ID: 901911271

View in Genome Browser
Species Human (GRCh38)
Location 1:12460320-12460342
Sequence AAATCCAGGGCGCCTGCCAC TGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 121
Summary {0: 1, 1: 0, 2: 1, 3: 19, 4: 100}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
901911271_901911275 0 Left 901911271 1:12460320-12460342 CCAGTGGCAGGCGCCCTGGATTT 0: 1
1: 0
2: 1
3: 19
4: 100
Right 901911275 1:12460343-12460365 TGCATCAGAAACAGCCCAGGCGG 0: 1
1: 1
2: 0
3: 19
4: 203
901911271_901911278 25 Left 901911271 1:12460320-12460342 CCAGTGGCAGGCGCCCTGGATTT 0: 1
1: 0
2: 1
3: 19
4: 100
Right 901911278 1:12460368-12460390 AGAGACACAGCCACACTCAGCGG 0: 1
1: 0
2: 1
3: 71
4: 629
901911271_901911274 -3 Left 901911271 1:12460320-12460342 CCAGTGGCAGGCGCCCTGGATTT 0: 1
1: 0
2: 1
3: 19
4: 100
Right 901911274 1:12460340-12460362 TTTTGCATCAGAAACAGCCCAGG 0: 1
1: 0
2: 0
3: 19
4: 253

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
901911271 Original CRISPR AAATCCAGGGCGCCTGCCAC TGG (reversed) Exonic