ID: 901913858

View in Genome Browser
Species Human (GRCh38)
Location 1:12482265-12482287
Sequence CTGGATAAGGGGAGGCTGGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 494
Summary {0: 1, 1: 1, 2: 3, 3: 36, 4: 453}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
901913858_901913866 4 Left 901913858 1:12482265-12482287 CCACCCAGCCTCCCCTTATCCAG 0: 1
1: 1
2: 3
3: 36
4: 453
Right 901913866 1:12482292-12482314 AAGCCATTCCTGACTAAGCCTGG 0: 1
1: 0
2: 0
3: 12
4: 152

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
901913858 Original CRISPR CTGGATAAGGGGAGGCTGGG TGG (reversed) Intronic
900387621 1:2417734-2417756 CTGCCTTAGGGGAGGCTGTGTGG - Intergenic
900619046 1:3578602-3578624 CTGGATGCTGGGTGGCTGGGAGG - Intronic
900637475 1:3672984-3673006 CTGGGTATGAGGAGGGTGGGTGG - Intronic
900754014 1:4420991-4421013 CTGGATGAGGGCTGGCAGGGTGG - Intergenic
901078922 1:6572714-6572736 CTGGAAAAGGGGAGGAGAGGAGG - Intronic
901167285 1:7229596-7229618 CAGGAGGAGGGGAGGCTAGGAGG + Intronic
901227870 1:7624888-7624910 AAGGATAAAGGGAGGCTGGAAGG + Intronic
901689759 1:10965111-10965133 CTGAATGAGGGCAGCCTGGGAGG - Intronic
901913858 1:12482265-12482287 CTGGATAAGGGGAGGCTGGGTGG - Intronic
902514299 1:16981434-16981456 CTGGGTAATGGAAGGCTGCGGGG - Intergenic
902712368 1:18249246-18249268 TGGGATTAGGGGAGGGTGGGAGG + Intronic
902925325 1:19692250-19692272 CTCCATAGGGGGAGGCGGGGAGG - Intronic
903565979 1:24266182-24266204 ATGGATAGAGGGAGGGTGGGAGG + Intergenic
903668162 1:25020698-25020720 CTGCAAAAGCGGAGGCTGTGGGG + Intergenic
904335960 1:29798277-29798299 CTGGGGAAGAGGAGGCAGGGTGG - Intergenic
904625830 1:31801544-31801566 CTGGGGGAGGGCAGGCTGGGTGG + Intronic
904741939 1:32684200-32684222 CTGGCTGAGGGGATGGTGGGAGG - Exonic
905908726 1:41639258-41639280 CTGGCAAAGGGGTGGATGGGAGG + Intronic
905970558 1:42138693-42138715 CTGGGTATGGGGAGAGTGGGAGG - Intergenic
906101876 1:43269221-43269243 CTGGTGAAGGGCAGGCTGGCTGG - Intronic
906107371 1:43302839-43302861 CTGAACAAAGGCAGGCTGGGGGG + Intronic
906136887 1:43506262-43506284 ATGGATGAGGGGAGGCGGGGAGG - Intergenic
906515268 1:46435389-46435411 CTGGACAAGGGGAGGCCAGGTGG - Intergenic
907527250 1:55061040-55061062 CTGCATAGGGAGGGGCTGGGGGG + Intronic
910515338 1:88054197-88054219 CTGGAGCTGGGGAGGCAGGGAGG - Intergenic
910588244 1:88902013-88902035 CTGGAGAAGAGAAGGCAGGGTGG - Intergenic
911054162 1:93696563-93696585 ATGGAGAAGGGCAGGATGGGAGG - Intronic
911523613 1:98958882-98958904 GTGGAGAAGAGGAGGCTGAGAGG - Intronic
911670068 1:100597809-100597831 CTGGATAAGGGGATGGAGGATGG + Intergenic
915107858 1:153545675-153545697 AAGGAGAAGGGGAGGCTGGTGGG - Intronic
915565507 1:156710635-156710657 CTGGAGAAGAGGAGACTGAGAGG + Intergenic
915597051 1:156901860-156901882 CTGGAGCAGGGCAGGGTGGGAGG + Intronic
916570012 1:166016980-166017002 CAGGATAAGGGGAGGATGGCAGG - Intergenic
917638120 1:176956649-176956671 ATGGGTCAGGGGAGGCAGGGAGG - Intronic
918408926 1:184238259-184238281 CTGGATAAGGCCAGGCGTGGTGG - Intergenic
918918201 1:190671588-190671610 CTGGGAAAGAGGAGGCAGGGTGG + Intergenic
919777163 1:201201824-201201846 CTGTATAAGGTGAGGCTGGAGGG + Exonic
920244721 1:204579005-204579027 CTGGATCAGGGGAGGCTCCCAGG + Intergenic
920504909 1:206508598-206508620 TTGGATAAAGGCAGGCTGTGAGG + Intronic
920516261 1:206586497-206586519 CTGCATGTTGGGAGGCTGGGTGG + Intronic
921880273 1:220247590-220247612 CTCGATGAGGGGAGGTTGGGAGG + Intronic
922896301 1:229102970-229102992 CTGGATAAAATGGGGCTGGGGGG + Intergenic
923325301 1:232875357-232875379 TTGGGCAAGGGGAGGCTTGGGGG - Intergenic
923668428 1:236019172-236019194 CTGGAGCTGGGGAGGCTGTGGGG + Intronic
1062810054 10:456394-456416 CTGCCTGAGGGGAGGCTGTGAGG + Intronic
1062979765 10:1712454-1712476 CTGCATGAGGAGAGGCTGTGTGG + Intronic
1064659372 10:17591114-17591136 ATGGAGAAGAGGAGGCTGGGTGG - Intronic
1064785690 10:18892024-18892046 GTGGCGAATGGGAGGCTGGGTGG + Intergenic
1067216912 10:44310944-44310966 ATGGAGAAGGGGAGGGTGCGCGG + Intergenic
1067509394 10:46882724-46882746 CAAGATGAGGGGAGGTTGGGAGG + Intergenic
1067682960 10:48451744-48451766 GGGGATTTGGGGAGGCTGGGTGG - Intronic
1067726272 10:48773679-48773701 CAGGATGATGGGAGGGTGGGCGG + Intronic
1067775479 10:49161924-49161946 CAGGAGAGAGGGAGGCTGGGAGG - Intronic
1070553814 10:77513098-77513120 CTGGGTAGGGGGAGGCTGGCAGG - Intronic
1070792116 10:79195691-79195713 CTGGATTTGGGCAGGTTGGGTGG + Intronic
1073323837 10:102631268-102631290 ATGGATACAGGGAGGATGGGAGG - Exonic
1073918447 10:108432024-108432046 CTGGAGAAGAGAAGGCAGGGTGG + Intergenic
1073995841 10:109314427-109314449 CTGGAGAAGAGAAGGCAGGGTGG + Intergenic
1074581826 10:114726470-114726492 CAGGAGAAAGGGAGACTGGGGGG + Intergenic
1074700553 10:116088364-116088386 CTGGAGAAGGGGATGTTTGGTGG - Intronic
1074882394 10:117669196-117669218 CTGGGAAAGAAGAGGCTGGGAGG - Intergenic
1075717617 10:124566148-124566170 CTGGAGAAGGTGATGCTGGGAGG - Intronic
1076338663 10:129727965-129727987 CTGGAGCAGGGGAGGGTGTGAGG + Intronic
1076725259 10:132410147-132410169 CGGGGGACGGGGAGGCTGGGCGG + Intronic
1076797987 10:132808014-132808036 CCGGATGAGTGGGGGCTGGGGGG - Intergenic
1077010899 11:378880-378902 CTGGAAGAGGAGTGGCTGGGAGG + Intronic
1077104688 11:837094-837116 CGGCATGAGGGGAGGTTGGGTGG - Intronic
1077118849 11:897667-897689 CTGTGTGAAGGGAGGCTGGGAGG - Intronic
1077240750 11:1509204-1509226 CTGGGTCAGGGTTGGCTGGGTGG - Intergenic
1077376195 11:2205967-2205989 AGGGAGATGGGGAGGCTGGGAGG - Intergenic
1077376217 11:2206031-2206053 AGGGAGATGGGGAGGCTGGGAGG - Intergenic
1077499414 11:2902482-2902504 CGGGATGCAGGGAGGCTGGGGGG - Exonic
1077614068 11:3662440-3662462 GTGGATCAGAGGAAGCTGGGGGG - Intronic
1078210527 11:9265954-9265976 TGGGAAAAGGGCAGGCTGGGAGG - Intergenic
1078907880 11:15704372-15704394 CTGGAAAACTGGAGGGTGGGAGG - Intergenic
1079079032 11:17401254-17401276 CTTGAGAAGAGGAGGCTGGGAGG + Intronic
1079104922 11:17564437-17564459 CTGGGTAAGGAGAGGGAGGGAGG + Intronic
1081718602 11:45269044-45269066 CTGGAGAAGGGGAGGGTGGTAGG + Intronic
1081967885 11:47180441-47180463 CTGAAGGAGGTGAGGCTGGGTGG - Exonic
1082065906 11:47900085-47900107 CTGGGTGAGTAGAGGCTGGGTGG + Intergenic
1082794417 11:57369338-57369360 CTGGAGGAGGAGAGGCAGGGCGG - Intronic
1083201400 11:61123156-61123178 CAGGAGAGGGGAAGGCTGGGTGG - Intronic
1083230387 11:61314049-61314071 CTGCACAAGGAGATGCTGGGTGG - Exonic
1083664769 11:64268452-64268474 AGGGATGAGGGGATGCTGGGTGG - Intronic
1083687247 11:64383881-64383903 CAGGGTAAGGGGAGGCTGGATGG + Intergenic
1083729435 11:64644803-64644825 CTGGGAGAGAGGAGGCTGGGAGG + Intronic
1083749288 11:64752621-64752643 CTGGAGGAGGAGGGGCTGGGAGG - Intronic
1083763865 11:64832980-64833002 GTGGATGAGGTGAGGCTGGGAGG + Intronic
1084004363 11:66315270-66315292 TGGGATAATGGGAAGCTGGGTGG + Exonic
1084026888 11:66456155-66456177 CTGGAGCAGGGGAGGGAGGGAGG + Intronic
1084043755 11:66557341-66557363 ATGGACAGGAGGAGGCTGGGAGG - Intronic
1084667806 11:70585890-70585912 ATGGATGGGGGGAGGATGGGTGG - Intronic
1084954198 11:72682929-72682951 CAGGTGAAGGGGAGGCTGGGGGG - Intergenic
1085309398 11:75507227-75507249 GCGGACATGGGGAGGCTGGGTGG + Intronic
1088265445 11:107983863-107983885 CTGGAGAAGAGAAGGCAGGGTGG - Intergenic
1089055578 11:115582232-115582254 CTGGAGGTGGGGAGGCTGGGTGG + Intergenic
1089078747 11:115759683-115759705 CTGGAGAAGGGGACGCAGGGAGG - Intergenic
1089255878 11:117193649-117193671 CTGGATACATGGAGGCTGGGTGG + Intronic
1089442584 11:118529684-118529706 CTGGATAAGGGGCTCCTGGGAGG - Intronic
1090181492 11:124704128-124704150 CTGTGTGAGTGGAGGCTGGGTGG - Intergenic
1090395769 11:126416913-126416935 ACGGCTCAGGGGAGGCTGGGCGG + Intronic
1091300455 11:134503933-134503955 CTGGGGAGGAGGAGGCTGGGAGG + Intergenic
1091355971 11:134937917-134937939 AGGGATAAGGGCAGGGTGGGAGG + Intergenic
1091399990 12:175700-175722 CTGGAAAAAGGGAGGCGGGAAGG + Exonic
1092131985 12:6119201-6119223 CTGGAGGAGAGTAGGCTGGGAGG - Intronic
1092460310 12:8680453-8680475 CTAAATAAGGGGTGGCTGGCTGG - Intergenic
1092863218 12:12737600-12737622 CTGGAGAAGGGGAGGAGGAGAGG - Intronic
1093047171 12:14460711-14460733 CTGTAGAAGCTGAGGCTGGGAGG - Exonic
1093925267 12:24902981-24903003 CTGGCCATGGGGAGGCTGCGGGG + Exonic
1095158640 12:38889493-38889515 GTGGAGAAGGGGAGGGTGGTGGG + Intronic
1095952994 12:47791585-47791607 CTGGACAACGGGAAGCTGGCAGG - Exonic
1096989049 12:55783566-55783588 ATGATTTAGGGGAGGCTGGGGGG + Intronic
1099213960 12:79831287-79831309 ATTGAAAAGAGGAGGCTGGGTGG + Intronic
1100437418 12:94584359-94584381 CTGGTTCTGGGGAGGCTGCGGGG - Intronic
1101434800 12:104655420-104655442 CAGGATAAAGGGATGCTGGGGGG - Intronic
1101852748 12:108417352-108417374 CAGGATAAATTGAGGCTGGGAGG - Intergenic
1102192459 12:110999016-110999038 CTGATTTAGGAGAGGCTGGGAGG + Intergenic
1103936679 12:124480927-124480949 ATGGGTGAGGGGCGGCTGGGAGG + Intronic
1104896434 12:132167136-132167158 ATGGATAAGGGATGGGTGGGTGG - Intergenic
1104903435 12:132201414-132201436 GTGGATATTAGGAGGCTGGGGGG - Intronic
1105557411 13:21459533-21459555 CTGGATGCGGACAGGCTGGGCGG + Intergenic
1107720748 13:43245712-43245734 CTGTATAAGGGGAGCCTCAGAGG + Intronic
1108533546 13:51348687-51348709 CTGGATCAGGGGGTCCTGGGGGG - Intronic
1108702625 13:52956583-52956605 CTGGATGAGGGAAGGCAGAGAGG + Intergenic
1111878680 13:93928169-93928191 CTGGATAATGGGAGTATAGGTGG + Intronic
1112251135 13:97781722-97781744 CTGGGTCAGGGGAGGATGGAAGG + Intergenic
1113420242 13:110165503-110165525 CTGAAAACGGGGAGGCTGAGGGG - Intronic
1113942408 13:114025119-114025141 CCGGAGAAGGGGGGGCAGGGAGG - Intronic
1113955595 13:114098626-114098648 CGGGATGAGGGGAGGCAGGAAGG + Intronic
1114703693 14:24705038-24705060 CTGGGAAAGGGGAGGCTGCCAGG + Intergenic
1117003196 14:51392774-51392796 CTGGATATGGGAAGGTTTGGAGG + Intergenic
1117671948 14:58117057-58117079 CTGGAGAAGTGGAGGCAGGAGGG - Intronic
1117863647 14:60121788-60121810 CTTGACAAGAGCAGGCTGGGTGG - Intronic
1118780601 14:69005312-69005334 CTAGGGAAGGTGAGGCTGGGAGG - Intergenic
1119276305 14:73359874-73359896 TTGGATAAGGGGAGAGTCGGGGG - Intronic
1120160631 14:81141261-81141283 CTGGACAAGGGCTGGGTGGGAGG + Intronic
1121742780 14:96265865-96265887 CTGGATACGTGGAGACAGGGAGG + Intronic
1121785792 14:96660027-96660049 CAGGATCAGGGTAGGTTGGGTGG + Intergenic
1122098253 14:99386986-99387008 ATGGACAAGGGGAGACTGGAAGG + Intergenic
1122128711 14:99592964-99592986 CTGGAGAAAGGGTGGCTGGGTGG + Intronic
1122157568 14:99759420-99759442 CTGGCTGAGGGGTGGCTGAGTGG - Intronic
1122159654 14:99773942-99773964 TTGGAGGAGGGGCGGCTGGGCGG + Intronic
1122283485 14:100637882-100637904 CTGGATGGGGGGTGGCAGGGAGG + Intergenic
1122810168 14:104283774-104283796 CTGGGTGAGGGGAGCCGGGGTGG + Intergenic
1122865390 14:104601688-104601710 CTGGAAAAGAGCAGGCTGGGCGG + Intronic
1122931224 14:104933766-104933788 CTGAGTGAGGGGAGGGTGGGAGG + Exonic
1122931307 14:104933971-104933993 CTGAGTGAGGGGAGGGTGGGAGG + Exonic
1124364467 15:29062250-29062272 CTGCATACGGGGAGGCTGCACGG + Intronic
1125672055 15:41480871-41480893 CTGGGGGAGGGGAGGCTGGTGGG - Exonic
1125694273 15:41622030-41622052 CGGGGTAGGGGGAGGGTGGGGGG + Intronic
1127286198 15:57535795-57535817 CTGGAGAAGGGGCGACTGAGAGG + Intronic
1128330890 15:66754863-66754885 CTAGGTAAGGGGAGGCTGTGTGG + Intronic
1128387875 15:67163553-67163575 CTGGATGATGAGAGTCTGGGTGG - Intronic
1128614131 15:69096268-69096290 CAGTCTCAGGGGAGGCTGGGAGG - Intergenic
1128929688 15:71693109-71693131 CAGGATGTGGGGAGGGTGGGGGG + Intronic
1129187847 15:73921376-73921398 CTGGAGAAGGGGAGGTGGTGTGG - Intergenic
1129439583 15:75570683-75570705 CTTGATCCTGGGAGGCTGGGAGG + Intronic
1130290974 15:82600821-82600843 TTGGACAGGGGGAGGTTGGGTGG + Intronic
1131111977 15:89770163-89770185 CTGGATATGGAGAGGTGGGGAGG + Intronic
1132107108 15:99070980-99071002 GGGGGAAAGGGGAGGCTGGGAGG + Intergenic
1133170591 16:3980486-3980508 CTGCCTCAGGAGAGGCTGGGCGG + Intronic
1134106080 16:11486737-11486759 ATGGATAATGGGTGGGTGGGTGG + Intronic
1134106089 16:11486768-11486790 ATGGATAATGGGTGGGTGGGTGG + Intronic
1134106146 16:11486950-11486972 ATGGATAATGGGTGGGTGGGTGG + Intronic
1134224400 16:12380380-12380402 ATGGATGAGGGGTGGGTGGGTGG - Intronic
1134224411 16:12380407-12380429 ATGGATGAGGGGTGGGTGGGTGG - Intronic
1134224675 16:12381214-12381236 ATGGATGAGGGGTGGGTGGGTGG - Intronic
1134821512 16:17251178-17251200 TTGGATATGGGGATTCTGGGGGG - Intronic
1136226583 16:28864118-28864140 CCGGAAAATGGGCGGCTGGGGGG + Intronic
1136250972 16:29004857-29004879 CTGGGGAAGGGAAGGCAGGGTGG - Intergenic
1136602520 16:31303602-31303624 TTGGGGAAGGGGAGTCTGGGAGG - Intronic
1137496240 16:48971519-48971541 CTGGGGAGGGGGAGGCTGTGAGG - Intergenic
1138544191 16:57706296-57706318 CTGGATCAGAGGATGGTGGGAGG - Intronic
1140027236 16:71301732-71301754 ATGGAGAAGAGGAGGCTGGTAGG + Intergenic
1141054468 16:80803590-80803612 CTGCGAAGGGGGAGGCTGGGTGG - Intronic
1141110080 16:81265231-81265253 CTAGATAAGGGGTGGATAGGTGG - Intronic
1141616138 16:85210682-85210704 CTGTGTAAGTTGAGGCTGGGAGG + Intergenic
1141786110 16:86201880-86201902 CCGGGTGAGGAGAGGCTGGGTGG + Intergenic
1141856484 16:86684760-86684782 CTGGAGACGGGGAGAGTGGGGGG - Intergenic
1142348804 16:89570632-89570654 CTGCAAAAGGGCAGCCTGGGAGG + Intergenic
1142588339 17:988308-988330 CTGGGAAAGGGAAGGCAGGGTGG + Intergenic
1142711610 17:1726755-1726777 GGGGATGAGGGGAGGCTCGGGGG - Exonic
1142903832 17:3029429-3029451 CTGGATCAGGGTGGGCTTGGGGG + Intronic
1143002153 17:3801206-3801228 CTGGCTGAGGGGAAGCTGAGTGG - Exonic
1143036669 17:4003597-4003619 CCGGACAAGGTGAGGCGGGGAGG + Intergenic
1143377253 17:6474096-6474118 CAGGAGAAGGAGAGGGTGGGAGG + Intronic
1143763056 17:9118641-9118663 CTGGAAAGGGGGTGGGTGGGAGG - Intronic
1144317515 17:14076867-14076889 CTGGACAAAGATAGGCTGGGCGG - Exonic
1145294708 17:21578926-21578948 CTGGCTATGGGGTGGGTGGGAGG + Intergenic
1146905185 17:36613526-36613548 CTGGGGAAGGGGAGGCAGAGGGG - Intergenic
1147258260 17:39194864-39194886 CAGGTAATGGGGAGGCTGGGCGG - Exonic
1147263621 17:39222809-39222831 CAGGATATGGGGAGGTGGGGAGG - Intronic
1147318385 17:39631917-39631939 CTGGGTAGGGAGAGGCTGGGTGG + Intronic
1147624699 17:41892495-41892517 CTGGGGAAGGGGAAGCTGAGGGG + Intronic
1148186848 17:45650555-45650577 CTGGGGAGGGGGAGGATGGGGGG + Intergenic
1148479380 17:47950039-47950061 CTGCAGAAGGGGAAGTTGGGAGG - Intergenic
1149567909 17:57652695-57652717 CTGGCTAAGAAGAGTCTGGGAGG - Intronic
1150576663 17:66436672-66436694 CTTGATAAAGGGAGGATGAGTGG + Intronic
1151280461 17:73070378-73070400 TTGGATGAGGGAAGCCTGGGAGG - Intronic
1151347614 17:73511698-73511720 CTGGATACAGGGATCCTGGGAGG + Intronic
1151422927 17:74010192-74010214 CTGGTTAGGGACAGGCTGGGAGG + Intergenic
1152033563 17:77858280-77858302 TTGGATGAGGGGTGGGTGGGTGG - Intergenic
1152125683 17:78445200-78445222 TGGGAGGAGGGGAGGCTGGGGGG + Intronic
1152125693 17:78445219-78445241 GGGGAGGAGGGGAGGCTGGGGGG + Intronic
1152261656 17:79270469-79270491 CAGGAGAAGGGGAGGCATGGTGG - Intronic
1152608290 17:81303742-81303764 CAGGAAAGGGGGAGGGTGGGCGG - Intergenic
1152755385 17:82084980-82085002 CTGGGGATGGGGAGGCTGGTGGG + Intronic
1153219085 18:2846876-2846898 CTGGAGACGGGGAGACTTGGTGG + Intergenic
1153220382 18:2855581-2855603 CCGGAAAAGGGGAGGCAGGTGGG + Intronic
1153382235 18:4453937-4453959 CTAGAGAAGGGGAGGATGTGCGG - Intronic
1155200286 18:23511319-23511341 CTTGAGCAGGGGAGGGTGGGAGG + Intronic
1157010606 18:43644003-43644025 CTTGATAAGAAGAGTCTGGGAGG - Intergenic
1157795513 18:50570852-50570874 CTGGACAAAGGGAGCCTGAGTGG + Intronic
1157898087 18:51487337-51487359 CTGGAGAAGCTGAGGCTGAGTGG - Intergenic
1159014198 18:63088408-63088430 CTGGGTAACAGGAGGCTGGAGGG - Intergenic
1160006577 18:75073083-75073105 CTGGATATGGGGAGGCTGGTGGG + Intergenic
1160188016 18:76690651-76690673 CTGGGTGAGGGGAGCCAGGGAGG - Intergenic
1160319250 18:77875070-77875092 GTGGAGAGGTGGAGGCTGGGCGG - Intergenic
1160526663 18:79542592-79542614 ATGGATAATGGGTGGGTGGGTGG - Intergenic
1160756709 19:761249-761271 CTGGCTAAAGGGAGGCTGCTAGG + Intronic
1161000327 19:1907611-1907633 CTGGTGAACAGGAGGCTGGGAGG - Intronic
1161016518 19:1986281-1986303 CTGGATCAGGGCAGCCGGGGAGG - Exonic
1161084908 19:2330492-2330514 CAGCATAAGCGGGGGCTGGGAGG + Intronic
1161337637 19:3722841-3722863 CTGGAGATGGGGTGGCGGGGGGG + Intronic
1161692337 19:5743488-5743510 CTTGAGATGGGGAGGCAGGGAGG + Intronic
1162752816 19:12838945-12838967 AGGAAGAAGGGGAGGCTGGGGGG + Intronic
1162992847 19:14314596-14314618 GTGCAGAAGGGGAGGCTGGGTGG + Intergenic
1163441662 19:17325012-17325034 CTGGGCAGGGGGAGGCCGGGTGG + Exonic
1163478879 19:17542838-17542860 CAGGAAAAGAGGAGGCAGGGAGG + Intronic
1163751064 19:19078136-19078158 CTGTATATGGGGAGGCTGGAGGG + Intronic
1163769247 19:19180686-19180708 CTGGGTTGGCGGAGGCTGGGGGG + Exonic
1164619659 19:29687114-29687136 CTAGATATGGAGAGGCTGAGTGG + Intergenic
1164676358 19:30104247-30104269 CTGAGGAAGGGGAGGCAGGGGGG - Intergenic
1164936994 19:32222919-32222941 CTGGCTAAGAGGTGGCTGTGAGG + Intergenic
1165461825 19:35948449-35948471 CTGGAGGAGGGGAGGCCTGGCGG + Intergenic
1165463480 19:35958464-35958486 CTGGTTCTGAGGAGGCTGGGCGG + Intergenic
1165856369 19:38881069-38881091 GGGGATGCGGGGAGGCTGGGGGG + Intronic
1166014144 19:39967430-39967452 CTGGAAACAGGGAGGATGGGAGG + Intergenic
1166299401 19:41905665-41905687 CTGGAGGTGGGGAGGCAGGGAGG - Intronic
1166335607 19:42105015-42105037 CTGGGAAAGGGAAGGCAGGGTGG - Intronic
1166655784 19:44610715-44610737 CTGGATAAGGGAAGACTCTGGGG - Intergenic
1166810579 19:45512026-45512048 CTCGGGAAGTGGAGGCTGGGAGG + Intronic
1167245942 19:48373269-48373291 CTGGAGGTGGGGAGGCTGGGAGG + Intronic
1167608100 19:50492516-50492538 CAGGAAAAGGTGGGGCTGGGTGG + Intergenic
1167915187 19:52734651-52734673 CTGAGGAGGGGGAGGCTGGGAGG + Intronic
1167958508 19:53087215-53087237 CTGGAGCAGAGGGGGCTGGGAGG + Intronic
1168522145 19:57060902-57060924 CTGGAGCAGGGGAGGGTGGTGGG - Intergenic
1168608881 19:57783018-57783040 CTGTATAAGGCCAGGCTTGGTGG + Intronic
925017684 2:543914-543936 CAGGATGATGGGAGGCAGGGAGG + Intergenic
925281614 2:2689306-2689328 CTAGTTAATGGGAGGCTGTGAGG - Intergenic
925780008 2:7373364-7373386 CTGGATAAGGGGAATCTGTGAGG - Intergenic
926222165 2:10943379-10943401 CTGGCTAAGGGAAGGATCGGGGG + Intergenic
926625726 2:15088099-15088121 GTAGAGAAGGAGAGGCTGGGTGG + Intergenic
926715573 2:15921358-15921380 CTGGAGAAGGAGAGGCTCAGAGG + Intergenic
927192077 2:20523884-20523906 CTGGAAGGGAGGAGGCTGGGTGG - Intergenic
928379311 2:30803988-30804010 CAGTATAAGGGAAGGCTGTGGGG - Intronic
928613798 2:33016633-33016655 CTCGATGAGTGGAGGCTGAGTGG - Intronic
929493907 2:42422898-42422920 CTGGATAAGAGGAGGAAAGGGGG - Intronic
929807069 2:45155543-45155565 CTTAATAAGGGGTGGCGGGGGGG - Intergenic
931261835 2:60626777-60626799 ATGGGTAACAGGAGGCTGGGAGG - Intergenic
932416265 2:71575419-71575441 CAGGTCAAGGGGAGGCTGAGGGG + Intronic
932635728 2:73386184-73386206 CTGGAGAAGGTGAGGCGGGCCGG + Exonic
933861027 2:86467916-86467938 CTGGAGAAGCTGAGGCAGGGGGG + Intronic
935044567 2:99468672-99468694 CTGGATAAGGAGAGATTGGCAGG - Intronic
935708387 2:105876313-105876335 CTCGGTAAGGGCAGGATGGGAGG + Intronic
935899823 2:107779541-107779563 CTGGAGAACTGGAGGCCGGGTGG + Intergenic
937280953 2:120716886-120716908 TTGGACCAGGGGAGGCAGGGTGG - Intergenic
937309488 2:120893327-120893349 GTGGGGGAGGGGAGGCTGGGGGG - Intronic
937983504 2:127628318-127628340 CTGGATCAGGGGAAGGTGGAGGG + Intronic
938172172 2:129088842-129088864 CTGGAAAATGTGAGGCTGGGAGG - Intergenic
938262854 2:129907465-129907487 GTGGACCAGGGGATGCTGGGGGG + Intergenic
938514898 2:131993450-131993472 ATGGATAAAGGGAGGCAGGAGGG + Intergenic
940854250 2:158717471-158717493 CTGGGTGAGGTGAGGCTGCGGGG - Intergenic
941616494 2:167726367-167726389 CTGGACAAGGGGCAGGTGGGCGG - Intergenic
942005349 2:171694363-171694385 CTTGAAAAGAGGTGGCTGGGTGG + Intronic
942457104 2:176145819-176145841 GTGGTTAGGGAGAGGCTGGGTGG - Intergenic
943060844 2:183039862-183039884 CCTGAGAAGGGGAGGCTGCGAGG + Intergenic
945004958 2:205395167-205395189 CTGGGTAATGGTTGGCTGGGAGG - Intronic
945132795 2:206592248-206592270 CTGGCTAGGGAGTGGCTGGGAGG - Intronic
945953777 2:216066191-216066213 CTGGAGAAGGAGAGGAAGGGAGG - Intronic
946074925 2:217065836-217065858 CTGGAGAAGAGGAGGCTGGGAGG - Intergenic
946836301 2:223776101-223776123 TTGGATGAGGAGAGGCTCGGCGG - Intronic
948094453 2:235322262-235322284 CTGGAGAAGGGGTGACTTGGTGG - Intergenic
948576500 2:238955084-238955106 CTGGATAACCGCAGGCTGGAAGG + Intergenic
1168790781 20:574482-574504 CTGGATAAGGGAGGGTTGTGGGG + Intergenic
1168928795 20:1604668-1604690 CTGGATGAGTGGAGGGTGGTGGG + Intronic
1168969584 20:1921764-1921786 CTGGATGAGTGGAGGGTGGTGGG - Intronic
1169497559 20:6129824-6129846 CTGGGGAATGGGAGGCTGGATGG + Intergenic
1170736958 20:19021083-19021105 CTGGAGGAGGGGATGCTGTGTGG + Intergenic
1171215975 20:23352400-23352422 CTGGTAAAGGGCTGGCTGGGAGG - Intronic
1172122500 20:32607313-32607335 CTGGCCCAGGGGAGGCTGAGGGG - Intronic
1172147120 20:32764481-32764503 CAGGAAAAGGAGAGGCTGGCAGG - Intronic
1172271755 20:33659154-33659176 ATGGAGACAGGGAGGCTGGGGGG - Intronic
1172386208 20:34535857-34535879 CTGGATAAAGGAAGGCAGTGGGG + Intronic
1175028812 20:55931638-55931660 CTAGATAGGGGGAGGGAGGGAGG + Intergenic
1175426546 20:58870905-58870927 CAGGGTGAGGGTAGGCTGGGGGG - Intronic
1175841616 20:62031586-62031608 TAGGGTAGGGGGAGGCTGGGAGG - Intronic
1176027494 20:62993472-62993494 TGGGAGCAGGGGAGGCTGGGAGG + Intergenic
1176035063 20:63032122-63032144 CTGGATCAGAGGAGGGTGAGAGG + Intergenic
1176428594 21:6563148-6563170 CTGGAGAAGGTGGTGCTGGGGGG + Intergenic
1177976530 21:27858616-27858638 ATGGATAAAGGGAGGCAGGAGGG - Intergenic
1178976936 21:37228137-37228159 ATGGTTAAGAGGATGCTGGGGGG - Intronic
1179437197 21:41369929-41369951 CTGGCTAAAGGCAGGCTGAGGGG - Intronic
1179704084 21:43171464-43171486 CTGGAGAAGGTGGTGCTGGGGGG + Intronic
1181427820 22:22855722-22855744 CTGGGTCAGGGGAGTCTGGAGGG + Intronic
1182358742 22:29734580-29734602 CAGGAGAAGCGGGGGCTGGGAGG + Intronic
1183027594 22:35077365-35077387 CAGGAAAAGAGGAGGCTGTGAGG - Intronic
1183680350 22:39325017-39325039 CTGGATTAGGAGAGGATGGAAGG + Intergenic
1183732777 22:39627930-39627952 CTGGAAGAGGTGGGGCTGGGTGG + Intronic
1184040451 22:41940039-41940061 CTGGATCAGTGGAGCCTGGTGGG - Intronic
1184119542 22:42441103-42441125 CTGGAGAAGGGGAGGCTGGGTGG - Intergenic
1184662850 22:45973365-45973387 CAAGACAAGGGAAGGCTGGGCGG + Intronic
1185069953 22:48650793-48650815 CTGGGGGAGGGGAGGCTCGGTGG - Intronic
1185340451 22:50288591-50288613 CTGGATGAGGGGTGGCTGGGTGG - Intronic
1185370507 22:50458830-50458852 CTGGATTGGGGGATGCAGGGAGG + Intronic
949310773 3:2695414-2695436 CTGAAAAAGGTGAGGCTTGGGGG - Intronic
950287317 3:11755115-11755137 CAGGATGAGGGGAGGAGGGGAGG - Intergenic
950613571 3:14141357-14141379 CTGGATCAGGGTAGAGTGGGTGG + Intronic
950903056 3:16513953-16513975 CTTGATTAGGAGGGGCTGGGAGG - Intronic
951864754 3:27295233-27295255 GTGGATAAGGGGATATTGGGTGG - Intronic
958935202 3:100249327-100249349 CTTGAAAAGGGGAGCCTGAGTGG - Intergenic
959459247 3:106604413-106604435 ATGGGTCAGGTGAGGCTGGGTGG + Intergenic
959552608 3:107680009-107680031 TGGGATCAGGGAAGGCTGGGAGG + Intronic
960162418 3:114365099-114365121 GTGGGTAGGAGGAGGCTGGGAGG - Intronic
960854119 3:122085669-122085691 CAGGATGAGGGGAGGTGGGGTGG + Intronic
961262881 3:125616686-125616708 CTGGGTAAGAGAAGGCAGGGTGG - Intergenic
961339967 3:126211559-126211581 GTGGATAGGGGCAGGCTGGAGGG - Intergenic
961344222 3:126251877-126251899 CGAGAGAAGGGGAGGTTGGGAGG - Intergenic
961740296 3:129029117-129029139 TTGGAAAAGGGGAGGCCGAGTGG - Intronic
961822243 3:129580989-129581011 CAGCTTTAGGGGAGGCTGGGAGG - Intronic
962326876 3:134441758-134441780 CTGGGGAAGGGGAGGTGGGGAGG - Intergenic
962708487 3:138067054-138067076 CTGGATTTGGGGAGGCTGGAGGG + Intronic
963837413 3:150071054-150071076 CTGGACAAGGGGAGAGTGGCAGG + Intergenic
964851330 3:161099422-161099444 CTGCACAAGGGCAGGATGGGGGG + Intronic
965576512 3:170222827-170222849 CTGGAGGAGGGGAGGGTGAGGGG + Intronic
966469689 3:180275042-180275064 CTGGGTGAGGGCAGGCAGGGAGG + Intergenic
966812302 3:183857835-183857857 CTTGATAGGGGGAGGCAGTGTGG + Intronic
968152455 3:196347854-196347876 CTTGAAACGGGGAGGGTGGGGGG - Exonic
968267739 3:197375710-197375732 CAGGATAATAGGAGCCTGGGAGG + Intergenic
968375203 4:34380-34402 CTTGATGGGGGGAGGGTGGGAGG - Intergenic
968519153 4:1027935-1027957 CTGGAGTAGGGGAGGGTGGAAGG + Intergenic
968594600 4:1475914-1475936 ATGGATAGGTGGTGGCTGGGTGG + Intergenic
968613143 4:1566062-1566084 CTGCAGAGGGGGAGGCTCGGCGG + Intergenic
968687654 4:1972306-1972328 CTGGGAAAGGAGAGGCTGTGAGG + Intronic
968936532 4:3614039-3614061 CTGGAGAAGCTGAGGATGGGAGG - Intergenic
969053504 4:4387921-4387943 CTGGATCGCGGGATGCTGGGCGG + Intronic
969631791 4:8343254-8343276 CTGGATGAGGAGAAGCAGGGAGG + Intergenic
969665662 4:8555923-8555945 CTTGGCAAGGGGAGGCTGGCGGG + Intergenic
971137566 4:23886424-23886446 GTTGGTAAGGGGAGGATGGGGGG + Intronic
971478664 4:27095264-27095286 ATGGAGAAGGAGAGGCTGGTGGG - Intergenic
972339887 4:38142961-38142983 CTGGATATGGAGAGGCAGGCAGG - Intergenic
972612439 4:40668188-40668210 GTGGATGAGGTGAGGCTGTGAGG - Intergenic
974298802 4:60038644-60038666 TTGGAGAAGTGGAGGCTGAGTGG + Intergenic
975152611 4:71037128-71037150 CTTCTTAAGGGCAGGCTGGGGGG - Intergenic
976264809 4:83180528-83180550 CAGGGTAAGGGGAAGTTGGGGGG - Intergenic
981531725 4:145760831-145760853 TTGGGTGAGGGGATGCTGGGAGG + Exonic
982062858 4:151622179-151622201 CTAGAAAAGGGGAGTCTGAGAGG + Intronic
982287359 4:153748986-153749008 CTGGAGAAGGAGCAGCTGGGAGG + Intronic
983027422 4:162755549-162755571 CTGGGTGAGGGAAGGCAGGGTGG - Intergenic
983527398 4:168773245-168773267 ATAGATAAGGGCAGGCTCGGGGG - Intronic
983566898 4:169162939-169162961 CTGGGTAAGGAGAGGATGGAGGG - Intronic
983957582 4:173715867-173715889 CTGGTTGGGGGGAGGCTGGGCGG + Intergenic
984032696 4:174624477-174624499 ATGGGTAAGGGAAGGATGGGAGG + Intergenic
984822837 4:183898160-183898182 CTGGAGAAGGAGAGGGAGGGCGG - Intronic
985209074 4:187572582-187572604 CTGGATAAGAGTGGGCAGGGAGG + Intergenic
985459840 4:190094664-190094686 CTTGATGGGGGGAGGGTGGGAGG + Intergenic
985546539 5:512739-512761 CTGGAGAAGGCCAGGCTGAGGGG + Intronic
985616166 5:923177-923199 CAGGAGAAGGGGGTGCTGGGGGG + Intergenic
985709231 5:1418992-1419014 CTGGATGATGGATGGCTGGGTGG - Intronic
986291241 5:6400757-6400779 CTGGACAAGGGGTGGATGTGGGG - Intergenic
991013772 5:61910625-61910647 CTGGAGGAGGGAAGGCAGGGTGG + Intergenic
992494218 5:77276362-77276384 CTGGATGAGGTGATCCTGGGAGG - Intronic
992552146 5:77868988-77869010 GGGGAGAAGGGGAAGCTGGGTGG + Intergenic
992980000 5:82159383-82159405 CTGGATAAGTGGGAGCTAGGTGG + Intronic
994344131 5:98664705-98664727 CTGGTAATGGGGAGACTGGGTGG + Intergenic
994696633 5:103079873-103079895 CTGGATCCAGGGAGGCTGGATGG - Intergenic
998148966 5:139746409-139746431 CTGCAGAAGGCGGGGCTGGGGGG + Intergenic
998169487 5:139864116-139864138 CTGGAGAAGAGGAGGTCGGGGGG + Intronic
999427595 5:151501010-151501032 CAGGAGAATGGGAGGCAGGGAGG + Intergenic
999622888 5:153490441-153490463 GAGGATAAGGTGAGGATGGGAGG + Intronic
999755151 5:154658730-154658752 CTGGAGAAGGAGGGGCTGCGAGG - Intergenic
1000632651 5:163608337-163608359 CCGGAGCAGGGGAGGCAGGGTGG - Intergenic
1001586400 5:172835954-172835976 CTGGGTAAGGGGAGGCTTTGTGG - Intronic
1001663463 5:173413474-173413496 CTGGGTGAGGGGATGGTGGGGGG + Intergenic
1002853316 6:1015880-1015902 CTGTATAAGGGGTGGCTGCAGGG + Intergenic
1003695870 6:8405888-8405910 CTGGAGGAGGGAAGGCAGGGTGG + Intergenic
1004075392 6:12340030-12340052 GTGGAGCCGGGGAGGCTGGGCGG + Intergenic
1006071015 6:31498079-31498101 CTGGATAAGCGGTCGCTGAGCGG + Intronic
1007371084 6:41427542-41427564 CTGGGAGAGGGGAAGCTGGGGGG + Intergenic
1008288870 6:49687853-49687875 CTGGATTGGGGCAGGCTTGGGGG + Intergenic
1008437783 6:51496458-51496480 CTGGAGAAGGGGATACTGGCAGG - Intergenic
1008561048 6:52725044-52725066 TTGGAGAAGAGAAGGCTGGGTGG - Intergenic
1008760619 6:54847719-54847741 CTTTATAGGAGGAGGCTGGGAGG + Intronic
1010323610 6:74540751-74540773 CTGGAGAAGAGAAGGCAGGGTGG - Intergenic
1012144844 6:95668524-95668546 CTGGATAAGGCTAGGCTAGTAGG - Intergenic
1013155690 6:107489925-107489947 CTGGATACGCGGATGCTGCGCGG - Intergenic
1013170958 6:107635811-107635833 TTGGAGAAGAGGAGGATGGGGGG + Intronic
1014307897 6:119765394-119765416 TTGGATAAGGGGAAGGAGGGTGG + Intergenic
1014679883 6:124415394-124415416 ATGGATAAGGCGAGGCATGGGGG + Intronic
1016843042 6:148543814-148543836 CAGGAGGAGGGCAGGCTGGGTGG + Exonic
1016909109 6:149179395-149179417 GTGGAGAAGGTGAGGCAGGGAGG + Intergenic
1017532929 6:155314627-155314649 CGCGAGAAGGGCAGGCTGGGTGG + Intergenic
1018036588 6:159887455-159887477 ATGATTGAGGGGAGGCTGGGGGG + Intergenic
1018312482 6:162525359-162525381 CAGGCTCAGGGGAGGTTGGGTGG - Intronic
1018586079 6:165360626-165360648 CTGGGGAAGAGGTGGCTGGGAGG + Intronic
1018640095 6:165897627-165897649 CTGGAGGTGGGGGGGCTGGGGGG - Intronic
1018647130 6:165959290-165959312 CTGGATAGGGTGGGGATGGGAGG + Intronic
1019493710 7:1326601-1326623 CTGGAGGAGGGCGGGCTGGGGGG - Intergenic
1019528921 7:1494103-1494125 CTGGACAAGGGGAGAAGGGGAGG + Intronic
1021256035 7:18393529-18393551 ATGGATGAGGTGAGGCAGGGAGG + Intronic
1021582785 7:22174794-22174816 CTGGATAAGGGAAGGATAAGGGG + Intronic
1022310745 7:29194301-29194323 CTGGACAGGGGGAGGCGGGACGG - Intronic
1022511222 7:30935880-30935902 CTGGGGAAGGGGAGGGTTGGTGG + Intergenic
1023780565 7:43651525-43651547 CTGGCTGAGGGGAGGCTGACAGG - Intronic
1023955129 7:44879456-44879478 CTGGATAATGGGTGTGTGGGTGG - Exonic
1024859623 7:53823572-53823594 CTGGTGAAAGGGAGACTGGGTGG + Intergenic
1026464856 7:70645226-70645248 ATGAATGAGGGGAGGTTGGGAGG - Intronic
1026638945 7:72107537-72107559 CTGGAGAAGGGGACTCTGGGTGG - Intronic
1026685837 7:72509401-72509423 CTGGATAAGGCCAGGCGCGGTGG - Intergenic
1028709389 7:93890491-93890513 CTGGAGAAAGCGAGGCTTGGAGG + Intronic
1029191642 7:98776223-98776245 CTGACTAAGGGAAGGCAGGGCGG - Intergenic
1029306712 7:99625017-99625039 CAGGATAAGGAAAGGCTAGGTGG - Intronic
1031097954 7:117443508-117443530 TTGGATCAGGGGAGGGTGTGAGG + Intergenic
1032331321 7:130983201-130983223 CTGAATAAAGGGATGCTGAGGGG + Intergenic
1032352372 7:131176946-131176968 CTGGAAAATGCTAGGCTGGGAGG + Intronic
1032496824 7:132368979-132369001 CTGAATTAGGGGAGGGTGGATGG - Intronic
1032840364 7:135708361-135708383 CTGGCGAAGGGGAGGCAGGGGGG + Intronic
1034256220 7:149725973-149725995 CTGGATGAGGAGAAGCTGGTGGG - Exonic
1034888114 7:154814508-154814530 CAGGACAGGGGAAGGCTGGGTGG + Intronic
1034904212 7:154929696-154929718 CTGGAGAAGGGAGGGCTGGTGGG - Intronic
1035583875 8:757299-757321 CTGGATGAGGGCAGGTTGGCTGG - Intergenic
1035797943 8:2376470-2376492 CTGGTGAAGGGGAAGCTGGCAGG + Intergenic
1035946511 8:3969280-3969302 CTGCAAAAGATGAGGCTGGGTGG + Intronic
1036213804 8:6863270-6863292 GTGGAAGAGGGGAGGCTGGCGGG + Intergenic
1037951332 8:23020088-23020110 CAGGAGGAGGGGAGGTTGGGGGG + Intronic
1038453653 8:27657079-27657101 CTGGAGCAGGGGATTCTGGGTGG + Intronic
1038828363 8:31032491-31032513 CTGGATAGGGAGAGGCCGGCAGG - Exonic
1039289392 8:36077575-36077597 CTGGCTCAGGAGAGCCTGGGGGG - Intergenic
1041586142 8:59522087-59522109 GTGGAGAGGGGGAGGGTGGGTGG + Intergenic
1042601678 8:70504963-70504985 CTGGATAAGGAAGGGCTGGGAGG + Intergenic
1044678690 8:94755380-94755402 CTGGTTAAGGGAAGGGAGGGTGG + Intronic
1044860785 8:96521478-96521500 CTGGATCAGGGCAGCCTTGGAGG + Intronic
1049250131 8:141583777-141583799 CTGGGTCTGGGGAGGCAGGGGGG + Intergenic
1049283901 8:141764281-141764303 CTGGTGAAGGGAGGGCTGGGAGG + Intergenic
1049533987 8:143169593-143169615 GTGCATAAGGACAGGCTGGGAGG - Intergenic
1049687953 8:143946511-143946533 CTGACTAAGGGGTGGCTGCGAGG - Intronic
1051323437 9:15936635-15936657 CAGGTTAAGGGGAGGTGGGGAGG - Intronic
1053148391 9:35727539-35727561 CTGGAACTGGGGAGACTGGGAGG - Intronic
1053314686 9:37041351-37041373 CTGGAAAGGGGGAGGCTGGAGGG + Intergenic
1053533610 9:38905121-38905143 CTGAATGAGGGGAGCCTGGCAGG - Intergenic
1053789550 9:41677104-41677126 CTATGTAGGGGGAGGCTGGGAGG - Intergenic
1054155593 9:61637648-61637670 CTATGTAGGGGGAGGCTGGGAGG + Intergenic
1054177888 9:61888795-61888817 CTATGTAGGGGGAGGCTGGGAGG - Intergenic
1054205834 9:62129550-62129572 CTGAATGAGGGGAGCCTGGCAGG - Intergenic
1054475362 9:65568658-65568680 CTATGTAGGGGGAGGCTGGGAGG + Intergenic
1054632526 9:67458820-67458842 CTGAATGAGGGGAGCCTGGCAGG + Intergenic
1054659641 9:67692029-67692051 CTATGTAGGGGGAGGCTGGGAGG + Intergenic
1056878227 9:90359576-90359598 CAGGATCAGGGATGGCTGGGAGG - Intergenic
1056935298 9:90911534-90911556 CTGCAACAGTGGAGGCTGGGGGG + Intergenic
1057329635 9:94101404-94101426 CTGGAAGTGGAGAGGCTGGGAGG + Intronic
1059086961 9:111313945-111313967 CAGGAAAAGGGCAGGCTTGGTGG - Intergenic
1059341236 9:113598680-113598702 ATGAGTAAGGGGAGGCAGGGAGG - Intergenic
1059550564 9:115224987-115225009 CTGGATAATGGTTGGCTGTGGGG - Intronic
1061375720 9:130223151-130223173 ATGGATAAGGTGAGGTGGGGGGG + Exonic
1062423711 9:136496596-136496618 CTGCACCAGGTGAGGCTGGGTGG + Exonic
1062520861 9:136957313-136957335 TTGGATAATGGGTGGGTGGGTGG + Intronic
1062552925 9:137098382-137098404 CTGGAGAACGGGAGGGTGAGTGG - Intronic
1062568305 9:137172968-137172990 CCAGAGGAGGGGAGGCTGGGAGG - Intergenic
1062636307 9:137493431-137493453 CAGGACAAGGGCAGGCTGGCAGG + Intronic
1203574021 Un_KI270744v1:159770-159792 CTTGATGGGGGGAGGGTGGGAGG + Intergenic
1186313771 X:8347122-8347144 CCAGAACAGGGGAGGCTGGGAGG + Intergenic
1186666114 X:11719404-11719426 CTGGAAAAGGTAATGCTGGGTGG + Intergenic
1186724818 X:12345654-12345676 GTGGATACTGGGAGACTGGGAGG + Intronic
1187169279 X:16835681-16835703 CTGGATAAGAGGACTCTGAGTGG - Intronic
1187581097 X:20608343-20608365 ATAGAAAAGGGGAGGCTAGGTGG - Intergenic
1189625792 X:42895411-42895433 CTGGATAAGAAGATGCTGTGAGG + Intergenic
1190739439 X:53279762-53279784 GGGGAAAAGGGAAGGCTGGGAGG + Intronic
1191226015 X:58043874-58043896 CTGGAGATGGAGTGGCTGGGAGG + Intergenic
1192175282 X:68881210-68881232 CAGGAGATGGGAAGGCTGGGGGG + Intergenic
1192451713 X:71248948-71248970 CTGGAAGAGGGGAGTATGGGAGG + Intronic
1192502995 X:71665474-71665496 CTGGAAGAGAGGAGGCTGGGGGG + Intergenic
1192951932 X:76026425-76026447 CTGGAGCTGGGGAGGCTGGACGG + Intergenic
1193799477 X:85917289-85917311 ATGGGTCAAGGGAGGCTGGGAGG + Intronic
1194445873 X:93986702-93986724 CTGGAGCAGGGGATGCTGGATGG + Intergenic
1195466647 X:105186490-105186512 TTGGATAAGGTGAGACAGGGAGG + Intronic
1196812533 X:119640144-119640166 CTGGATAGTGGGAGGGTGGGAGG - Intronic
1197160156 X:123313876-123313898 CTGGAGAAGGGGCAGCAGGGTGG + Intronic
1197903090 X:131394296-131394318 ATAGAGAAGGGGAGGCTGGATGG - Intronic
1198117227 X:133555912-133555934 CTGAAAAAGGGGAACCTGGGAGG - Intronic
1198577539 X:138026303-138026325 CTGGAGAGGGGGAGACTTGGAGG - Intergenic
1199341271 X:146680061-146680083 CTGGATACAGGGAGGGAGGGTGG - Intergenic
1200787513 Y:7273659-7273681 CGGAAGATGGGGAGGCTGGGTGG - Intergenic
1202092523 Y:21208840-21208862 CTGGAGCAAGGGAGGCTGGAGGG + Intergenic
1202149247 Y:21829806-21829828 CAGGATGAAGGGAGACTGGGAGG + Intergenic