ID: 901921100

View in Genome Browser
Species Human (GRCh38)
Location 1:12538262-12538284
Sequence ACAGCTGCACACACCATCCA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
901921095_901921100 -8 Left 901921095 1:12538247-12538269 CCCCTCTGCTTGCCCACAGCTGC No data
Right 901921100 1:12538262-12538284 ACAGCTGCACACACCATCCATGG No data
901921096_901921100 -9 Left 901921096 1:12538248-12538270 CCCTCTGCTTGCCCACAGCTGCA No data
Right 901921100 1:12538262-12538284 ACAGCTGCACACACCATCCATGG No data
901921094_901921100 -3 Left 901921094 1:12538242-12538264 CCAAACCCCTCTGCTTGCCCACA No data
Right 901921100 1:12538262-12538284 ACAGCTGCACACACCATCCATGG No data
901921097_901921100 -10 Left 901921097 1:12538249-12538271 CCTCTGCTTGCCCACAGCTGCAC No data
Right 901921100 1:12538262-12538284 ACAGCTGCACACACCATCCATGG No data
901921093_901921100 -2 Left 901921093 1:12538241-12538263 CCCAAACCCCTCTGCTTGCCCAC No data
Right 901921100 1:12538262-12538284 ACAGCTGCACACACCATCCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
901921100 Original CRISPR ACAGCTGCACACACCATCCA TGG Intergenic
No off target data available for this crispr