ID: 901926694

View in Genome Browser
Species Human (GRCh38)
Location 1:12570748-12570770
Sequence TAGGAGCCCCTAGTTGATCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 112
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 104}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
901926694_901926701 17 Left 901926694 1:12570748-12570770 CCCTGATCAACTAGGGGCTCCTA 0: 1
1: 0
2: 0
3: 7
4: 104
Right 901926701 1:12570788-12570810 TCTCAGACCCGAGGTCAGGATGG 0: 1
1: 0
2: 2
3: 10
4: 114
901926694_901926703 24 Left 901926694 1:12570748-12570770 CCCTGATCAACTAGGGGCTCCTA 0: 1
1: 0
2: 0
3: 7
4: 104
Right 901926703 1:12570795-12570817 CCCGAGGTCAGGATGGACTGAGG 0: 1
1: 0
2: 1
3: 15
4: 160
901926694_901926705 25 Left 901926694 1:12570748-12570770 CCCTGATCAACTAGGGGCTCCTA 0: 1
1: 0
2: 0
3: 7
4: 104
Right 901926705 1:12570796-12570818 CCGAGGTCAGGATGGACTGAGGG 0: 1
1: 0
2: 1
3: 12
4: 130
901926694_901926706 28 Left 901926694 1:12570748-12570770 CCCTGATCAACTAGGGGCTCCTA 0: 1
1: 0
2: 0
3: 7
4: 104
Right 901926706 1:12570799-12570821 AGGTCAGGATGGACTGAGGGAGG 0: 1
1: 0
2: 1
3: 48
4: 415
901926694_901926699 8 Left 901926694 1:12570748-12570770 CCCTGATCAACTAGGGGCTCCTA 0: 1
1: 0
2: 0
3: 7
4: 104
Right 901926699 1:12570779-12570801 TGAGGAGCATCTCAGACCCGAGG 0: 1
1: 0
2: 1
3: 9
4: 125
901926694_901926697 -10 Left 901926694 1:12570748-12570770 CCCTGATCAACTAGGGGCTCCTA 0: 1
1: 0
2: 0
3: 7
4: 104
Right 901926697 1:12570761-12570783 GGGGCTCCTAGAGACGGCTGAGG 0: 1
1: 0
2: 1
3: 6
4: 131
901926694_901926700 13 Left 901926694 1:12570748-12570770 CCCTGATCAACTAGGGGCTCCTA 0: 1
1: 0
2: 0
3: 7
4: 104
Right 901926700 1:12570784-12570806 AGCATCTCAGACCCGAGGTCAGG 0: 1
1: 0
2: 0
3: 10
4: 95

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
901926694 Original CRISPR TAGGAGCCCCTAGTTGATCA GGG (reversed) Intronic
901647631 1:10725126-10725148 TAGGATTCCCTAGTTGGCCAGGG + Intronic
901926694 1:12570748-12570770 TAGGAGCCCCTAGTTGATCAGGG - Intronic
902116946 1:14129047-14129069 TAGGAGGCCTTGGTTGAGCAAGG - Intergenic
902971136 1:20051853-20051875 CAGGAGCCCCAAGTTTATCTTGG + Intronic
911505239 1:98740987-98741009 TTGGAGCCCTTAAATGATCAGGG + Intronic
915672545 1:157502590-157502612 TAGGAGCTCCAAGTTTATCTTGG + Intergenic
916073221 1:161184043-161184065 TAGGTGCCCCTCCTTGATCATGG + Intergenic
917077019 1:171215976-171215998 TAGGAGCTCCAAGTTTATCTTGG - Intergenic
917209684 1:172619145-172619167 TAGGAGCTCCAAGTTAATCTTGG + Intergenic
917691241 1:177471577-177471599 TAGGAGACCCTAGATGAGAAAGG - Intergenic
923893978 1:238248630-238248652 TAGGACCGCCGAGTTGATGATGG - Intergenic
924929550 1:248716757-248716779 CAGGAGCCCCAAGTTTATCTTGG + Intergenic
1063341127 10:5263956-5263978 CAGGAGCCCCAAGTTTATCTTGG - Intergenic
1065182157 10:23137078-23137100 TAGGAGCCCATAGGTCATCTTGG + Intergenic
1071012531 10:80954847-80954869 TAGGAGCTCCAAGTTTATCTTGG - Intergenic
1071689544 10:87802361-87802383 CAGGAGCCCCAAGTTTATCTTGG + Intronic
1072363756 10:94687851-94687873 AAGGAGGCCCTGATTGATCATGG + Exonic
1073679448 10:105686476-105686498 TAGGAGCCCGTAGGTCATCTTGG + Intergenic
1074500154 10:114016554-114016576 TAGAAGCCACCAGTTGGTCAAGG - Intergenic
1080914327 11:36639949-36639971 TAAGAGTCCCTAGTCGTTCAGGG - Intronic
1084709258 11:70833957-70833979 AAGGAGCTCCAAGTTGATGAAGG + Intronic
1086296258 11:85371707-85371729 TAGGAGCTCCAAGTTTATCTTGG + Intronic
1087486096 11:98761574-98761596 TAGGAGCTCCAAGTTTATCTTGG + Intergenic
1092830510 12:12440075-12440097 TAGGGACCTCTAGTTGATCCCGG - Intronic
1092907494 12:13115251-13115273 AACCAGCCCCTAGTGGATCAGGG + Intronic
1095516396 12:43011061-43011083 TAGGAGACACTAGTTGTTCATGG - Intergenic
1102224103 12:111215832-111215854 TGGGAGCCCCCAGGTGATGAGGG + Intronic
1104524976 12:129512642-129512664 ACCTAGCCCCTAGTTGATCACGG - Intronic
1105886781 13:24649332-24649354 TTAGAGCCCCCAGTTGATCCCGG - Intergenic
1108500221 13:51063561-51063583 TAGGAGCCCCGAGTTGCGGAAGG - Intergenic
1111539999 13:89657283-89657305 TAGGAGCCCCAGGTTCATAAAGG - Intergenic
1113877664 13:113604737-113604759 TAGGAGCCCCTCTTTGTTCCAGG + Intronic
1118699556 14:68419875-68419897 TAGGGTCCCATAGTTGATAATGG + Intronic
1118938769 14:70313262-70313284 CAGGAGCCCCAAGTTTATCTTGG + Intergenic
1120314172 14:82870965-82870987 TAGGAGCTCCAAGTTTATCTTGG + Intergenic
1128002401 15:64205562-64205584 TAGGAGCCCACTGTTGATCCAGG - Intronic
1135225250 16:20650355-20650377 AAGGTGCCCCTGGGTGATCAGGG + Intronic
1135905894 16:26511477-26511499 TAGGAGCCACGAGTTGAAGATGG - Intergenic
1146039295 17:29435551-29435573 TAGGAGCTCCAAGTTTATCTTGG - Intronic
1146441488 17:32899368-32899390 CAGGAGCCCCAAGTTTATCTTGG - Intergenic
1147513376 17:41093490-41093512 CAGGAGCCCCAAGTTTATCTTGG + Intronic
1147515468 17:41113785-41113807 CAGGAGCCCCAAGTTTATCTTGG + Intergenic
1148525707 17:48331118-48331140 TAATAGCCCCTTGTTCATCAAGG - Intronic
1148552268 17:48557560-48557582 TAGGTACCCCCAGTTTATCAGGG - Intronic
1149094633 17:52825733-52825755 TAGGAGCTCCCAGTTTATCTTGG - Intergenic
1149104160 17:52942435-52942457 TACCAGTCCCTAGTTGAACATGG - Intergenic
1151548703 17:74808907-74808929 CAGGAGCCCCCAGTGGGTCATGG + Intronic
1155784703 18:29881672-29881694 TAGGAGCTCCAAGTTTATCTTGG - Intergenic
1156698642 18:39797265-39797287 TAGGAGCTCCAAGTTTATCTTGG - Intergenic
1157821960 18:50778514-50778536 TAGGAGCTCCAAGTTTATCTTGG + Intergenic
1158152036 18:54384196-54384218 TAGGAGCTCCAAGTTTATCTTGG - Intronic
1160249639 18:77190461-77190483 GAGGAGCCCCTGATTGATCAGGG + Intergenic
1163176044 19:15564559-15564581 TAGAAGCCCCCAGTAGAACAAGG - Intergenic
1165544898 19:36527200-36527222 TAGGAGTACTTAGATGATCAAGG + Intronic
929236416 2:39610037-39610059 TAGGAGCCCTGAGGTGAACATGG + Intergenic
934108489 2:88718499-88718521 TAGGAGGCCCAAGTTTATCTTGG - Intronic
935039035 2:99407779-99407801 TATTAGCCCCTGGTTAATCAGGG + Intronic
935153273 2:100459279-100459301 CAGGAGCCCCAAGTTTATCTTGG + Intergenic
937742977 2:125377605-125377627 TAGGAGCCCAGAGGTTATCAGGG - Intergenic
939262454 2:139828288-139828310 TTGCAGCCCCTAGATGCTCAAGG + Intergenic
943598165 2:189882105-189882127 CAGGAGCCCCAAGTTTATCTTGG - Intronic
949029091 2:241780806-241780828 CAGGAGCCCCAAGTTTATCTTGG - Intronic
1178619733 21:34163113-34163135 TAGGAGCTCCAAGTTTATCTTGG - Intergenic
1180915171 22:19480609-19480631 TGGGAGCCCCTAGTCTATTAGGG + Intronic
1180938730 22:19642979-19643001 CAGGAGCCCCTCCTTGATCCAGG - Intergenic
950391467 3:12700202-12700224 TAGGACCCACTAGTTGACCCTGG + Intergenic
950919124 3:16676438-16676460 CAGGAGCCCCAAGTTTATCCTGG + Intergenic
951297989 3:20962784-20962806 CAGGAGCCCCAAGTTTATCTCGG + Intergenic
954967715 3:54625869-54625891 TAGGACCCCCAAAATGATCACGG - Intronic
965565466 3:170112037-170112059 TAGGAGCATCTTTTTGATCATGG - Intronic
968294666 3:197566404-197566426 CAGGAGCCCCAAGTTTATCTTGG + Intronic
971913281 4:32824532-32824554 CAGGAGCCCCAAGTTCATCTTGG - Intergenic
975001272 4:69225321-69225343 TCGGAGCCCCTACTTGACCCAGG + Intergenic
975012575 4:69375926-69375948 TCGGAGCCCCTACTCGACCAAGG - Intronic
976345168 4:83992225-83992247 TAGGAGCTCCAAGTTTATTATGG + Intergenic
979388479 4:120098806-120098828 TAGGAACCCCTAGTTACTTATGG + Intergenic
980071556 4:128247783-128247805 CAGGAGCCCCAAGTTTATCTCGG - Intergenic
980511408 4:133793258-133793280 TAAGAGCTCCTAGTTGCTTATGG - Intergenic
985903278 5:2813723-2813745 TGCAAGCCCCTAGTGGATCAGGG - Intergenic
986213594 5:5697544-5697566 TAGGAGCTCCAAGTTTATCTTGG + Intergenic
987957909 5:24763966-24763988 TTCAAGACCCTAGTTGATCAAGG + Intergenic
990100621 5:52181683-52181705 TAGGAGCTCATTGTTTATCAAGG + Intergenic
990595155 5:57305543-57305565 TGGCAGCCCCCAGTTCATCAAGG - Intergenic
992292890 5:75298424-75298446 CAGGAGCCCCAAGTTTATCTTGG + Intergenic
995538807 5:113164462-113164484 TAGGGGCCCCTGGGCGATCAAGG - Intronic
998418126 5:141960124-141960146 TAGGAGCCCCTGGGAGCTCAGGG + Intronic
1005322683 6:24670366-24670388 CAGGAGCCCCTGGTTTATCATGG - Intronic
1009908041 6:69892676-69892698 TAGGAGCTCCAAGTTTATTATGG - Intronic
1018698283 6:166407457-166407479 TAGGAAACCCTAATTGTTCATGG - Intergenic
1019123100 6:169820770-169820792 CAGGAGCCCCAAGTTTATCTTGG + Intergenic
1020626378 7:10585773-10585795 TAGCAGCCCCCAGTTGCTGATGG - Intergenic
1020677065 7:11195699-11195721 TAGGAGCTCCCAGTTTATCTTGG + Intergenic
1023336628 7:39177330-39177352 CAGGTGCCCCCACTTGATCACGG - Intronic
1024128267 7:46323200-46323222 TAGGAGACCCTAACTGATGAGGG - Intergenic
1025758092 7:64364168-64364190 CAGGAGCCCCAAGTTTATCTTGG - Intergenic
1031957174 7:127954421-127954443 TCGGAGCCACTATTTAATCAAGG - Intronic
1037111333 8:15167420-15167442 TAGGAGCTCCAAGTTCATCTTGG + Intronic
1039859161 8:41441573-41441595 AAGGTGCCCTTTGTTGATCAGGG + Intergenic
1045304618 8:100948713-100948735 TAGGAGCCCGTAGGTCATCTTGG - Exonic
1052206880 9:25853348-25853370 CAGGAGCCCCTAGTTTATCCTGG + Intergenic
1053046389 9:34922745-34922767 TAGGAGCCCGTAGGTCATCTTGG - Intergenic
1058997283 9:110312509-110312531 CAGGAGCCCCAAGTTTATCATGG + Intronic
1186682365 X:11889231-11889253 GAGGAGCACCTATTTGTTCAGGG - Intergenic
1189153223 X:38728969-38728991 TAGGAGCTCCAAGTTTATCTTGG + Intergenic
1189512408 X:41676318-41676340 TAGGAGCCCGTAGGTCATCTTGG - Intronic
1194027338 X:88769557-88769579 TAGGAGCTCCAAGTTTATCTTGG + Intergenic
1194066526 X:89268269-89268291 TAGGAGCTCCAAGTTTATCTTGG - Intergenic
1194660733 X:96626520-96626542 CAGAAGCCCCTAGATCATCACGG + Intergenic
1194705370 X:97169299-97169321 TAGGAGGCCCTAGGTGATCTGGG - Intronic
1195225633 X:102789705-102789727 CAGGAGCCCCAAGTTTATCTTGG - Intergenic
1199038968 X:143087707-143087729 AAGTAGCCCATAATTGATCATGG - Intergenic
1200720694 Y:6602390-6602412 TAGGAGCTCCAAGTTTATCTTGG - Intergenic