ID: 901928582

View in Genome Browser
Species Human (GRCh38)
Location 1:12582891-12582913
Sequence ATGCATGGATGGATGGAGTA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 2374
Summary {0: 1, 1: 2, 2: 46, 3: 529, 4: 1796}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
901928582 Original CRISPR ATGCATGGATGGATGGAGTA GGG (reversed) Intronic
Too many off-targets to display for this crispr