ID: 901924872

View in Genome Browser
Species Human (GRCh38)
Location 1:12559866-12559888
Sequence CCTCCTGGAGTCACACAGCC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
901924869_901924872 -7 Left 901924869 1:12559850-12559872 CCAGAGAAGTCGGTGACCTCCTG No data
Right 901924872 1:12559866-12559888 CCTCCTGGAGTCACACAGCCAGG No data
901924867_901924872 7 Left 901924867 1:12559836-12559858 CCTAGTAGTTCAAACCAGAGAAG No data
Right 901924872 1:12559866-12559888 CCTCCTGGAGTCACACAGCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
901924872 Original CRISPR CCTCCTGGAGTCACACAGCC AGG Intergenic
No off target data available for this crispr