ID: 901923715

View in Genome Browser
Species Human (GRCh38)
Location 1:12553073-12553095
Sequence CACATTGAAGAGCACATAAT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
901923715_901923720 2 Left 901923715 1:12553073-12553095 CCCATTATGTGCTCTTCAATGTG No data
Right 901923720 1:12553098-12553120 CTATCCCGAGCCCGGAGCCCTGG No data
901923715_901923718 -6 Left 901923715 1:12553073-12553095 CCCATTATGTGCTCTTCAATGTG No data
Right 901923718 1:12553090-12553112 AATGTGGCCTATCCCGAGCCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
901923715 Original CRISPR CACATTGAAGAGCACATAAT GGG (reversed) Intergenic
No off target data available for this crispr