 4:176523024-176523046 CTGGGGATATGGGGAGCTTGGGG + Intergenic
985741078 5:1617845-1617867 CTGTGCAGCTGGAGATCTGATGG - Intergenic
985741314 5:1618952-1618974 CTGTGCAGCTGGAGACCTGACGG - Intergenic
985889432 5:2704317-2704339 CTGAGGATGGGGAGCGCTGATGG + Intergenic
986357005 5:6938358-6938380 CTCTGAATATGGACAGTTGAGGG + Intergenic
987206854 5:15636269-15636291 CTGTAGATGAGGAGAGTTGAGGG - Intronic
988324577 5:29746201-29746223 CTGTGGACATGGACTGCTGATGG - Intergenic
988617505 5:32789606-32789628 CTGTGAATAGGGAGAAGTGAGGG - Exonic
990282989 5:54271323-54271345 CTGTGGATTTTGATACCTGAAGG - Intronic
992211074 5:74480010-74480032 TTGTGTATATGGGGACCTGAAGG + Intergenic
995635852 5:114189294-114189316 CTGAGAACAAGGAGAGCTGATGG + Intergenic
995857950 5:116613670-116613692 CTGGGTATCAGGAGAGCTGAGGG - Intergenic
998637278 5:143970060-143970082 ATGTCTATCTGGAGAGCTGAGGG - Intergenic
999194916 5:149775236-149775258 CTGTGGATCTGGAGAGGGCAGGG + Intronic
1000043514 5:157502796-157502818 CTGTGGAGAAGAAGAGGTGAGGG - Exonic
1000158479 5:158575546-158575568 CTGAAGCTTTGGAGAGCTGATGG + Intergenic
1000267527 5:159652066-159652088 CTGTGGATATGCAGAACTGGGGG - Intergenic
1001176529 5:169474129-169474151 ATGTGGAAAGGGACAGCTGAAGG - Intergenic
1001328385 5:170745564-170745586 CTGTGCTTATGGATAGCTTAGGG + Intergenic
1002258632 5:177978587-177978609 CTGTGGGACTGGAGAGCAGACGG + Intergenic
1002364415 5:178698968-178698990 CTGTGGAAATGAAGAGATGGTGG - Intergenic
1002501229 5:179648959-179648981 CTGTGGGACTGGAGAGCAGACGG - Intergenic
1002586657 5:180252959-180252981 ATGTGGAGAAGTAGAGCTGAGGG + Intronic
1005467972 6:26133784-26133806 CTTTGGATTTGTAGAGATGAAGG - Intronic
1006824097 6:36921447-36921469 CTGTGGAGATGGAGGGGAGAGGG + Intronic
1008112929 6:47512383-47512405 CTGTGAATATGGAGTGTGGATGG + Intronic
1008356898 6:50565663-50565685 CAGTGGCTATGGAGAGCCGGAGG - Intergenic
1010040621 6:71378663-71378685 CTGTGGAGATGGAGAAGTCATGG + Intergenic
1010118429 6:72342894-72342916 ATGGGGATATTGAAAGCTGAAGG + Intronic
1012953688 6:105545659-105545681 GTGTGGATGAGGAGAGCAGAAGG - Intergenic
1012954274 6:105552050-105552072 CTGAGGATATGAAGTGCTGGAGG - Intergenic
1013451341 6:110284599-110284621 CTGTGAATATGAAGAAGTGAAGG + Intronic
1014608021 6:123502976-123502998 ATGTGAATATACAGAGCTGAAGG - Intronic
1015499286 6:133915285-133915307 TTGTGGATATGGAGGGCTGGTGG - Intergenic
1016521458 6:144951341-144951363 CTGTGGATACTGAGGGATGATGG - Intergenic
1016542039 6:145177540-145177562 TTATGGATATAGAGAGCAGAAGG + Intergenic
1017329432 6:153178353-153178375 CTATGGAAATGAAGGGCTGATGG - Intergenic
1017628369 6:156370976-156370998 CTATGGATACAGAGGGCTGATGG - Intergenic
1018038641 6:159902987-159903009 CTGTGGAAAAGAAGGGCTGAGGG - Intergenic
1021667400 7:22998649-22998671 CTGTGGAGATGGAGAGCAGATGG - Intronic
1022469571 7:30674067-30674089 CTGTGGAAATAGGGAGTTGAGGG - Intronic
1022548893 7:31217651-31217673 CTGAGGAGAGGGAGAGATGAGGG + Intergenic
1022757386 7:33307830-33307852 CTATGAATATAGAGGGCTGATGG + Intronic
1023111894 7:36821785-36821807 CTGAGAATCAGGAGAGCTGATGG + Intergenic
1023111900 7:36821834-36821856 CTGAGAATCAGGAGAGCTGATGG + Intergenic
1023591339 7:41783635-41783657 CTGTAGATGTGGAGAGAAGACGG + Intergenic
1023781900 7:43663722-43663744 ATGGGGAAATGGAGAGTTGATGG - Intronic
1031934443 7:127721717-127721739 CTGTGAATAAGGAGAGGAGAAGG + Intronic
1033138980 7:138808374-138808396 CTGTGGCTCTGCACAGCTGAGGG + Intronic
1033271971 7:139940153-139940175 CTTTGCATATGAAGAGCAGAGGG + Intronic
1033597416 7:142867374-142867396 GTGTGGATGTGGAGGGCTGTGGG + Intronic
1033845932 7:145432151-145432173 CTGAGGAGAAGGAGAGATGAGGG + Intergenic
1036576912 8:10036237-10036259 CTGTGGAAGAGGAGAGCTGTAGG - Intergenic
1037620148 8:20556294-20556316 CTGTGGACATTGTGAGCAGAGGG + Intergenic
1037620160 8:20556363-20556385 CTGTGGACATTGTGAGCAGAGGG + Intergenic
1037748425 8:21664223-21664245 CTGTGGATATGGGGAGCCTGGGG - Intergenic
1040460591 8:47644094-47644116 CTGTGAAGATGGAGTGCTGGTGG + Intronic
1041501344 8:58542215-58542237 GTGAAAATATGGAGAGCTGATGG + Intergenic
1041945264 8:63433698-63433720 CAGGGAATATGGAGAGCAGAGGG + Intergenic
1042944962 8:74145263-74145285 CTGTGGATAAGGTGAGATGCAGG + Intergenic
1044488527 8:92783381-92783403 CTGTGTGTAAGGAGAGCTGACGG + Intergenic
1046291442 8:112167236-112167258 CTATGGATATGGGGCTCTGAGGG + Intergenic
1047310048 8:123684369-123684391 CTGTGGCTCTGGAGAGCTAGTGG - Intronic
1048907637 8:139103883-139103905 CCCTGGAGATGGATAGCTGAAGG + Intergenic
1049672230 8:143875056-143875078 CTGCAGATTTGGGGAGCTGAGGG - Intronic
1049700954 8:144012314-144012336 CTGGTGGCATGGAGAGCTGAGGG + Intronic
1049758381 8:144320818-144320840 CTGTGGGTATGGAGCCCTGCAGG - Intronic
1050254143 9:3776637-3776659 CTGGAGATATGGTGAGATGAAGG - Intergenic
1052029510 9:23612104-23612126 CTGTGAATCAGAAGAGCTGATGG + Intergenic
1052170810 9:25394222-25394244 CTGTGGATATGGAGAGCCAACGG + Intergenic
1052692522 9:31833537-31833559 CTGTGGATATGGATAAATGGAGG - Intergenic
1053019230 9:34683482-34683504 CTGTGGATAGGAAGAGGAGAGGG - Intergenic
1055293883 9:74814261-74814283 CCATGGAGATGGAGAGCAGAAGG + Intronic
1056592178 9:87972638-87972660 CTGTGGCTATGGAGAGCAGTGGG + Intronic
1057307603 9:93921213-93921235 CTGGGGAACTGGAGAGCTGGGGG + Intergenic
1057312304 9:93950035-93950057 CTGTGGAAAGGGAGGCCTGAGGG - Intergenic
1057374687 9:94509679-94509701 CAGTGGATCTCAAGAGCTGAAGG - Intergenic
1059652770 9:116331308-116331330 CTGGGAATATGGGTAGCTGATGG - Exonic
1060251634 9:121990942-121990964 CTGCAGCTATGGAGAGCGGATGG + Intronic
1061387947 9:130301485-130301507 CTCTGGGTTTGGAGAGATGAGGG + Intronic
1185479572 X:435837-435859 CTGGGAAAATGCAGAGCTGAGGG + Intergenic
1185936159 X:4258662-4258684 ATGTAGAGAAGGAGAGCTGATGG - Intergenic
1186630154 X:11340008-11340030 CTGTGGAGATGGAGAAGGGATGG - Intronic
1187066759 X:15847956-15847978 CTGTGGATAAGGAGCGAGGATGG - Intronic
1187567035 X:20461021-20461043 CTGTAGAGATGGAGAACAGATGG - Intergenic
1189783532 X:44539230-44539252 GTGTGGATCTGGAATGCTGAAGG - Intronic
1190322028 X:49185135-49185157 CTGTGGAACTGGAGTGCTGCTGG - Intronic
1195224015 X:102773610-102773632 CTGTGGAGATAGAGAGTAGAAGG - Intergenic
1197086072 X:122477283-122477305 CTTTGTATCTGGAGTGCTGATGG - Intergenic
1198146171 X:133859517-133859539 GTGTGGGTAGGGAGAGATGAAGG + Intronic
1198311640 X:135430529-135430551 TTGTGGAGATAGAGTGCTGAGGG + Intergenic
1198405061 X:136304127-136304149 CTGTAGATATGGAGAGCAGATGG + Exonic
1198720551 X:139614155-139614177 CTCTGGATATGGATGGCTCAGGG - Intronic
1199936312 X:152577028-152577050 CTGTGGATTTGGGTATCTGAGGG - Intergenic
1200088521 X:153623628-153623650 CTCTGGCTCTGGAGAGCTGAGGG - Intergenic
1200366462 X:155670957-155670979 CTGTGGATGTGGAAAGATTATGG - Intergenic
1201720473 Y:17090723-17090745 ATGTAGAGATGGAGAGCTGATGG - Intergenic