ID: 901927296

View in Genome Browser
Species Human (GRCh38)
Location 1:12574470-12574492
Sequence GGGCCTCAGAATCACCATCA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 244
Summary {0: 1, 1: 0, 2: 0, 3: 26, 4: 217}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
901927296_901927302 -1 Left 901927296 1:12574470-12574492 CCATGATGGTGATTCTGAGGCCC 0: 1
1: 0
2: 0
3: 26
4: 217
Right 901927302 1:12574492-12574514 CACAGCCCTGTGGTCAAGAGGGG 0: 1
1: 0
2: 0
3: 21
4: 188
901927296_901927299 -3 Left 901927296 1:12574470-12574492 CCATGATGGTGATTCTGAGGCCC 0: 1
1: 0
2: 0
3: 26
4: 217
Right 901927299 1:12574490-12574512 CCCACAGCCCTGTGGTCAAGAGG 0: 1
1: 0
2: 4
3: 22
4: 213
901927296_901927301 -2 Left 901927296 1:12574470-12574492 CCATGATGGTGATTCTGAGGCCC 0: 1
1: 0
2: 0
3: 26
4: 217
Right 901927301 1:12574491-12574513 CCACAGCCCTGTGGTCAAGAGGG 0: 1
1: 0
2: 1
3: 24
4: 211

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
901927296 Original CRISPR GGGCCTCAGAATCACCATCA TGG (reversed) Intronic
901511092 1:9718408-9718430 AGGCCTCAGTTTCCCCATCAGGG - Intronic
901927296 1:12574470-12574492 GGGCCTCAGAATCACCATCATGG - Intronic
903647417 1:24903618-24903640 GGGCCTCAGTTTCCCCATCAAGG - Intronic
903654065 1:24938221-24938243 GGCCCTCAGACTCCCCTTCAGGG + Intronic
903678711 1:25082985-25083007 GAGCCTCAGTTTCCCCATCAAGG + Intergenic
904771511 1:32883910-32883932 GGGACTAAGTATCACCAGCAAGG + Intergenic
905295664 1:36952959-36952981 GAGAATCAGCATCACCATCAGGG + Intronic
905641413 1:39592517-39592539 AGGCCTGAGTGTCACCATCAGGG - Intergenic
905653790 1:39672924-39672946 GGGCCTCGGAACTACCATCCTGG + Intergenic
905863386 1:41364537-41364559 GGGCCTCAGTCTCACCGTCTGGG - Intronic
905926381 1:41752698-41752720 GTGCCTCAGAATCACCTGGAGGG - Intronic
907936372 1:59045908-59045930 GGGCATCAGGATCACCTGCAGGG - Intergenic
908618758 1:65952163-65952185 GGGCCTCACAATCACCTGGAAGG - Intronic
914214902 1:145616814-145616836 GTGGCTCGGAGTCACCATCACGG - Intronic
914466845 1:147937208-147937230 GTGGCTCGGAGTCACCATCACGG - Intronic
914723725 1:150310133-150310155 AGGCATCAGAATCACCTGCAAGG - Intergenic
915259936 1:154670286-154670308 GGGCATCAGAATCACCTACAGGG + Intergenic
917906510 1:179591510-179591532 GGGCCTCAGAATCACCTGTGGGG - Intergenic
919821533 1:201476078-201476100 GGGCGTCAGAATCACCTGGAGGG - Intergenic
919843998 1:201629452-201629474 GGGGCTCAGCATAGCCATCAAGG - Intronic
919871457 1:201824908-201824930 GTGCATCAGAATCACCAGGAGGG - Exonic
920394877 1:205637650-205637672 AGGCCTAAGAATCCCTATCATGG - Intergenic
920516147 1:206585781-206585803 TGGCCTGAGAATGACCAACAGGG + Intronic
920930021 1:210379180-210379202 GGACCCCAGAATCTCCAGCATGG + Intronic
920950480 1:210567709-210567731 GGGCCACAGCATCTCCATCTAGG - Intronic
923339654 1:232996492-232996514 GGGCCTCAGAGTAAACAGCATGG + Intronic
924580191 1:245316838-245316860 GACCCTCACAATCACCTTCAAGG + Intronic
1062991479 10:1823567-1823589 GGGCAACAGCATCACCAACATGG - Intergenic
1069790031 10:71013558-71013580 GCAACTCAGAATCACCATGAAGG + Intergenic
1069923339 10:71831079-71831101 GGGCCCCAGAAGCACCTTCAAGG + Intronic
1070163547 10:73880960-73880982 GGGCCACAGAAGGAACATCAGGG - Intergenic
1071899264 10:90101474-90101496 TGGCCTCAGAATCACCCTTAGGG - Intergenic
1074975705 10:118579915-118579937 GGTCCTCAGAAGGACCATGAGGG - Intergenic
1075083666 10:119400151-119400173 GCTCCTCAGAATCCCCATCATGG - Intronic
1075817001 10:125272040-125272062 GGGCCTCAGGCTCTCCATCCAGG - Intergenic
1075825146 10:125349579-125349601 GAGCCTCAGAATCACCTGTAGGG + Intergenic
1077317182 11:1924837-1924859 GGGCCTCAGAACCCCTCTCAGGG + Intronic
1077414638 11:2419118-2419140 GTGCCTTAGAATCACCCACAGGG + Intronic
1078690912 11:13579641-13579663 AGGCCTGGGAATCACCTTCAGGG - Intergenic
1078910136 11:15723425-15723447 GGGAAACAGAATCACCATCCTGG + Intergenic
1079393920 11:20045279-20045301 GGGGCTCAGAATCAGGATGACGG + Exonic
1084587433 11:70070835-70070857 GGGCCTGAGCATCTCCTTCAGGG + Intergenic
1084912893 11:72405626-72405648 GAGCCTCAGAATCCTCTTCAAGG + Intronic
1086945274 11:92838657-92838679 TGGCCTCAGAATCACCCCAAAGG + Intronic
1091994934 12:4986117-4986139 GGGCTCCAGAATCAGCAGCATGG + Intergenic
1092318643 12:7447154-7447176 TGACCTCTGAATCACCTTCAAGG - Intronic
1096183522 12:49564338-49564360 AGGCCTCAGTATCACCCCCAAGG + Intronic
1097327194 12:58290143-58290165 GGGCATCAGAATCACCTGAAGGG - Intergenic
1098610218 12:72447589-72447611 GTGTATCAGAGTCACCATCAGGG - Intronic
1098636354 12:72788860-72788882 GGACCTCAGCCTCACAATCATGG - Intergenic
1100391909 12:94150834-94150856 GGGACTCAGAGTCACCACCCTGG + Intronic
1101192479 12:102349396-102349418 GGGCATCAGAATCACCTGGAAGG + Intergenic
1102036353 12:109772460-109772482 GGGCCTCAGTTTCCCCATCTAGG + Intergenic
1102822425 12:115919043-115919065 GGGCATCAGAATCACCTGGAGGG - Intergenic
1103027486 12:117585277-117585299 GAGCCTCAGAAGCACCATCTGGG - Intronic
1103091159 12:118099061-118099083 GGGCGTCAGAATCACCTGGAGGG - Intronic
1104023252 12:125007985-125008007 GTGCCTCAGCATCACCAGGAGGG + Intronic
1105812974 13:24010794-24010816 GGCCCTCAGATCCACCAACAAGG - Intronic
1106093531 13:26621463-26621485 GGGCCTCAGTTTCTTCATCAGGG - Intronic
1106136027 13:26974411-26974433 TGGCCTCAGGATCCCCAGCAAGG - Intergenic
1111741552 13:92211691-92211713 GTGCCTCAGAATCACCTGGAGGG - Intronic
1111819907 13:93199839-93199861 GGACCTCAGTGTCACGATCATGG - Intergenic
1111893853 13:94116732-94116754 TAGCCACAGAATCATCATCAGGG - Intronic
1111897703 13:94161866-94161888 GGGCCTCACAATCATGATGAAGG + Intronic
1113853460 13:113431066-113431088 GGGCCTCAGACACACCCACAGGG - Intronic
1116563611 14:46416172-46416194 GGCCCTCAGAATCTCCAACTGGG + Intergenic
1116725959 14:48561860-48561882 GCGGCTCGGGATCACCATCATGG + Intergenic
1119687693 14:76645641-76645663 GGGACTCTGAATCAGAATCAAGG - Intergenic
1120653767 14:87165228-87165250 ATGCCTCAGAATCACCAGGAGGG + Intergenic
1121655851 14:95595010-95595032 AGGCCTCAGAAACACAATCATGG - Intergenic
1121936855 14:98027815-98027837 GACCCTCAGAATCACCCTGATGG - Intergenic
1122542382 14:102505616-102505638 GGCCCTCAGTCTCCCCATCAAGG - Exonic
1122792740 14:104191234-104191256 GGGCCTCAGTTTCCCCATTATGG + Intergenic
1123124732 14:105938153-105938175 AGGCCTGAGAAACAGCATCATGG + Intergenic
1123714232 15:23014565-23014587 GGGCCTCAGAAGCAGCCTCATGG + Intronic
1124812545 15:32955483-32955505 AGGACTCACTATCACCATCAAGG + Intronic
1125827513 15:42688919-42688941 GGACCTCAGAATCACCTTGCTGG + Exonic
1127896157 15:63301040-63301062 GTGCCTCAGAATCACCTGGAGGG + Intronic
1128617014 15:69118145-69118167 AGGCGTCAGAATCACCCACAGGG - Intergenic
1128885366 15:71281970-71281992 AGGCCTCAGATTCCCCATTAGGG + Intronic
1129676942 15:77636804-77636826 CGGCCTCAGCAACCCCATCATGG - Intronic
1129893718 15:79089185-79089207 GGGCCTCAGTGTCCCCATCTAGG + Intronic
1129945871 15:79539003-79539025 GGGCCTCAGAGTCTGCATCTAGG - Intergenic
1131328017 15:91467835-91467857 AGGCCTCAGAATCATCAAGAAGG - Intergenic
1132749451 16:1450744-1450766 GGGCCTCACAGTCACCTTCCAGG + Intronic
1134629253 16:15745183-15745205 GTTCCTCTGAATCACCTTCATGG + Exonic
1135409919 16:22225795-22225817 CCCCATCAGAATCACCATCATGG - Exonic
1137254844 16:46766327-46766349 GGGCCTCAGTTTCCCCATCAAGG + Intronic
1141717435 16:85734935-85734957 GGGCCTCAGTTTCCCCCTCAGGG - Intronic
1142901989 17:3018021-3018043 GGGCCTGAGAATCAGCACCCGGG - Intronic
1143480678 17:7226018-7226040 GGGCATCATGACCACCATCATGG + Exonic
1143783618 17:9241754-9241776 GGGACTCATTATCACCAGCAAGG + Exonic
1144956291 17:19020487-19020509 GGGCCTCGGGATCCCCATGAGGG - Exonic
1144961477 17:19046664-19046686 GAGCCTCAGATTCTCCATCTAGG - Intronic
1144973683 17:19127860-19127882 GAGCCTCAGATTCTCCATCTAGG + Intronic
1145960159 17:28882572-28882594 GATCCTCAGCTTCACCATCAAGG - Exonic
1148336753 17:46847217-46847239 GGGCTTCAGAATCCCCTCCAGGG - Intronic
1148809130 17:50279187-50279209 GGGCTTCAGAATCACCTGCAGGG - Exonic
1149067616 17:52498936-52498958 GGGCCTCAGAAAAACTATCAAGG - Intergenic
1150613361 17:66750779-66750801 GTGCCTCAGTTTCACCATCCAGG - Intronic
1151445452 17:74160687-74160709 GGGCCTCAGAGTCACCGTGTAGG - Intergenic
1155237914 18:23840093-23840115 GGGCATCAGAATCACCTGGAGGG - Intronic
1157316533 18:46594449-46594471 GGGGCACAGAATCACCACCTGGG + Intronic
1159560496 18:69987610-69987632 GGACCACAGAATCACTAGCAAGG + Intergenic
1161365713 19:3878212-3878234 GGGCCTCTGCTTCCCCATCAGGG + Intergenic
1161991017 19:7684242-7684264 GGGTATCAGAATCACCAGGAGGG + Exonic
1164720556 19:30428916-30428938 GGGCCTCAGAGGCACCCACAGGG + Intronic
1164813016 19:31172992-31173014 GGGTCTCAGAGCCACCATAAGGG + Intergenic
1165746871 19:38234678-38234700 GCGCCTCAGCATCCCCATCTGGG - Intergenic
1167672257 19:50859965-50859987 GGCCCCCAGAATCACCCTAAGGG - Exonic
926685137 2:15692229-15692251 AGCCCTCAGCATCACCAGCAGGG - Intronic
927450747 2:23207328-23207350 AGTCCTCACAATCACCAGCAAGG + Intergenic
929538393 2:42800081-42800103 GTGACTCAGCATCGCCATCATGG + Intergenic
929765013 2:44837161-44837183 GGGCCTCAGTTTCTCCACCAAGG + Intergenic
931804964 2:65795482-65795504 GGGCTTGAAGATCACCATCATGG + Intergenic
933719512 2:85389103-85389125 GGGCCTCAGAATCCCCTACAGGG - Intronic
933973283 2:87487597-87487619 TGGCCTCAGGATGAACATCATGG + Intergenic
935695193 2:105765407-105765429 CGGCCTCAGGATGACCATGATGG - Intronic
936320438 2:111462614-111462636 TGGCCTCAGGATGAACATCATGG - Intergenic
938569112 2:132546179-132546201 GTGCCTCAGAATCACTCCCAGGG + Intronic
938682565 2:133706519-133706541 GGGCCTCACAAGCACCTGCAGGG + Intergenic
939816554 2:146904238-146904260 GAGCATAAGAATCACCATGAAGG + Intergenic
941095075 2:161229903-161229925 GTGTCTCAGAATCATCAACATGG + Intronic
941860279 2:170272267-170272289 GAGCCTCAGAAGCACCCACAGGG - Intronic
948497075 2:238357720-238357742 GGGTCTCAGAAATACCACCAGGG - Intronic
1169918402 20:10706582-10706604 GGGCCTCCGAATCCCCCTCCAGG - Intergenic
1170597231 20:17815247-17815269 GGGCCTCAGAGTGTCCTTCATGG - Intergenic
1172299323 20:33837976-33837998 GGGCCTCAGACTCCTCATCAAGG - Intronic
1172900490 20:38331083-38331105 GGGCCTCAGACTCACCGGGAAGG - Exonic
1173718763 20:45235393-45235415 GGGCCTGAGAAACAGCCTCATGG - Intergenic
1174054420 20:47788209-47788231 AGGCCCCAGAAGCACCACCAAGG - Intergenic
1175663889 20:60841990-60842012 AAGCCTCACAATCACAATCATGG + Intergenic
1176386564 21:6141023-6141045 GGGCCACAGAAGCAACACCACGG + Intergenic
1176940334 21:14916215-14916237 GTGGGTCAGAATTACCATCAGGG + Intergenic
1177871779 21:26581765-26581787 GTGCATCAGAATCACCTGCAGGG + Intergenic
1179152751 21:38822582-38822604 ATGCCTCAGAATCATAATCAGGG + Intronic
1179165665 21:38933463-38933485 GGGCATCAGAATCACCTGAATGG + Intergenic
1179348551 21:40584769-40584791 GAGCATCAGAATCACCAAGATGG - Intronic
1179596858 21:42448714-42448736 CTTCCTCAGCATCACCATCATGG - Intergenic
1179736909 21:43397229-43397251 GGGCCACAGAAGCAACACCACGG - Intergenic
1180174028 21:46078871-46078893 CGGCCTCGGAGTCACCACCAAGG - Intergenic
1182350398 22:29696007-29696029 GGGCCACAGAACCACCCCCACGG + Exonic
1183305688 22:37081913-37081935 GTGCCTCAAATTCACCATCAAGG + Intronic
1184306012 22:43602383-43602405 TGGTCTCAGCAGCACCATCAGGG + Intronic
1184391699 22:44206884-44206906 GGGCCCCAGAGTCACCCTCCAGG + Exonic
1184482556 22:44756347-44756369 GGGCCTCAGAGGTACCTTCAGGG - Intronic
1184661015 22:45965518-45965540 GGGCCTCAGTTTCCCCATCTGGG - Intronic
1184912740 22:47547189-47547211 GGGCCTTAAACTCACCAACAGGG - Intergenic
1185339097 22:50283699-50283721 GGGCATCCGCATCACCATCCTGG - Exonic
950161983 3:10767161-10767183 GGGCCAGAGCACCACCATCAGGG - Intergenic
950754447 3:15161637-15161659 GGGCCTCAAAATTTACATCATGG + Intergenic
950885038 3:16355669-16355691 GAGCCTCAGAATCTCCTGCAGGG + Intronic
951557596 3:23936443-23936465 GTGCCTCAGAATCACCTGGAGGG + Intronic
951559536 3:23952037-23952059 GTGCATCAGAATCACCAAGAGGG + Intronic
952117494 3:30200272-30200294 AGGGCTCAGAAGCACCATCTTGG + Intergenic
952381640 3:32809899-32809921 GAGGCTCAGAATCTCCATGAAGG - Intergenic
952861018 3:37812331-37812353 GGTCCTCAGAATCACTGTCTAGG + Intronic
953856703 3:46504855-46504877 AGGCCTCAGGAACACAATCATGG + Intergenic
953882965 3:46701130-46701152 GGGCCTCAGTTTCTCCATCTGGG - Intergenic
954081478 3:48214595-48214617 GTGCATCAGAATCACCTGCAGGG + Intergenic
954488005 3:50872908-50872930 TGGCCTGGGAATCACCTTCATGG + Intronic
954520251 3:51218804-51218826 GTGCCTCAGAATCACCTGCAAGG + Intronic
954642954 3:52113014-52113036 GTGCCTCAGAATCACTCTGAGGG - Intronic
956871785 3:73425440-73425462 TGGCATCAGAATCACCAGGAGGG - Intronic
959131672 3:102363675-102363697 GGGCCTGAGAAACAGCATGATGG + Intronic
959895776 3:111604220-111604242 GGCTCTCAGAACCACCCTCATGG - Intronic
960005280 3:112775370-112775392 GGGAATCAGAATCACCCTAATGG + Intronic
961556399 3:127699097-127699119 GGGCCTCAGTTTCCCCATCAGGG + Intronic
961696332 3:128707851-128707873 GGGACCCAGAGTCTCCATCATGG - Intergenic
962611359 3:137079261-137079283 GGGCATCAGAATCACCTGGAGGG - Intergenic
967265342 3:187686462-187686484 GTGGCTCAGAGTCACCATCATGG + Intergenic
967513516 3:190340368-190340390 AGGCCTCACAATCACAGTCATGG + Intronic
970480035 4:16463466-16463488 GGGCATCAGAATCACCTGGAGGG + Intergenic
970873892 4:20847477-20847499 GAGCCTCAGAATCACCTGAAGGG - Intronic
975479015 4:74857114-74857136 AGGCCTCACAGTGACCATCATGG - Intergenic
976328758 4:83803465-83803487 GGGCCTCAGAATCTCTACCTGGG + Intergenic
992363624 5:76069430-76069452 GGGCAGCAGAATGACGATCAGGG - Intergenic
992765103 5:79991149-79991171 CGGCCTCACCATCACCACCAGGG + Exonic
995768831 5:115647997-115648019 GTGCCTCAGAATCACCTGGAAGG + Intergenic
998954643 5:147426624-147426646 GGGCTACAGAATCAGCATCAAGG - Intronic
1000996656 5:167966132-167966154 AGGCCTCAGATTTACCATCCGGG - Intronic
1001542793 5:172551118-172551140 GGGCCCCAGAGTCCCCAGCAGGG + Intergenic
1001772747 5:174308253-174308275 GGGCCTCAGTTTCCCCACCAGGG - Intergenic
1002299071 5:178247479-178247501 TGGCCTCAGACTCACCGTCTGGG - Intronic
1002484961 5:179528904-179528926 GGGACTCAGAACCAGCAGCAAGG - Intergenic
1006170943 6:32092130-32092152 GGGCATCAGAATCACCTGGAGGG + Intronic
1006189902 6:32201341-32201363 GGGGCTCAGTACCACCAGCAGGG + Exonic
1007239343 6:40413880-40413902 GGCACTCAGAACCACCATGAGGG - Intronic
1008490641 6:52083339-52083361 CTGCCTCAGAATCACCAGAAAGG + Intronic
1009791765 6:68411176-68411198 GAGACTCAGAATTGCCATCAAGG - Intergenic
1011971062 6:93223536-93223558 GGGCATCACAATCACCAGAAGGG - Intergenic
1012478807 6:99645127-99645149 AGGCCTCACAATCACAATCATGG + Intergenic
1013470734 6:110461432-110461454 AGACCTCAGAACCCCCATCAAGG + Intronic
1014995637 6:128139716-128139738 GGACTTCAGAATCAACATCCAGG + Intronic
1017499317 6:155009015-155009037 GGGCATCAGAATCACCTGGAGGG + Intronic
1017817924 6:158028429-158028451 GGGCATCAGAATCACCTGGAGGG + Intronic
1019075295 6:169382367-169382389 GGGCCTCAGCATCAGAATGAGGG + Intergenic
1019391254 7:787840-787862 CAGCCTCAGAATCACCTGCAGGG - Intergenic
1021951972 7:25783832-25783854 GTGGCTCAGAGTTACCATCAAGG + Intergenic
1022216291 7:28265540-28265562 CTGCCTCAGAATCACCCTCAGGG + Intergenic
1022429588 7:30303406-30303428 GGGCCTGAGAATCACCCAGAGGG + Intronic
1022527085 7:31045143-31045165 GGGCCTCAGTTTCCCCATCAAGG + Intergenic
1022589007 7:31643197-31643219 GGGCCTCAGAGTCAACATGAAGG - Exonic
1024769357 7:52700398-52700420 AAGCCTCAGAATTAGCATCAAGG - Intergenic
1029236606 7:99125127-99125149 GGAGTTCAGAAGCACCATCATGG + Intronic
1031469761 7:122155250-122155272 GTGCATCAGAATCACCAGGAGGG + Intergenic
1035132952 7:156672922-156672944 GGGCCTCAGAATCACCTGGAGGG + Intronic
1038215605 8:25559087-25559109 AGGCCTCACAAACACCATTAGGG - Intergenic
1039990500 8:42483508-42483530 GTGCCTCAGACTCTCCAGCAAGG - Intronic
1042593226 8:70418411-70418433 GGACCTCCTATTCACCATCATGG - Intergenic
1045012998 8:97974857-97974879 GTGCCTCAGAATCACCTGGAGGG + Intronic
1045423370 8:102039116-102039138 GGGCCTGTGAATCCTCATCAAGG - Intronic
1048104183 8:131389297-131389319 GGGCCACAGCATCTCCATGAGGG + Intergenic
1050458741 9:5858725-5858747 TGACCTCAGAACCACCATGAAGG - Intergenic
1051253364 9:15185619-15185641 GTGCCTCAGAATCACCTGGAGGG - Intronic
1052776574 9:32739012-32739034 GTGCCTCAGAGTCACCTACAGGG + Intergenic
1056501955 9:87218248-87218270 TTGCCTCAGAATCACCAGAATGG - Intergenic
1057081005 9:92174662-92174684 GGGCCCTAGAGTCATCATCAGGG - Intergenic
1057140830 9:92725928-92725950 GGGCCTCTGATTCCCCATCTGGG + Intronic
1057287783 9:93774371-93774393 TGGCCTATGAATCACCTTCAGGG - Intergenic
1057902212 9:98958197-98958219 GGGCCTCAGTTTCCCCATCTGGG + Intronic
1058457128 9:105147963-105147985 GGGCATCAGAATGAATATCAGGG - Intergenic
1058817312 9:108696347-108696369 GTGCATCAGAATCACCAGCAGGG + Intergenic
1060205476 9:121680378-121680400 GGGACTCAGAATCACCTCCTGGG - Intronic
1060549612 9:124478689-124478711 GGGCCTCAGCCTCATCATCAGGG + Intergenic
1061023853 9:128034877-128034899 GGGCCTCAGTTTCCCCATCTAGG + Intergenic
1061796195 9:133087149-133087171 GGGCCTCAGAGTCACCCGTAGGG - Intronic
1061949075 9:133926163-133926185 GGGCCTCAGTTTCCCCATCTGGG - Intronic
1061990003 9:134153673-134153695 GGCCCTCAGCATTACCACCACGG - Intronic
1062519544 9:136951990-136952012 GGGCCTCTGAACCCCCAGCATGG + Intronic
1187003049 X:15201687-15201709 GGTCCTTAGAATCATCATTATGG + Intergenic
1187572447 X:20518813-20518835 GGGCCTGAGAGTCCCCATCGTGG - Intergenic
1189162456 X:38824049-38824071 GGGGCTCAAAATTACCATCAAGG - Intergenic
1189350365 X:40271241-40271263 GGGCGTCAGAATCACCTGGAGGG - Intergenic
1189428771 X:40928948-40928970 GGGGTTCTGAATCTCCATCATGG - Intergenic
1190240729 X:48655798-48655820 CGGTCTCTGAATCACCTTCAGGG + Intergenic
1191950996 X:66593036-66593058 GGGCCTCAGAGTCACAGTCTTGG + Intergenic
1192215522 X:69155623-69155645 GGGCCTCAGAAGCACCAAACAGG - Intergenic
1194222755 X:91215616-91215638 GTGTGTCAGAATCACCTTCAGGG - Intergenic
1196780746 X:119381989-119382011 CAGCCTCACAATCTCCATCAAGG + Intergenic
1198227991 X:134664140-134664162 GTGCCTCAGAATCACCTGGAGGG + Intronic
1199746192 X:150773195-150773217 GGCCCTCAGTTTCCCCATCAAGG - Intronic
1199870414 X:151893491-151893513 GTGCATCAGAGTCAGCATCAAGG - Intergenic
1200559233 Y:4679074-4679096 GTGTGTCAGAATCACCTTCAGGG - Intergenic