ID: 901928784

View in Genome Browser
Species Human (GRCh38)
Location 1:12583713-12583735
Sequence ATGCATGAATGGATGGAGTA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1295
Summary {0: 1, 1: 2, 2: 7, 3: 143, 4: 1142}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
901928784 Original CRISPR ATGCATGAATGGATGGAGTA GGG (reversed) Intronic
900498136 1:2985870-2985892 GTGAATGAATGGATGGATGATGG - Intergenic
900498167 1:2986011-2986033 GTGAATGAATGGATGGAGGATGG - Intergenic
900498729 1:2989278-2989300 ATGAATGGATGGATGGAGGATGG - Intergenic
900498766 1:2989463-2989485 ATGGATGGATGGATGGATGATGG - Intergenic
900498784 1:2989543-2989565 ATGGATGAATGGATGGAGGATGG - Intergenic
900509425 1:3051531-3051553 ATGGATGGATGGATGGATGATGG - Intergenic
900509584 1:3052193-3052215 ATGAATGAATGGATGGATGATGG - Intergenic
900535659 1:3175940-3175962 GTGGATGGATGGATGGGGTAAGG - Intronic
900573330 1:3370817-3370839 ATGGATGAATAGATGGTGGATGG - Intronic
900573347 1:3370883-3370905 ATGGATGAATGGATGGTGGATGG - Intronic
900573384 1:3371060-3371082 ATGGTTGAATGGATGGTGGATGG - Intronic
900573396 1:3371123-3371145 ATGAATCAATGGATGGTGAATGG - Intronic
900573426 1:3371253-3371275 ATGGATGAATGGATGGTGGATGG - Intronic
900573442 1:3371339-3371361 ATGAATGGATGGATGGTGAATGG - Intronic
900747930 1:4373827-4373849 ATGAATGAATGGATGGGTTGGGG - Intergenic
900922004 1:5678790-5678812 ATGGATGGATGGATGGATGAGGG + Intergenic
900922015 1:5678845-5678867 ATGGATGAATGGATGAGGGATGG + Intergenic
900931020 1:5737659-5737681 ATGGATGGATGGATGGATGATGG + Intergenic
900931027 1:5737700-5737722 ATATATGAATGGATGGTGGATGG + Intergenic
901001369 1:6150510-6150532 ATGGATGGATGGATGGTGGATGG + Intronic
901006541 1:6174414-6174436 ATGGATGAATGCATGGTGGATGG + Intronic
901006601 1:6174699-6174721 ATGGATGAATGGATGGTGGATGG + Intronic
901006623 1:6174835-6174857 ATGGATGAATGGATGAATGACGG + Intronic
901006675 1:6175066-6175088 ATGGATGAGTGGATGGTGGATGG + Intronic
901006719 1:6175276-6175298 ATGCATGGATGGATGGTGGATGG + Intronic
901006723 1:6175299-6175321 ATGAATGAATGGATGGTGGATGG + Intronic
901006731 1:6175341-6175363 ATGGATGAGTGGATGGTGGATGG + Intronic
901006736 1:6175364-6175386 ATGCATGGATGGATGGTGGATGG + Intronic
901006743 1:6175406-6175428 ATAGATGAATGGATGGATGACGG + Intronic
901212127 1:7532746-7532768 ATGAATGAGTGGATGGATCAAGG + Intronic
901743695 1:11358764-11358786 ATGGATGGATGGATGGAATGAGG - Intergenic
901863596 1:12089915-12089937 ATGGATGGATGGATGGGGAAGGG - Intronic
901863697 1:12090315-12090337 ATGGATGGATGGATGGGGAAAGG - Intronic
901863729 1:12090433-12090455 ATGGATGGATGGATGGGGGAAGG - Intronic
901928566 1:12582834-12582856 ATGGATGGATGGATGGAGTTGGG - Intronic
901928582 1:12582891-12582913 ATGCATGGATGGATGGAGTAGGG - Intronic
901928592 1:12582933-12582955 GTGGATGGATGGATGGAGTGGGG - Intronic
901928617 1:12583033-12583055 GTGGATGAGTGGATGGAGTTGGG - Intronic
901928637 1:12583135-12583157 GTGAGTGGATGGATGGAGTAGGG - Intronic
901928644 1:12583161-12583183 GTGGATGGATGGATGGAGTGGGG - Intronic
901928681 1:12583312-12583334 ATGGATGGATGAATGGAGTAGGG - Intronic
901928699 1:12583377-12583399 ATGGATGGATGGATGGGGTGGGG - Intronic
901928741 1:12583542-12583564 ATGGATGGGTGGATGGAGTGGGG - Intronic
901928769 1:12583647-12583669 ATGGATGGATGGATGGAGTGGGG - Intronic
901928784 1:12583713-12583735 ATGCATGAATGGATGGAGTAGGG - Intronic
901928808 1:12583816-12583838 ATGGTTGGATAGATGGAGTAGGG - Intronic
902412856 1:16221587-16221609 ATGGATGGATGGATGGATGATGG + Intergenic
902412888 1:16221777-16221799 ATGGATGGATGAATGGAGGATGG + Intergenic
902520100 1:17011285-17011307 ATGAATGAATGAATGGCGTTGGG - Intronic
902599040 1:17528624-17528646 ATGAATGAATGGATGGAGGATGG - Intergenic
902603883 1:17558106-17558128 ATGGATGGATGGATGGACAATGG - Intronic
902721184 1:18305246-18305268 ATGGATGCATGGATGGTGGATGG + Intronic
902721208 1:18305383-18305405 ATGGATGGATGGATGGATAATGG + Intronic
902721214 1:18305417-18305439 ATGGATAGATGGATGGATTATGG + Intronic
902721222 1:18305471-18305493 ATGGATGGATGGATGGATGATGG + Intronic
902721233 1:18305529-18305551 ATGAATGGATGGATGGATGATGG + Intronic
902721240 1:18305560-18305582 ATGGATGGATGGATGGATTATGG + Intronic
902721244 1:18305579-18305601 ATGGATGGATGGATGGATGATGG + Intronic
902790551 1:18764988-18765010 ATGAATGAATGCATGGGGAAGGG - Intergenic
902827600 1:18987738-18987760 ATGAATGAATGAATGAAGGAAGG + Intergenic
903175173 1:21576236-21576258 ATGGATGGATGGATGGATGATGG + Intronic
903234459 1:21940659-21940681 ATGAATGAATGAATGGACAAAGG - Intergenic
903277511 1:22231388-22231410 ATGGATGAATGGATGATGGATGG - Intergenic
903341677 1:22658796-22658818 ATGGATGGATGGATGGAGGGTGG + Intronic
903357842 1:22758937-22758959 ATGAATGGATGGATGGATGATGG + Intronic
903474263 1:23608541-23608563 ATGAATGAATGGATGAATGAAGG + Intronic
903690428 1:25169326-25169348 ATGGATGGATGGATGGATGATGG + Intergenic
903949724 1:26989207-26989229 ATAAATGAATGAATGGAGAAGGG + Intergenic
904441874 1:30537126-30537148 GTGTATGAATGGCTGAAGTATGG - Intergenic
904464524 1:30699979-30700001 ATGGATGGATGGATGGATGAAGG - Intergenic
904465112 1:30702955-30702977 ATGGATGGATGGATGGATGATGG + Intergenic
904581269 1:31545946-31545968 ATGGATGAATGGATGGATGGAGG - Intergenic
904581357 1:31546517-31546539 ATGGATGGATGGATGGATGATGG - Intergenic
904734928 1:32624461-32624483 ATTCATGGATGGATGGCATATGG + Intronic
904745210 1:32706486-32706508 ATGAATGAAGGGAAGGAGGATGG + Intergenic
904824847 1:33267420-33267442 CTGCATGTATAGATGGAGCAAGG - Intronic
905274627 1:36809197-36809219 ATGGATGGATGGATGGATGATGG - Intronic
905605359 1:39293739-39293761 ATGCATGGATGCATTGAGTAGGG - Intronic
905929206 1:41775200-41775222 ATGGACGAATGGATGGAGGGAGG - Intronic
906180686 1:43815915-43815937 ATGGATGGATGGATGGATGATGG + Intronic
906817819 1:48897357-48897379 ATGGATGAATGGATAAAGTGTGG - Intronic
907774266 1:57498029-57498051 ATGGATGAATGGATGGATCAAGG + Intronic
907790129 1:57655368-57655390 ATGAATGGATGGATGGATGATGG - Intronic
907839884 1:58146818-58146840 ATGGATGGATGGATGGATAAAGG - Intronic
908391370 1:63686692-63686714 ATGGATGGATGGATGGATGAAGG - Intergenic
908391400 1:63686850-63686872 ATGGATGAATGGATGGGGGATGG - Intergenic
908437474 1:64120830-64120852 GTGGATGGATGGATGGAGAATGG + Intronic
909669521 1:78172449-78172471 ATGCATGAATGTTTGAACTAAGG - Intergenic
910362020 1:86422431-86422453 ATGACTGAATGAATGGAGTCAGG - Intergenic
912138491 1:106691842-106691864 ATTCATGAATGGATAAAGAAAGG + Intergenic
912521759 1:110250540-110250562 ATGCCTGCATGGTTGGTGTAAGG + Intronic
914351301 1:146842755-146842777 ATGCATGGATGGATGGATGATGG + Intergenic
914351375 1:146843022-146843044 ATGGATGAATGGATGATGGATGG + Intergenic
916024651 1:160823279-160823301 ATGCTTGAAAGGAAGGAGGAAGG + Intronic
916050873 1:161036080-161036102 ATGAATGAATGAATGTAGGAGGG + Intronic
916681363 1:167108155-167108177 CTGGATGAATGGATGGACCATGG - Intronic
917050455 1:170916601-170916623 AAGCATGGATGGAGTGAGTATGG + Intergenic
917485892 1:175454293-175454315 ATGGATGAATGAATGCAGTATGG - Intronic
918427312 1:184423854-184423876 ATGGATGGATGGATGGACGATGG - Intronic
918844939 1:189596798-189596820 ATGTATGAGTGGCTGGAGTGGGG - Intergenic
919069660 1:192737819-192737841 ATGAATGGATGAATGGAGTGGGG + Intergenic
919604965 1:199670273-199670295 AAGCTTGAGTGGATGGAGAAGGG + Intergenic
919826995 1:201510182-201510204 ATGGATGGATGGATGGAGGGAGG - Intergenic
919922272 1:202173655-202173677 ATGGATGGATGGATGGTGGATGG - Intergenic
919935098 1:202245975-202245997 ATGGATGAATGGATAGATGAAGG - Intronic
919935115 1:202246030-202246052 ATGAATGGATGGATGGAGGGAGG - Intronic
919935117 1:202246034-202246056 ATGGATGAATGGATGGATGGAGG - Intronic
919935127 1:202246066-202246088 ATGGATGAATGGATAGATGAAGG - Intronic
919935247 1:202246397-202246419 ATGGATGAATGGATAGATGAAGG - Intronic
920195429 1:204223309-204223331 ATGGATGAATGGATGGATAGTGG + Intronic
920700588 1:208215529-208215551 ATGGATGAAGGGATGGAGGAAGG + Intronic
920722271 1:208398896-208398918 ATGAATGAATGAATGGATGATGG - Intergenic
920819872 1:209370274-209370296 ATGGATGAATGGATGGGGGTGGG + Intergenic
920910213 1:210209463-210209485 GTGAATGAATGGTTGAAGTATGG - Intergenic
921382437 1:214538201-214538223 AAGAATGAATGGAAGGAGGAAGG + Intronic
921396544 1:214674417-214674439 ATGCATAAAGGGAAGGAGTCTGG - Intergenic
921501460 1:215909298-215909320 ATGAATGAATAGATGGAACACGG + Intronic
921815599 1:219559746-219559768 ATTCATGAATGGTTGGGATATGG + Intergenic
922745544 1:228041379-228041401 ATGGATGAATGGATGATGGATGG - Intronic
922745795 1:228042926-228042948 ATGGATGGATGGATGGTGAATGG + Intronic
922790597 1:228308871-228308893 AAGAATGAATGGATGGATAATGG - Intronic
922790943 1:228310684-228310706 ATACATGAGTGGATGGGGGAAGG - Intronic
923471769 1:234297402-234297424 ATGGATGAATGGATAAAGTGTGG + Intronic
924034300 1:239920405-239920427 ATGGATGAATGGATGATGGATGG - Intergenic
924445519 1:244126512-244126534 ATGCAGGTATGGATGAAGTAAGG + Intergenic
924509642 1:244718849-244718871 AGGGATGAATGGGTGGAGCACGG - Intergenic
1062928340 10:1335200-1335222 ATGAATGGATGGATGGAGGGAGG + Intronic
1063269671 10:4493863-4493885 ATGGAAGGATGGATGGATTATGG - Intergenic
1063438926 10:6056287-6056309 ATGCATGAATGGATGGATGAAGG + Intronic
1064132361 10:12721505-12721527 ATGGATGGATGGATGGTGGATGG - Intronic
1064440809 10:15351697-15351719 ATGGATGGATGGATGGAGAGTGG + Intronic
1064715262 10:18170241-18170263 AGGAATGAATGGATGTAGGATGG + Intronic
1064896381 10:20241954-20241976 ATGGATGGATGGATGGAGAAAGG + Intronic
1065268409 10:24001230-24001252 ATGTATGAATGAATGGGGTCAGG - Intronic
1065734525 10:28739461-28739483 GTGTATGAATGGTTGAAGTATGG - Intergenic
1065825052 10:29563025-29563047 ATGCATGGATGCATGGAGAGAGG + Intronic
1065860666 10:29870276-29870298 ATACATGAATGGGTGGTGGATGG - Intergenic
1065860679 10:29870336-29870358 ATGGATGGATGGATGGTGGATGG - Intergenic
1065951642 10:30657783-30657805 ATGGATGAGTGGATGGAGAAAGG - Intergenic
1065952357 10:30663794-30663816 ATGCATGGATGCATGGAGAGAGG - Intergenic
1066229330 10:33416895-33416917 ATGAATGGATGGATGGTGGATGG + Intergenic
1067051422 10:43023554-43023576 ATGGATGAATGGATGGATGATGG + Intergenic
1067051489 10:43024059-43024081 ATGGATAAATGGATGGATGATGG + Intergenic
1067342426 10:45416715-45416737 ATGGATGAAGGGAAGGAGGAAGG + Intronic
1067931663 10:50568313-50568335 ATGCATGAATGCTTGGATGAAGG + Intronic
1069008605 10:63346505-63346527 ATTCATGAGTGGTTGAAGTATGG - Intronic
1069285242 10:66706235-66706257 AAGAATGAATGGATGAAGGATGG - Intronic
1069601630 10:69711869-69711891 ATGGATGGATGGATGGATGATGG - Intergenic
1070440082 10:76434582-76434604 ATGGATGAGTGGATGGCCTAAGG - Intronic
1070667040 10:78352342-78352364 ATGGATGGATGGATGAAGAATGG + Intergenic
1070749902 10:78957851-78957873 ATGGATGGATGGATGGATGAAGG + Intergenic
1071508580 10:86247369-86247391 ATGGATGGATGGATGGATGATGG + Intronic
1071575553 10:86723319-86723341 ATGCATGGATAAATGGAGGAGGG + Intronic
1072450411 10:95535058-95535080 ATAAATGAATGGATGGATGATGG + Intronic
1072532786 10:96335375-96335397 GTGAATGAAAGGATGGAGGAAGG - Intronic
1073429014 10:103474163-103474185 ATAGATGAATGGATGAAGGATGG - Intronic
1073467166 10:103700945-103700967 ATGGATGGATGGATGGATGATGG - Intronic
1073467170 10:103700964-103700986 ATGGATGGATGGATGGTGGATGG - Intronic
1073467179 10:103701013-103701035 ATGGATGGATGGATGGTGGATGG - Intronic
1073467185 10:103701036-103701058 ATGGATGGATGGATGGTGGATGG - Intronic
1073467191 10:103701059-103701081 ATGGATGGATGGATGGATGATGG - Intronic
1073467213 10:103701172-103701194 ATGGATGGATGGATGGTGGATGG - Intronic
1073467233 10:103701269-103701291 ATGGATGAATGGATAGATGATGG - Intronic
1073467236 10:103701292-103701314 ATGGATGAATGGATGGATGATGG - Intronic
1073467240 10:103701315-103701337 ATGGATGAATGGATGGATGATGG - Intronic
1073467250 10:103701357-103701379 ATGGATGAATGGATAGATGATGG - Intronic
1073467275 10:103701488-103701510 ATGGATGAATGGATGGATGATGG - Intronic
1073467290 10:103701556-103701578 ATGGATGAATGGATAGATGATGG - Intronic
1073467364 10:103701979-103702001 ATGGATGGATGGATGGTGGATGG - Intronic
1073467399 10:103702161-103702183 ATGGATGGATGGATGGTGGATGG - Intronic
1073543417 10:104330081-104330103 ATGCCAGATTGGAGGGAGTAAGG - Intronic
1074773155 10:116746208-116746230 TTGCATGAATGGATGTGGTGGGG - Intergenic
1074905385 10:117858225-117858247 ATGGATGGATGGATGGATAATGG - Intergenic
1075465406 10:122647107-122647129 ACGAATGAATGGATGGAGTTGGG - Intergenic
1075648258 10:124110487-124110509 ATGGATGGATGGATGGATGATGG + Intergenic
1075918312 10:126188873-126188895 ATGAATGAAAGGATGAAGGATGG - Intronic
1075918324 10:126188979-126189001 ATGGATGGATGGATGGTGAATGG - Intronic
1076136725 10:128050242-128050264 ATGGATGGATGGATGGATGATGG + Intronic
1076494436 10:130887636-130887658 ATGGATGGATGGATGGATGAAGG + Intergenic
1076578003 10:131483685-131483707 ATGGATGAATGGATGATGGATGG + Intergenic
1076602836 10:131670116-131670138 ATGGATGAATGGATGAATGATGG + Intergenic
1076676720 10:132150900-132150922 ATGGATAAATGGATGGATTAAGG - Intronic
1076825136 10:132963425-132963447 ATGGACGGATGGATGGAGGAAGG - Intergenic
1076825165 10:132963541-132963563 ATGGATGGATGGATGGAGAGAGG - Intergenic
1076844939 10:133065429-133065451 ATGTATGGATGGATGGATGATGG + Intergenic
1076844953 10:133065483-133065505 ATGGATGGATGGATGGTGGATGG + Intergenic
1076931874 10:133536885-133536907 ATGGGTGGATGGATGGAGGATGG + Intronic
1076934360 10:133557516-133557538 ATGGATGAATGGAGAGAGAATGG + Intronic
1077159570 11:1106513-1106535 ATGGATGGATGGATGGTGGATGG - Intergenic
1077280507 11:1742914-1742936 ATGGATAGATGGATGGAGGATGG + Intronic
1077280512 11:1742937-1742959 ATGGATAGATGGATGGAGGATGG + Intronic
1077280531 11:1743033-1743055 ATGGATGGATGGATGAAGGATGG + Intronic
1077280541 11:1743067-1743089 ATGGATGGATGGATGGAGGATGG + Intronic
1077280588 11:1743339-1743361 ATGGATGGATGGATGGAGGATGG + Intronic
1077280595 11:1743377-1743399 ATGGATGAATGGATGGAAGATGG + Intronic
1077480881 11:2814000-2814022 ATGGATGGATGGATGGATGATGG + Intronic
1079807369 11:24950223-24950245 ATAAATGAATGGATGGATGAAGG + Intronic
1079887696 11:26008363-26008385 ATGAATGAATGAATGAAGTGCGG - Intergenic
1079973461 11:27064077-27064099 ATTCAAGAATGGATGTAGCAAGG - Intronic
1080415115 11:32062562-32062584 ATGGATGGATGGATGGTGGATGG + Intronic
1080781489 11:35433828-35433850 ATGGATGGATGGATGGATGAGGG + Intronic
1080801868 11:35617743-35617765 ATGCATGAATGAATGGGAGATGG + Intergenic
1080849360 11:36054893-36054915 ATGGATGAATGGATGGATGATGG + Intronic
1081287183 11:41285246-41285268 ATGAATGAATGGATGGATGATGG - Intronic
1082781382 11:57290190-57290212 ATGGATGGATGGATGGATGAAGG + Intergenic
1083142105 11:60730413-60730435 ATGGATGAGTGCATAGAGTATGG - Intronic
1083151788 11:60796202-60796224 ATGGATGGATGGATGATGTATGG + Intronic
1083433166 11:62625455-62625477 AGGCATGAATGGATAGACTCTGG + Exonic
1083622405 11:64055699-64055721 ATGGATGGATGGATGGATGATGG + Intronic
1083879843 11:65542978-65543000 ATGGATGGATGGATGGATGAAGG + Intronic
1083879844 11:65542982-65543004 ATGGATGGATGGATGAAGGATGG + Intronic
1083879852 11:65543013-65543035 GTGGATGGATGGATGGAGAAAGG + Intronic
1083891098 11:65596094-65596116 ATGAATGAATGAATGTGGTATGG - Intronic
1084464707 11:69315475-69315497 ATGGATGGATGGATGGATAATGG + Intronic
1084543830 11:69803775-69803797 ATGGATGGATGGATGGATGATGG + Intergenic
1084543847 11:69803888-69803910 ATGGATGGATGGATGGATGATGG + Intergenic
1084576540 11:69992238-69992260 ATGGATGGATGGATGGATGATGG + Intergenic
1084579222 11:70012347-70012369 ATGGATGGATGGATGGATGAAGG - Intergenic
1084579265 11:70012688-70012710 ATGGATGGATGGATGGATGAAGG - Intergenic
1084596232 11:70118602-70118624 ATGGATGGATGGATAGATTATGG + Intronic
1084596273 11:70118788-70118810 ATGGATGAATGGATGCTGAAGGG + Intronic
1084609661 11:70194152-70194174 ATGGATGGATGGATGGTGGATGG + Intergenic
1084609760 11:70194630-70194652 ATGGATGGATGGATGGTGGATGG + Intergenic
1084609837 11:70195037-70195059 ATGGATGGATGGATGGTGGATGG + Intergenic
1084658813 11:70535409-70535431 ATGGATGGATGGATGGATGATGG - Intronic
1084667819 11:70585921-70585943 ATGGAGGAATGGATGAAGGATGG - Intronic
1084705120 11:70811622-70811644 ATGGATGAGTGGATGGATGATGG - Intronic
1084705154 11:70811817-70811839 ATGGATGAATGAATGGTGGATGG - Intronic
1084705318 11:70812990-70813012 GTGAATGAATGAATGGAGAAAGG - Intronic
1084781886 11:71415141-71415163 ATGGGTGAATGGATGGATGATGG + Intergenic
1084815553 11:71643945-71643967 GTGCATGAGGGGATGGAGGATGG - Intergenic
1085032777 11:73282751-73282773 ATGAATGAATGAATGGAGGAGGG + Intronic
1085393841 11:76196323-76196345 AGGCATGGATGGATGGGGTATGG - Intronic
1085406834 11:76268536-76268558 ATGGATGGATGGATGGTGGAGGG - Intergenic
1085406867 11:76268657-76268679 ATGGATGGATGGATGGAGGATGG - Intergenic
1085406873 11:76268680-76268702 ATGGATGGATGGATAGAGGATGG - Intergenic
1085406894 11:76268761-76268783 ATGAATGGATGGATGGAGGATGG - Intergenic
1085714131 11:78856626-78856648 AAGCATGACTTGATGGAGTAAGG + Intronic
1086401979 11:86468335-86468357 ATGGATGGATGGATGGATGATGG - Intronic
1087175913 11:95095233-95095255 TTGAATGAATGGATGGAGGGTGG + Intronic
1088375027 11:109131623-109131645 ATGGATGAATGGATGGTTAAAGG + Intergenic
1089739554 11:120572964-120572986 GTGAATGAGTGAATGGAGTATGG - Intronic
1090446397 11:126768323-126768345 GTGGATGGATGGATGCAGTATGG - Intronic
1090479908 11:127059051-127059073 ATGCATGAATTGAGGGAGTTTGG + Intergenic
1090527261 11:127550916-127550938 ATGAATGAATGAATGAAATAGGG - Intergenic
1090675174 11:128985678-128985700 ATGAATGAATGGATGGACAAAGG - Intronic
1090857096 11:130619709-130619731 ATGGATAGATGGATGGAGGATGG - Intergenic
1091036642 11:132239983-132240005 ATGAATGGATGGATGGATGATGG - Intronic
1091057017 11:132429061-132429083 ATGGATGGATGGATGGAGAGTGG + Intronic
1091187304 11:133658294-133658316 ATGGATGGATGGATGGATGATGG + Intergenic
1091407333 12:217381-217403 ATGGATGGATGGATGGAGGATGG + Intergenic
1091654676 12:2337001-2337023 ATGGATGGATGGATGGTGAATGG - Intronic
1091968133 12:4763022-4763044 ATGGATGAATGGTTGAAGTATGG + Intronic
1092232891 12:6786950-6786972 GTACATGAATGAATGGAGCAGGG + Intronic
1092427458 12:8386109-8386131 GTGCATGAGGGGATGGAGGATGG + Intergenic
1093163811 12:15781928-15781950 ATTCATGAATTAATGGATTAAGG - Intronic
1093204948 12:16237352-16237374 ATCAATGAATGAATGGAGTGGGG + Intronic
1093653097 12:21666200-21666222 GTGTATGAATGGTTGAAGTATGG + Intronic
1094355590 12:29574194-29574216 GTGAATGAATGAATGGAGGAAGG - Intronic
1094405980 12:30116604-30116626 ATGGATGAATCGATGAAGTCAGG - Intergenic
1094484690 12:30915129-30915151 CTGAATGAAAGGAAGGAGTAAGG + Intergenic
1094488020 12:30940305-30940327 ATGAATGAATGAATGAAGGAAGG - Intronic
1095240747 12:39856218-39856240 ATGCATGGATAGATGGATGAAGG - Intronic
1095256225 12:40039953-40039975 ATGTGTGAATGTATGGAGCATGG - Intronic
1095510653 12:42948257-42948279 ATGCATGCATGCATGCAGCATGG - Intergenic
1096536760 12:52279827-52279849 GTGAATGGATGGATGGAGAATGG - Intronic
1096611227 12:52803312-52803334 ATGGATGAATAGATGGATGATGG + Intergenic
1096716997 12:53497654-53497676 ATGCATGAGTGGCTGGCGTGAGG + Intronic
1096960942 12:55576936-55576958 ATGGATGAATGAATGAAGGATGG + Intergenic
1097144536 12:56930868-56930890 ATGAATGAATGGATTGATTTTGG - Intronic
1097742533 12:63260898-63260920 ATGAATGAATGGAGGGAATCTGG + Intergenic
1098129208 12:67331098-67331120 TTGCGTTAATGGATGCAGTAGGG + Intergenic
1098700525 12:73618862-73618884 ATGTATGAATGGAAGGAGAAAGG - Intergenic
1098963056 12:76759511-76759533 ATGGATGAATGGATAAAGTGTGG + Intergenic
1100563190 12:95769665-95769687 GTGCATGAATGGTTGAAGTATGG + Intronic
1101201302 12:102439193-102439215 ATGAATAAATGAATGGAGAAGGG + Intronic
1101791915 12:107935339-107935361 AAGAATGGATGGATGGAGGATGG - Intergenic
1101801096 12:108022524-108022546 ATGAATGAATGGATGATGGAAGG - Intergenic
1101873189 12:108582022-108582044 ATGAATGAATGAATGGGGGATGG - Intergenic
1102043168 12:109813845-109813867 ATGAATGGATGGATGGATGATGG + Intronic
1102043181 12:109813965-109813987 ATAGATGAATGGATGGATGATGG + Intronic
1102199791 12:111049353-111049375 ATGGATGCATGCATGGAGGAAGG - Intronic
1102222957 12:111206951-111206973 ATGCATAAATGGATGGTGGTTGG + Intronic
1102507192 12:113391005-113391027 ATGAATGAATGGATGGCTGATGG - Exonic
1102514748 12:113438895-113438917 ATGAATGCATGGATGGATTATGG - Intergenic
1102526574 12:113516251-113516273 ATGGAGGAAGGGATGGAGGAAGG - Intergenic
1102825991 12:115948301-115948323 ATTCATGAATGAATTGAGTTGGG - Intergenic
1102895620 12:116595853-116595875 ATGGATGGATGGATGGATGAAGG + Intergenic
1103006201 12:117422360-117422382 ATGTATGAATAGATGGTGGATGG - Intronic
1103012773 12:117469993-117470015 ATGGATGGATGGATGAAGGATGG - Intronic
1103012774 12:117469997-117470019 ATGGATGGATGGATGGATGAAGG - Intronic
1103024063 12:117559068-117559090 ATGGATGGATGGATGGTGGATGG + Intronic
1103255955 12:119541445-119541467 ATGAATGAATGGATGGTGGATGG + Intergenic
1103417322 12:120751728-120751750 ATGGAAGAATGGCTGGAGGACGG + Intergenic
1103834325 12:123807128-123807150 ATGGATGGATGGATGGATGATGG - Intronic
1103941441 12:124503425-124503447 ATGCATGCATGGATAGAGAAAGG + Intronic
1103941449 12:124503467-124503489 ATGGATGGATGGATGGATGATGG + Intronic
1103992528 12:124808641-124808663 GAGCATGAATGGATGGAGGGTGG - Intronic
1104034722 12:125090357-125090379 ATGGATGAATAGATGGATGACGG - Intronic
1104034774 12:125090720-125090742 ATGGATGGATGGATGGATGATGG - Intronic
1104075695 12:125387792-125387814 ATGGATGGATGGATGGATAACGG - Intronic
1104552232 12:129767715-129767737 ATGGATGAATGGATAAAGTGTGG - Intronic
1104567607 12:129899325-129899347 ATGGATGGATGGATGGATGATGG + Intronic
1104769063 12:131349231-131349253 ATGCAGAAATGGAGGGAGAAGGG + Intergenic
1104778404 12:131404630-131404652 ATGGATGGATGGATGGATGATGG - Intergenic
1104778423 12:131404708-131404730 ATGGATGGATGGATGGATGATGG - Intergenic
1104896313 12:132166671-132166693 ATGGGTGAATGGATGGATGATGG - Intergenic
1104896439 12:132167148-132167170 GTGGATGAATGGATGGATAAGGG - Intergenic
1104968083 12:132518511-132518533 ATGCATGCATGCATGGTGGATGG - Intronic
1105016451 12:132788759-132788781 GTGCATGAAGGGAGGGAGTGAGG - Intronic
1105947588 13:25202832-25202854 AGGCGGGAATGGATGGAGTCGGG + Intergenic
1106000584 13:25719479-25719501 ATGGATGGATGGATGGATGATGG + Intronic
1106586324 13:31059267-31059289 ATGCATGAATAAATGGGGGAAGG + Intergenic
1106636811 13:31537692-31537714 ATGCATTATTGGCTGGAGTGGGG + Intergenic
1107438172 13:40400484-40400506 ATGAATGAATGAATGAAGAATGG + Intergenic
1107836957 13:44420070-44420092 ATGAATGAATGAATGGAAAAGGG - Intergenic
1108461930 13:50675604-50675626 AGGCTTGGAAGGATGGAGTAGGG - Intronic
1109791708 13:67257405-67257427 ATGCAGTCATTGATGGAGTAAGG - Intergenic
1110199982 13:72838640-72838662 GTGTATGAATGGTTGAAGTATGG + Intronic
1110382162 13:74865312-74865334 ATGGATGGATGGATGGAGGGAGG - Intergenic
1110752517 13:79131803-79131825 TTGAATGAATGGATGGATGAAGG - Intergenic
1110907114 13:80905150-80905172 ATACATGAATGGATTCAGAATGG + Intergenic
1111105135 13:83635451-83635473 AAACAAGAATGGATGGAGTGAGG + Intergenic
1112951650 13:105005006-105005028 ATGAATGAAGGGATGGGGTGGGG - Intergenic
1113072883 13:106438685-106438707 ATGGATGGATGGATGGATGATGG + Intergenic
1113224736 13:108147356-108147378 ATGGCTGAATAGATGGAGGATGG - Intergenic
1113224762 13:108147503-108147525 ATGACTGAATAGATGGAGGATGG - Intergenic
1113224791 13:108147699-108147721 ATGACTGAATAGATGGAGGATGG - Intergenic
1113224811 13:108147797-108147819 ATGGCTGAATAGATGGAGGATGG - Intergenic
1113224821 13:108147845-108147867 ATGATTGAATAGATGGAGGATGG - Intergenic
1113224840 13:108147943-108147965 ATGGCTGAATAGATGGAGGATGG - Intergenic
1113224862 13:108148040-108148062 ATGACTGAATAGATGGAGGATGG - Intergenic
1113224873 13:108148089-108148111 ATGACTGAATAGATGGAGGATGG - Intergenic
1113417572 13:110140288-110140310 ATGGATGGATGGATGGTGGATGG + Intergenic
1113824792 13:113243341-113243363 CTGCATGCATGGGTGGAGGAGGG + Intronic
1113852283 13:113424665-113424687 ATAGATGAATGGATGGTGAATGG - Intronic
1113901128 13:113798719-113798741 ATGGATGGATGGATGAAGTATGG + Intronic
1116079062 14:40150322-40150344 ATGAATGAATGAATGAAGGAAGG - Intergenic
1116164612 14:41318647-41318669 ATGCATGTATGTGTGGAGTATGG - Intergenic
1116268397 14:42727190-42727212 ATGGATGGATGGATGGAAGATGG - Intergenic
1117016636 14:51525172-51525194 ATGGATGGATGGATGGATAAAGG + Intronic
1117325774 14:54667793-54667815 AAGCATGAATGCATGGTGTGTGG - Intronic
1117449077 14:55833507-55833529 ATGGATGGATGGATGGATTTTGG - Intergenic
1118190015 14:63571748-63571770 TTGAATGAGTGGACGGAGTAAGG - Intergenic
1118823964 14:69363683-69363705 ATGAATGAATGAATGGAATGAGG + Intergenic
1120725856 14:87940297-87940319 ATACATGACTGGATTGAATATGG + Intronic
1120734712 14:88040094-88040116 ATGAATGAATGAATGAATTATGG - Intergenic
1121062234 14:90923425-90923447 ATGGATGGATGGATGGATGATGG - Intronic
1121096547 14:91221432-91221454 ATGCATGGATGGATGGGTGATGG + Intronic
1121096560 14:91221494-91221516 ATGCATGGATGGATGGATAGTGG + Intronic
1121277443 14:92677908-92677930 ATGCATGGATGGATGACGGATGG - Intronic
1121277444 14:92677912-92677934 ATGGATGCATGGATGGATGACGG - Intronic
1121423186 14:93830050-93830072 ATGGATGGATGGATGGTGGATGG + Intergenic
1121423210 14:93830168-93830190 ATGGATGGATAGATGGAGGAAGG + Intergenic
1121428027 14:93866660-93866682 ATGCATGGCTGGATGGATGATGG - Intergenic
1121739969 14:96244806-96244828 ATGGATGCATGGATGGAGGAGGG - Intronic
1121824938 14:97002450-97002472 ATGGATGGATGGATGGGGGATGG - Intergenic
1122109083 14:99482431-99482453 ATGAAAGAATGGATGGATGATGG + Intronic
1122275759 14:100589960-100589982 ATGCATGGATGGATGGAGGTGGG + Intergenic
1122813205 14:104299117-104299139 ATGGATGGATGGATGGAAGATGG - Intergenic
1122915055 14:104854813-104854835 AAGGATGAATGTAAGGAGTAGGG + Intergenic
1123058853 14:105585428-105585450 ATGGATGAGTGGATGAAGGATGG - Intergenic
1123058861 14:105585462-105585484 ATGGATGGATGGATGAAGGATGG - Intergenic
1123083171 14:105705609-105705631 ATGGATGGATGGATGGATGATGG - Intergenic
1124395798 15:29300316-29300338 ATGGATGGATGGATGGATGATGG + Intronic
1124555780 15:30724460-30724482 ATGGATGGATGGATGGAGACAGG + Intronic
1124675499 15:31681288-31681310 ATGGATGGATGGATGGAGACAGG - Intronic
1125431837 15:39603211-39603233 ATGAATGAATGGATGGCAGATGG + Intronic
1126463126 15:48935188-48935210 ATGTATGAATGGATGAATAATGG + Intronic
1127500785 15:59552297-59552319 GTGTATGAATGGTTGAAGTATGG + Intergenic
1127620444 15:60728689-60728711 TTGCATTAATGAATGGAGCAGGG - Intronic
1127859816 15:62984080-62984102 GTGTATGAATGGTTGAAGTATGG - Intergenic
1128265211 15:66260117-66260139 ATGGATGAATGAATGGATGATGG + Intergenic
1128440616 15:67705231-67705253 ATGCATAAATGAATGTAGAAAGG - Intronic
1128518934 15:68362660-68362682 ATGGATAAATGGATGGAAGATGG + Intronic
1128554583 15:68622664-68622686 ATGAATGAATGAATGGGGTGTGG - Intronic
1128565302 15:68697103-68697125 ATGGATGGATGGATGGATTGTGG + Intronic
1129266100 15:74394008-74394030 ATGAATGAGTGAATGGATTAGGG + Intergenic
1129572311 15:76700822-76700844 AAGCATGAATGTATGAAGTCAGG + Intronic
1130353603 15:83111213-83111235 ATGGGTGAATGTATGGAGGATGG - Intronic
1130353607 15:83111232-83111254 ATGAGTGGATGGATGGAGTATGG - Intronic
1130353615 15:83111287-83111309 ATGGATGAATTGATGGATGATGG - Intronic
1130353623 15:83111339-83111361 ATGGATGAATTGATGGATGATGG - Intronic
1130353634 15:83111400-83111422 ATGAATGGATGGATGGATGATGG - Intronic
1130353638 15:83111423-83111445 ATGGATGAATGGATAGATGATGG - Intronic
1130733831 15:86527928-86527950 ATGGATGAATGGATGATGGATGG - Intronic
1131218941 15:90564807-90564829 AGGCAGGAATGGATAGAGTATGG + Intronic
1132019070 15:98344857-98344879 ATGAATGGATGGATGGTGGATGG + Intergenic
1132030850 15:98437694-98437716 ATGGATGGATGGATGGAGGATGG + Exonic
1132030857 15:98437721-98437743 ATGGATGGATGGATGGATGATGG + Exonic
1132030864 15:98437755-98437777 ATGAATGGATGGATGGAGGATGG + Exonic
1132030881 15:98437847-98437869 ATGGATGGATGGATGGAAGATGG + Exonic
1132030902 15:98437928-98437950 ATAGATGGATGGATGGAGGATGG + Exonic
1132030914 15:98437981-98438003 ATGGATGGATGGATGGATGATGG + Exonic
1132030931 15:98438060-98438082 ATGGATGAATGGATGGATGGAGG + Exonic
1132653736 16:1032936-1032958 ATGGATGGATGGATGGATGATGG - Intergenic
1132653854 16:1033506-1033528 ATGGATGGATGGATGGATGATGG - Intergenic
1133204833 16:4227056-4227078 ATGGATGGATGGATGGATGATGG + Intronic
1133326833 16:4947077-4947099 ATGAATGGATGGATGGAGGAAGG - Intronic
1133326834 16:4947081-4947103 ATGGATGAATGGATGGATGGAGG - Intronic
1133326873 16:4947257-4947279 ATGGATGGATGGATGGAGGAAGG - Intronic
1133370790 16:5244269-5244291 GTGCATGAGGGGATGGAGGATGG - Intergenic
1133456144 16:5944015-5944037 CTGGATGAATGGATGGTGGATGG - Intergenic
1133530914 16:6653993-6654015 ATGGATGGATGGATAGAGGAAGG + Intronic
1133554397 16:6891096-6891118 ATGAATGAATGGATGGATATTGG - Intronic
1133862495 16:9609399-9609421 ATGAATGGATGGATGAATTATGG + Intergenic
1133965929 16:10531777-10531799 ATGAATGAATGAATGGTGGATGG + Exonic
1134132378 16:11658504-11658526 ATGAATGAATGGATGCAGGCAGG - Intergenic
1134226192 16:12392437-12392459 ATGGATGAATGGCTGGAGCAGGG - Intronic
1134488430 16:14677723-14677745 ATGGATGGATGGATGGATGATGG + Intronic
1134488468 16:14677903-14677925 AAGAATGAATGGATGGATGATGG + Intronic
1134554788 16:15155436-15155458 ATAAATGAATGGATGGGGAATGG - Intergenic
1134632237 16:15765161-15765183 ATGAATAAATGGATAGAGGATGG + Intronic
1134788004 16:16962459-16962481 ATGGATGGATGGATGGATGAAGG + Intergenic
1134848573 16:17461569-17461591 ATGGATGAATGGACAGAGGATGG + Intronic
1134848590 16:17461684-17461706 ATGCATAAATAGATGGAGGCAGG + Intronic
1135156501 16:20057565-20057587 ATGGAAGGATGGATGGAGGAAGG - Intronic
1135283284 16:21171509-21171531 ATGCATGAATGAATGGATGGAGG + Intronic
1135548100 16:23379081-23379103 AGGGATGAATGGGTGGAGGATGG - Intronic
1135548123 16:23379173-23379195 AGGGATGAATGGGTGGAGGATGG - Intronic
1135894069 16:26382753-26382775 GTGCATAAAGGGAGGGAGTACGG + Intergenic
1135949851 16:26903793-26903815 ATGGATGGATGGATGGCATATGG + Intergenic
1136071396 16:27789700-27789722 ATGGATGGATGGATGGATGATGG + Exonic
1136071407 16:27789776-27789798 ATGGATGAATGGATAGATAATGG + Exonic
1136071449 16:27790060-27790082 ATGGATGAATGGATAGATGATGG + Exonic
1136071468 16:27790214-27790236 ATGAATGGATGGATGGATAATGG + Exonic
1136290811 16:29270303-29270325 ATGGATGGATGGATGGATAAAGG + Intergenic
1137386142 16:48044181-48044203 ATGAATGGATGGATGGATGATGG - Intergenic
1137580085 16:49628245-49628267 ATGGATGGGTAGATGGAGTATGG - Intronic
1137601623 16:49760170-49760192 ATGGATGGATGGATGGATGAGGG + Intronic
1137625611 16:49906099-49906121 ATGGATGGATGGATGGATGATGG + Intergenic
1137633402 16:49964685-49964707 ATGAATGAATGAATGAGGTAGGG - Intergenic
1137811184 16:51354322-51354344 ATAGATGAATGGATAGAGGATGG - Intergenic
1138244035 16:55453097-55453119 ATGGATGGATGGATGGATAAAGG - Intronic
1138440362 16:57030648-57030670 ATGGATGGATGGATGGATGAAGG + Intronic
1138495671 16:57407745-57407767 ATGGATGGATGGATGGATGATGG - Intronic
1138495765 16:57408309-57408331 GTGAATGGATGGATGGAGGATGG - Intronic
1138524100 16:57591949-57591971 ACGGATGAATGGATGGAGGCTGG - Intergenic
1138547764 16:57729691-57729713 ATGGATGGATGGATGGATGATGG + Intronic
1138547854 16:57730050-57730072 ATGGATGGATGGATGGATGATGG + Intronic
1138748133 16:59387292-59387314 GTGCATGCAAGGATGGAGGATGG + Intergenic
1139982663 16:70872525-70872547 ATGGATGAATGGATGATGGATGG - Intronic
1139982737 16:70872795-70872817 CTGCATGGATGGATGGATGATGG - Intronic
1140781509 16:78301032-78301054 ATGCATGGATGGATGATGGATGG - Intronic
1140863654 16:79040921-79040943 ACGCATCCATGGATGGAGCATGG + Intronic
1140917140 16:79504595-79504617 ATGGATAAATGGATAGAGGATGG + Intergenic
1140970920 16:80011491-80011513 ATGCATGAATGGATAAAATATGG - Intergenic
1141032001 16:80597138-80597160 ATGCATGGATGGTTGGATGATGG + Intergenic
1141110129 16:81265418-81265440 ATGAATGGATGGATGGTGGATGG - Intronic
1141110130 16:81265422-81265444 ATGGATGAATGGATGGATGGTGG - Intronic
1141110182 16:81265620-81265642 ATGAATGGATGGATGGTGGATGG - Intronic
1141110183 16:81265624-81265646 ATGGATGAATGGATGGATGGTGG - Intronic
1141115133 16:81302031-81302053 ATGGATGGATGGATGGAGCTGGG - Intergenic
1141283390 16:82649300-82649322 ATGAATGCATAGATGGAGGATGG + Intronic
1141299073 16:82796260-82796282 ATGGATGTATGGAGGGAGTATGG + Intronic
1141314305 16:82946212-82946234 ATGGATGAATGGAGGGAGGGAGG + Intronic
1141421616 16:83921379-83921401 ATGGATAGATGGATGGAGGAGGG + Exonic
1141430287 16:83967756-83967778 ATGGATGGATGGATGGAGGGTGG + Intergenic
1141606498 16:85156941-85156963 ATGGATGGATGGATGGAGAAAGG - Intergenic
1141641943 16:85346612-85346634 ATGGATGGATGGATGGATGATGG + Intergenic
1141641988 16:85346821-85346843 ATGGATGGATGGATGGATGATGG + Intergenic
1141650012 16:85387932-85387954 ATGGATGGATGGATGGATAAAGG + Intergenic
1141854827 16:86673844-86673866 ATGGATGAAGGGATGGAGGGAGG - Intergenic
1141854853 16:86673963-86673985 ATGGATGAAGGGATGGAGGGAGG - Intergenic
1141854867 16:86674014-86674036 ATGGATGAAGGGATGGAGGGGGG - Intergenic
1142096683 16:88243771-88243793 ATGCAAGGATGGATGGATAAAGG + Intergenic
1142152470 16:88518757-88518779 ATGGATGGATGGATGGATGATGG + Intronic
1142152563 16:88519134-88519156 ATGGATGGATGGATGGATGATGG + Intronic
1142933720 17:3310045-3310067 ATCCATGAATTGATGTAGAAAGG - Intergenic
1142960532 17:3549715-3549737 ATGGATGGATGGATGGAGGATGG + Intronic
1142960552 17:3549877-3549899 ATGGATGGATGGATGGAGGATGG + Intronic
1143301240 17:5912083-5912105 ATGGATGAATGGATGGAAGATGG - Intronic
1143301246 17:5912118-5912140 ATGGATGAATGGATGGAAGATGG - Intronic
1143301490 17:5913855-5913877 ATGGATGGATGGATGGAAGATGG - Intronic
1143496162 17:7313858-7313880 ATGCATGGATGGAAGTACTAGGG + Intronic
1143766321 17:9139903-9139925 ATGGATGAATGGATGGATGATGG - Intronic
1143766328 17:9139945-9139967 ATGGATGAATGAATGGATGATGG - Intronic
1143858160 17:9868126-9868148 ATGAATGAATGAAAGGAGAAAGG + Intronic
1144100697 17:11939828-11939850 ATGGATGGATGGATGGATGATGG + Intronic
1144481087 17:15629575-15629597 ATGAATGAATGGATCAAATATGG - Intronic
1144482846 17:15641754-15641776 ATGAATGGATGGATGGATGATGG + Intronic
1144915840 17:18723277-18723299 ATGAATGGATGGATGGATGATGG - Intronic
1145262410 17:21362340-21362362 ATGAATGGATGGATGGATGATGG + Intergenic
1145262425 17:21362479-21362501 ATGCATGGATGGATGGATGATGG + Intergenic
1145271658 17:21407990-21408012 ATGGATGGATGGATGGATGATGG - Intronic
1145819932 17:27824433-27824455 ATGGATGAAGTGATGGAGGAGGG - Intronic
1145898168 17:28472861-28472883 ATGGATGGATGGATGGATGATGG + Intronic
1145978737 17:28999103-28999125 AAGGATGGATGGATGGAGGATGG + Intronic
1146239342 17:31202436-31202458 CTGCAGGAATGGATAGAATATGG - Intronic
1146489236 17:33268338-33268360 ATGGATGGATGGATGGATGATGG - Intronic
1146629598 17:34460279-34460301 ATGAATGAATTGGTGGAGTTTGG + Intergenic
1146820918 17:35983061-35983083 ATGGATGGATGGATGAAGGAAGG - Intergenic
1146820919 17:35983065-35983087 ATGGATGGATGGATGGATGAAGG - Intergenic
1147977503 17:44256183-44256205 ATGGATGAATAGATGGATAATGG - Intronic
1148190203 17:45672949-45672971 ATGAATGAATGAATGAAGAAAGG + Intergenic
1148235965 17:45969392-45969414 ATGCATGATTGGGTGGAGGGAGG - Intronic
1148826637 17:50398724-50398746 ATGAATGAATGAATGAAGGAAGG + Intergenic
1150291912 17:63987239-63987261 ATGCATGAAAGGCTGGGGTGAGG + Intergenic
1150439050 17:65176973-65176995 GTGTACGAATGGATGGAGGAAGG - Intronic
1150631426 17:66883050-66883072 ATGGAAGAATGGATGGATGATGG - Intronic
1150680320 17:67279302-67279324 GTGTATGAATGGCTGAAGTATGG - Intergenic
1151009304 17:70474859-70474881 GTGTATGAATGGTTGAAGTACGG - Intergenic
1151030549 17:70733029-70733051 GTGTATGAATGGTTGAAGTATGG + Intergenic
1152006601 17:77686084-77686106 ATGGATGGATAGATGGAGGAAGG - Intergenic
1152034054 17:77861163-77861185 ATGGATGAATGGATGGAGGATGG + Intergenic
1152038019 17:77885225-77885247 ATGGATGGATGGATGGAGGATGG + Intergenic
1152301845 17:79499465-79499487 ATGAATGAATGGATGGTGGATGG - Intronic
1152773290 17:82184156-82184178 ATGCATGCATGGAGGTAGTTGGG - Intronic
1153266411 18:3274637-3274659 GTGTATGAATGGTTGAAGTATGG + Intronic
1153381338 18:4442993-4443015 ATGAATGAATGGATTGACAATGG + Intronic
1153666576 18:7371872-7371894 ATGCAAGAATGCAGGGAGGAAGG + Intergenic
1155403573 18:25463955-25463977 ATGAATGAATGAATGAAGGAAGG - Intergenic
1155539319 18:26850728-26850750 ATGGATGGATGGATGGATGATGG - Intergenic
1156399373 18:36727000-36727022 ATGGATGGATGGATGGGTTAGGG + Intronic
1156471604 18:37380535-37380557 ATGGATAGATGGATGGAGAATGG - Intronic
1156471694 18:37381107-37381129 ATGGATGGATGGATGGATGATGG - Intronic
1157177590 18:45465569-45465591 ATGCATGGATGGATGGATGAAGG - Intronic
1157502870 18:48203205-48203227 GTGCATGAATTCCTGGAGTATGG - Intronic
1157976059 18:52328163-52328185 GTGCATGAGTGGTTGAAGTATGG + Intergenic
1158549075 18:58419656-58419678 ATGCATGGATGGATGATGCATGG + Intergenic
1158549077 18:58419671-58419693 ATGCATGGATGGATGATGCATGG + Intergenic
1160226787 18:77018217-77018239 ATGGATGAGTGGATGGGGGATGG - Intronic
1160226824 18:77018384-77018406 ATGGATGAGTGGATGGGGGATGG - Intronic
1160226857 18:77018553-77018575 ATGGATGAGTGGATGGGGGATGG - Intronic
1160226888 18:77018689-77018711 ATGTATGAGTGGATGGGGGATGG - Intronic
1160502432 18:79408802-79408824 ATGAATGAATGGATAGGGAATGG - Intronic
1160502455 18:79408928-79408950 ATGAATGAATGGATAGGGAATGG - Intronic
1160502478 18:79409057-79409079 ATGAATGAATGGATAGGGAATGG - Intronic
1160502519 18:79409294-79409316 ATGGAGGAATGGATGGATGATGG - Intronic
1160502523 18:79409313-79409335 ATGAATGAATGGATAGGGAATGG - Intronic
1160502561 18:79409525-79409547 GTGGATGAATGGATGGATGATGG - Intronic
1160526659 18:79542553-79542575 ATGAATGAATGGATGGATGGTGG - Intergenic
1160926593 19:1549637-1549659 ATGGATGGATGGATGGATGAAGG - Intergenic
1160960241 19:1717713-1717735 ATGGATGGATGGATGGAACATGG + Intergenic
1161049782 19:2157095-2157117 ATGGATGGATGGATGGATGATGG - Intronic
1161242828 19:3231988-3232010 ATGAATGGATGGATGGATGATGG + Intronic
1161287624 19:3477108-3477130 ATGGATGGATGGATGGATCATGG + Intronic
1161329088 19:3677949-3677971 AGGGATGGATGGATGGAGGATGG + Intronic
1161449122 19:4334806-4334828 ATGGATGAGTGGATGGATGATGG - Intronic
1161449147 19:4334921-4334943 GTGGATGGATGGATGGATTATGG - Intronic
1161449217 19:4335243-4335265 ATGCATGGATGGATGATGGATGG - Intronic
1161449218 19:4335247-4335269 ATGAATGCATGGATGGATGATGG - Intronic
1161498838 19:4602114-4602136 ATAAATGAATGGATGGATTATGG + Intergenic
1161632895 19:5367876-5367898 ATGAATGGATGGATGGGTTACGG + Intergenic
1161657498 19:5525098-5525120 ATGGGTGAATGGATGGATGATGG - Intergenic
1161768977 19:6221247-6221269 ATGAATGAATGGATGGATGAGGG - Intronic
1161774361 19:6250856-6250878 ATGGATGAATGGATAAAGTGTGG + Intronic
1161844673 19:6706065-6706087 ATGCATGCATGAATGAAGAAGGG + Intronic
1161933779 19:7358321-7358343 ATGGATGAATGGATGTTGAATGG - Intronic
1162062943 19:8107735-8107757 AAGGAAGAATGGATGGAGGATGG + Intronic
1162112519 19:8407614-8407636 ATGAATGAATGAATGGAGACTGG + Intronic
1162155990 19:8678257-8678279 ATGCATGGATAAATGGAGGATGG - Intergenic
1162180842 19:8867693-8867715 ATGGATGGATGGATGGTGGATGG + Intronic
1162321267 19:9972046-9972068 ATGCATGAATGAATGGACAGAGG - Intronic
1162681799 19:12349768-12349790 ATGCATGAATGTAAGGAATGTGG - Exonic
1163218175 19:15895988-15896010 ATGGATGGATGGATGGATGATGG - Intronic
1163238372 19:16043190-16043212 ATGGATGAATGGATGCAGGGAGG + Intergenic
1163238405 19:16043317-16043339 ATGGATGAATGGAGGGAGGGAGG + Intergenic
1163238425 19:16043381-16043403 ATGGATGAATGGGTGGAGGATGG + Intergenic
1163238454 19:16043500-16043522 ATGGATGAATGGATGGAGGGAGG + Intergenic
1163383546 19:16985272-16985294 GTGGATGAATGGATGGATGAAGG + Intronic
1163383551 19:16985299-16985321 ATGTATGGATGGATGGATGAAGG + Intronic
1163383586 19:16985456-16985478 ATGGATGGATGGATGGATGAAGG + Intronic
1163409629 19:17145936-17145958 ATGGATGGATGGATGGATGATGG + Intronic
1163462268 19:17446181-17446203 ATGGATGGATGGATGGATGAGGG - Intronic
1163609980 19:18295650-18295672 ATGGATGAGTGGATGGTGGATGG - Intergenic
1163609990 19:18295695-18295717 ATGGATGAGTGGATGGTGGATGG - Intergenic
1163609997 19:18295729-18295751 ATGGATGGATGGATGGTGGATGG - Intergenic
1163703619 19:18799553-18799575 ATGAATGGATGTATGGAGGATGG + Intergenic
1164694627 19:30234047-30234069 ATGCATGAAGAGATGCAGGAAGG + Intronic
1164706510 19:30324033-30324055 ATGGATAGATGGATGGAGGATGG - Intronic
1164732960 19:30519736-30519758 ATGAATGAATGAATGGTGTTGGG - Intronic
1164797296 19:31044403-31044425 ATGGATGGATGGATGGATGAAGG + Intergenic
1164797309 19:31044515-31044537 ATGGCTGAATGGATGGATGAAGG + Intergenic
1164829616 19:31310455-31310477 ATGGATGAATGGATGAACTCAGG + Intronic
1165144390 19:33722093-33722115 ATGGATGGATGGATGGATGAAGG + Intronic
1165787073 19:38468045-38468067 ATGGATGGATGGATGGATGATGG - Intronic
1165787101 19:38468204-38468226 ATGGATGGATGGATGGATGATGG - Intronic
1166136246 19:40778710-40778732 CTGCATGAATGGCAGGAGTCGGG + Intronic
1166647678 19:44544195-44544217 ATGGATGGATGGATGGATGACGG - Intergenic
1166935600 19:46330604-46330626 ATGGATGCATGGATGGTGGATGG + Intronic
1166935606 19:46330627-46330649 ATGGATGGATGGATGGTGGATGG + Intronic
1166935621 19:46330707-46330729 ATGGATGGATGGATGGTGGATGG + Intronic
1166935641 19:46330792-46330814 ATGGATGGATGGATGGTGGATGG + Intronic
1167086853 19:47315932-47315954 ATGGATGGATGGATGGATAATGG - Intronic
1167144159 19:47672101-47672123 ATGGATGGAAGGATGGAGGATGG + Intronic
1167144166 19:47672132-47672154 ATGGATGGAAGGATGGAGCATGG + Intronic
1167144174 19:47672163-47672185 ATGGATGGAAGGATGGAGGATGG + Intronic
1167144182 19:47672194-47672216 ATGGATGGAAGGATGGAGGATGG + Intronic
1167144213 19:47672316-47672338 ATGGATGGAAGGATGGAGGATGG + Intronic
1167144221 19:47672347-47672369 ATGGATGGAAGGATGGAGGATGG + Intronic
1167144229 19:47672378-47672400 ATGGATGGAAGGATGGAGGATGG + Intronic
1167144273 19:47672585-47672607 ATGGATGGATGGATGGAGGCAGG + Intronic
1167161417 19:47769727-47769749 ATGGATGGATGGATGGATGATGG - Intergenic
1167161425 19:47769762-47769784 ATGGATGGATGGATGGATGATGG - Intergenic
1167168964 19:47818337-47818359 ATGGATGGATGGATGGATGATGG - Intronic
1167277626 19:48548433-48548455 ATGGATGAATGGATAGATGAAGG + Intergenic
1167556046 19:50196394-50196416 ATGGATGGATGGATGGATGATGG - Intronic
1167601287 19:50456289-50456311 ATGGATGGATGGATGGATGATGG - Intronic
1167639274 19:50671692-50671714 ATGAATGAATGGATGGAATCGGG + Intronic
1167701006 19:51045669-51045691 GTGTATGAATGGTTGAAGTATGG - Intergenic
1168330930 19:55568082-55568104 ATGCATAGATGGATGGATGATGG + Intergenic
1168330961 19:55568266-55568288 ATGAATAGATGGATGGATTATGG + Intergenic
1168508267 19:56954585-56954607 ATGGATGGATGGATGGATAAGGG - Intergenic
925253279 2:2460776-2460798 ATGCAACAATGGAAGGAGCATGG - Intergenic
925306820 2:2853266-2853288 ATGCATGCATGCATGTAGTGTGG - Intergenic
925454942 2:4008053-4008075 AGGCAAGAATGGAGGGAGGAGGG + Intergenic
925489250 2:4373838-4373860 ATGGATAAATGGATGGAATAAGG - Intergenic
925541185 2:4969547-4969569 ATGGATGGATGGATGGATGATGG - Intergenic
925925605 2:8667993-8668015 ATGAATGGATGGATGGATGAAGG + Intergenic
925925640 2:8668184-8668206 ATGGGTGAATGGATGGATAAAGG + Intergenic
925925649 2:8668234-8668256 ATAAATGAATGGATGGATGAAGG + Intergenic
925925677 2:8668372-8668394 ATGGATGGATGGATGGATGAAGG + Intergenic
926214018 2:10892604-10892626 ATGGATGGATGGATGGAAGAAGG - Intergenic
926521531 2:13921922-13921944 GTGTATGAATGGTTGAAGTATGG - Intergenic
926522174 2:13928898-13928920 GTGTATGAATGGTTGAAGTATGG - Intergenic
926698577 2:15787626-15787648 ATGGATGGATGGATGGAGATTGG - Intergenic
926698637 2:15787991-15788013 ATGGATGAATGGATGGAGTATGG - Intergenic
926910376 2:17847381-17847403 ATGTATGAGTGGTTGAAGTATGG - Intergenic
927197747 2:20559732-20559754 ATGGATGGATGGATGGATGATGG + Intergenic
928177512 2:29044965-29044987 ATGGATGGATGGATGGATGATGG - Intronic
928638143 2:33269094-33269116 ATGAATGAATGAATGGAGTCTGG - Intronic
929154701 2:38778991-38779013 ATGAGTGAATGGATGAAGAAAGG + Exonic
931021542 2:58049888-58049910 ATGAATGAATGAATGAAGTTTGG + Intronic
931169179 2:59784511-59784533 ATGAATGGATGGATGGTGAATGG + Intergenic
931972339 2:67602639-67602661 ATGGATGGATGGATGGATGATGG + Intergenic
932323209 2:70837116-70837138 ATGGATGAATGGATGGATAGAGG + Intergenic
932330914 2:70897836-70897858 GTGCATGCGGGGATGGAGTAAGG - Intergenic
932463159 2:71896400-71896422 ATGGATGGATGGTTGGAGGAGGG + Intergenic
933248246 2:79999648-79999670 ATGGATGAATGGACAGAGGAAGG - Intronic
933563806 2:83924185-83924207 ATGAATGAATGGAGGGATGATGG - Intergenic
934052915 2:88225285-88225307 ATGAATGAATGGAAGAAGGAGGG + Intergenic
934613895 2:95759599-95759621 ATGAATGAATGGATGGATGGAGG + Intergenic
934639287 2:96017655-96017677 ATGCAATAATGGATTCAGTAAGG - Intergenic
934647005 2:96064745-96064767 ATGAATGAATGGATGGTAGATGG - Intergenic
934840380 2:97620621-97620643 ATGAATGAATGGATGGTAGATGG - Intergenic
935637136 2:105257998-105258020 ATGAATGAATGAATGGAAAATGG + Intergenic
935782255 2:106518670-106518692 AGGAATGAATGGATGGTGAATGG - Intergenic
935782322 2:106519059-106519081 ATGGATGGATGGATGGATGATGG - Intergenic
935885191 2:107610773-107610795 GTGTATGAATGGTTGAAGTATGG - Intergenic
936243980 2:110810636-110810658 ATGGATGGATGGATGGATGATGG - Intronic
936287750 2:111194197-111194219 GTGCATGAATGAATGAAGGAAGG - Intergenic
936615951 2:114047987-114048009 ATGGACGGATGGATGGAGGATGG - Intergenic
937106219 2:119316019-119316041 ATGCAGCAATGAATGGAGAATGG + Intronic
937207231 2:120244613-120244635 ATGGATGGATGGATGGATGAGGG - Intronic
937268490 2:120632292-120632314 ATGGATGGATGGATGGGGGACGG + Intergenic
937579555 2:123467760-123467782 GTGTATGAATGGTTGAAGTATGG + Intergenic
937795173 2:126009001-126009023 ATGCATGTGTGGAGGGGGTAGGG + Intergenic
938108034 2:128546613-128546635 ATGGATGCATGGATGGATAATGG - Intergenic
938108073 2:128546804-128546826 ATGGATGGATGGATGGAGAATGG - Intergenic
938108082 2:128546855-128546877 ATGAATGAATGGGTGGATAATGG - Intergenic
938108109 2:128546969-128546991 ATGGATGCATGGATGGATAATGG - Intergenic
938108119 2:128547012-128547034 ATGGATGAATGGGTGGATAATGG - Intergenic
938108156 2:128547180-128547202 ATGGATGGATAGATGGAGAATGG - Intergenic
938140476 2:128790880-128790902 GTGCACGAATGGTTGAAGTACGG - Intergenic
938169566 2:129062963-129062985 ATGGATGGATGGATGGATGATGG - Intergenic
939115531 2:138056276-138056298 ATGCATGATATGATGAAGTAGGG + Intergenic
939237271 2:139512219-139512241 ATGGATGAATGGATAGAGGAGGG - Intergenic
940866291 2:158820743-158820765 ATGCATTAATCCATGCAGTAGGG - Intronic
942104228 2:172616564-172616586 ATGGTTGCATGGATGGAATAGGG + Intergenic
944309602 2:198218671-198218693 AAGCATGAAGGAAGGGAGTAGGG + Intronic
946211405 2:218150196-218150218 ATGCAGGAAAGGGTGGAGGAAGG - Intergenic
946672496 2:222121231-222121253 AAGAAGGAATGGATGGAGGAAGG + Intergenic
946888395 2:224247527-224247549 CTGTATGAATGGTTGAAGTACGG + Intergenic
947233680 2:227918168-227918190 ATGGATGGATGGATGGATGATGG - Intronic
948067348 2:235091116-235091138 ATGGATGGATGGATGGGGGAGGG - Intergenic
948246416 2:236489585-236489607 ATGCATGGATGGAAGCAGAAGGG + Intronic
948458503 2:238118255-238118277 ATGGAGGAATGGATGGTGGAGGG + Intronic
948514418 2:238494769-238494791 ATGCGTGAATGAATGGCGTGAGG - Intergenic
949065739 2:241989524-241989546 ATGGATGAATGGATGGTGGGTGG - Intergenic
949065752 2:241989576-241989598 ATGGATGGATGGATGGTGGATGG - Intergenic
949065765 2:241989631-241989653 ATGGATGGATGGATGGTGGATGG - Intergenic
949065798 2:241989774-241989796 ATGGATGAATGGATGGTGGATGG - Intergenic
949065806 2:241989811-241989833 ATGGATGGATGGATGGTGGATGG - Intergenic
949065816 2:241989849-241989871 ATGGATGAATGGATGGTGGGTGG - Intergenic
949065828 2:241989902-241989924 ATGGATGCATGGATGGTGGATGG - Intergenic
949065854 2:241990011-241990033 ATGGATGGATGGATGGATGATGG - Intergenic
949065879 2:241990122-241990144 ATGGATGCATGGATGGTGGATGG - Intergenic
949065883 2:241990141-241990163 ATGGATGCATGGATGGTGGATGG - Intergenic
949065894 2:241990186-241990208 ATGGATGCATGGATGGTGGATGG - Intergenic
949065898 2:241990205-241990227 ATGGATGCATGGATGGTGGATGG - Intergenic
949065906 2:241990238-241990260 ATGGATGCATGGATGGTGGATGG - Intergenic
949065920 2:241990289-241990311 ATGGATGGATGGATGGTGGATGG - Intergenic
949065938 2:241990354-241990376 ATGGATGGATGGATGGTGGATGG - Intergenic
949065955 2:241990422-241990444 ATGGATGGATGGATGGTGGATGG - Intergenic
949065977 2:241990504-241990526 ATGGATGGATGGATGGTGGATGG - Intergenic
949065986 2:241990537-241990559 ATGGATGGATGGATGGTGGATGG - Intergenic
949065992 2:241990560-241990582 ATGGATGGATGGATGGTGGATGG - Intergenic
1168756639 20:323102-323124 ATGCATGCATGGATGGAAGAAGG + Intergenic
1168826224 20:816145-816167 AAGGATGAATGAATGGATTAGGG + Intergenic
1169699200 20:8427697-8427719 ATTCTTGATTGGTTGGAGTAAGG + Intronic
1170361177 20:15548084-15548106 ATGGATGAATGGATGGAGGAAGG - Intronic
1170956595 20:20985636-20985658 ATGAATGAATGAATGGTGAATGG - Intergenic
1171119170 20:22553327-22553349 ATGCATGGATGGAAGGAGGCTGG + Intergenic
1171568188 20:26215575-26215597 AGTGATGAATGGATGGAGCAAGG + Intergenic
1172184908 20:33025436-33025458 ATGGATGAATGAATGGATGATGG - Intergenic
1172203981 20:33148922-33148944 ATGGATGGATGGATGGATGATGG + Intergenic
1172208542 20:33181637-33181659 ATGCATGAATGGATAGATCAGGG - Intergenic
1172377529 20:34456897-34456919 ATGAATGAAATGATGTAGTATGG + Intronic
1172544655 20:35750278-35750300 TTGGATGAATGGATGGACAAAGG - Intergenic
1172783316 20:37450184-37450206 ATGGATGAATGGATGGACAAAGG - Intergenic
1172919510 20:38469413-38469435 ATGGATGGATGGATGGATGAGGG - Intergenic
1173063507 20:39684612-39684634 ATAAATGAATGAATGGTGTATGG + Intergenic
1173378324 20:42510995-42511017 ATTCATGGATTGATGGATTAAGG + Intronic
1173759896 20:45550201-45550223 GTACATGAATGCATGGATTATGG + Intergenic
1173871498 20:46344890-46344912 ATGGATGAATGGATGGTAGATGG - Intergenic
1173871501 20:46344909-46344931 ATGGATGGATGGATGGATGATGG - Intergenic
1173974794 20:47179203-47179225 ATGCATGGATGGATGGATATGGG + Intronic
1174125618 20:48302983-48303005 ATGGATGGATGGATGAAGAATGG - Intergenic
1174125625 20:48303018-48303040 ATGAATGGATGGATGAAGAATGG - Intergenic
1174480948 20:50831130-50831152 TTGCAAGAATGGATGGAGGCTGG + Intronic
1174577288 20:51545573-51545595 ATGGATGCATGGATGGAAGATGG + Intronic
1174577307 20:51545662-51545684 ATGGATGCATGGATGGAAGATGG + Intronic
1174577323 20:51545728-51545750 ATGGAAGAATGGATGGATGATGG + Intronic
1174746942 20:53072906-53072928 AGGGATGAATGGATGGATGAAGG - Intronic
1174746976 20:53073030-53073052 AAGGAGGAATGGATGGAGGAAGG - Intronic
1174747037 20:53073293-53073315 ATGGATGGATGGATGGATGAAGG - Intronic
1174860226 20:54084441-54084463 ATGGATGAATGGATGTAGGGTGG - Intergenic
1175165266 20:57039088-57039110 ATGAATAAATGGATGGATAATGG + Intergenic
1175165322 20:57039411-57039433 ATGGATGGATGGATGGATGATGG + Intergenic
1175301919 20:57948960-57948982 ATGGATGAATGGATGATGGATGG + Intergenic
1175301982 20:57949292-57949314 ATGGATGAATGGATGATGGATGG + Intergenic
1175305302 20:57971789-57971811 AAGGATGGATGGATGGAGGATGG + Intergenic
1175493216 20:59393271-59393293 AAGGATGAATGGATGGATGAAGG - Intergenic
1175687964 20:61045134-61045156 ATTGATGGATGGATGGAGGATGG - Intergenic
1175687983 20:61045213-61045235 ATGGATGAATAGACGGAGGATGG - Intergenic
1175687995 20:61045296-61045318 ATGGATGGATGGATGGTGGATGG - Intergenic
1175688001 20:61045319-61045341 ATGCATGGATGGATGGTGAAAGG - Intergenic
1175754151 20:61518765-61518787 ATGGATGAAAGGATGGATGATGG - Intronic
1175754158 20:61518807-61518829 ATGGATTAATGGATGGATGATGG - Intronic
1175754182 20:61518976-61518998 ATGAATGGATGGATGAAGGATGG - Intronic
1175754183 20:61518980-61519002 ATGGATGAATGGATGGATGAAGG - Intronic
1175772631 20:61633182-61633204 ATGGATGAATGGATGGAGGATGG - Intronic
1175779195 20:61671645-61671667 ATGGGTGAATGGATGGATAATGG + Intronic
1175779244 20:61671862-61671884 ATGGATGGATGGATGGTGGATGG + Intronic
1175781064 20:61682358-61682380 ATGGATGGATGGATGGTGGATGG + Intronic
1175798470 20:61787095-61787117 ATGGATGGATGGATGGATGATGG - Intronic
1175798483 20:61787155-61787177 ATGCATGAATGGATGGATGGAGG - Intronic
1175798968 20:61790164-61790186 ATGGATGAATGGATGACGGATGG - Intronic
1176129965 20:63492590-63492612 ATGCATGGATGGATGGATGGAGG + Intronic
1176286558 21:5022003-5022025 ATGCATGAATGGAAGGAGGGAGG - Intergenic
1178368634 21:32008836-32008858 ATGGATGGATGGATGGTGAATGG + Intronic
1178613908 21:34113337-34113359 GTGGATGAATGGATAAAGTATGG + Intronic
1178666274 21:34549801-34549823 ATGGATGGATGGATGGATGATGG - Intronic
1178689667 21:34740568-34740590 ATGGATGGATGGATGGACGATGG - Intergenic
1178809637 21:35869643-35869665 ATGCATGAATGGATACAAAATGG + Intronic
1178910850 21:36672171-36672193 AAGCATGAATGGATAGAATCAGG + Intergenic
1179006741 21:37521939-37521961 CTGAAAGAATGGATGGAGGAGGG + Intergenic
1179007658 21:37529454-37529476 ATGGATGGATGGATGGAGGGAGG + Intergenic
1179017465 21:37605653-37605675 ATGGATGGATGGATGGATGAAGG - Intergenic
1179474765 21:41636110-41636132 GTGGATGAATGGATGGATGATGG - Intergenic
1179567526 21:42258453-42258475 ATGCATTGAGGGATGGAGGAAGG - Intronic
1179870623 21:44241472-44241494 ATGCATGAATGGAAGGAGGGAGG + Intergenic
1180025105 21:45156380-45156402 ATGGATGGATGGATGGATGATGG - Intronic
1181002418 22:19994117-19994139 ATGGATGAATGAATGGAGGGTGG + Intronic
1181002442 22:19994218-19994240 ATGAATGGATGGATGGGGGATGG + Intronic
1181482150 22:23206966-23206988 ATGGATGGATGGATGGAGGGAGG - Intronic
1181528410 22:23502660-23502682 AGGGATGGAGGGATGGAGTATGG - Intergenic
1181536999 22:23551531-23551553 ATGGGAGAATGGATGGAGAATGG - Intergenic
1181537045 22:23551782-23551804 ATGGGAGAATGGATGGAGGATGG - Intergenic
1181737492 22:24893196-24893218 ATGCATGAATGAATAAAGGAAGG + Intronic
1181824894 22:25507149-25507171 ATGAATAAAAGGATGGAGGATGG - Intergenic
1181879013 22:25962568-25962590 ATGCAGACATGGATGGACTAGGG + Intronic
1181999251 22:26906789-26906811 ATGGAAGAAGGGATGGAGAAAGG + Intergenic
1182010453 22:26996462-26996484 ATGGATGGATGGATGGACTGAGG - Intergenic
1182023757 22:27101486-27101508 ATGGATGGATGGATGGAGAGAGG - Intergenic
1182026942 22:27127376-27127398 ATGAATGAATGAATGAAGGAGGG - Intergenic
1182039081 22:27222380-27222402 ATGGGTGAATGGATGGATGATGG + Intergenic
1182048503 22:27295734-27295756 ATGGATGGATGGATGGATAATGG + Intergenic
1182060722 22:27395243-27395265 ATGCATGGATGGATGAATGATGG + Intergenic
1182060729 22:27395278-27395300 ATGCATGGATGGATGAATGATGG + Intergenic
1182099733 22:27649414-27649436 ATGGATGGATGGATGGATGATGG + Intergenic
1182862079 22:33568868-33568890 ATGGATGGATGGATGGATGATGG + Intronic
1183100062 22:35578439-35578461 ATGGATGGATGGATGGTGGATGG + Intergenic
1183106491 22:35618796-35618818 ATGGATGAATGGAGGGATGATGG - Intronic
1183189662 22:36313771-36313793 AGCCATGCATGGATGTAGTAAGG - Intronic
1183266752 22:36831993-36832015 GTGCATGGATGGATGGATGACGG + Intergenic
1183303932 22:37071974-37071996 ATGGATGGATGGATGGATGATGG + Intronic
1183303944 22:37072028-37072050 ATGAATGGATGGATGGTGGATGG + Intronic
1183303966 22:37072144-37072166 ATGGGTGAATGGATGGATGATGG + Intronic
1183303975 22:37072197-37072219 ATGAATGGATGGATGGATGATGG + Intronic
1183303979 22:37072216-37072238 ATGGATGGATGGATGGATGATGG + Intronic
1183303990 22:37072273-37072295 TTGCATGGATGGATGGATGATGG + Intronic
1183303999 22:37072322-37072344 ATGGATGAATGGATGGATGATGG + Intronic
1183304003 22:37072341-37072363 ATGGATGGATGGATGGATGATGG + Intronic
1183304009 22:37072368-37072390 GTGCATGGATGGATGGATGATGG + Intronic
1183304027 22:37072467-37072489 ATGGATGGATGGATGGATGATGG + Intronic
1183304035 22:37072523-37072545 ATGGATGAATGGATGGATGATGG + Intronic
1183304038 22:37072542-37072564 ATGGATGAATGGATGGATGATGG + Intronic
1183304042 22:37072561-37072583 ATGGATGGATGGATGGATGATGG + Intronic
1183304049 22:37072595-37072617 ATGGATGGATGGATGGATGATGG + Intronic
1183304090 22:37072798-37072820 ATGGATGGATGGATGGATGATGG + Intronic
1183304098 22:37072840-37072862 ATGGATGGATGGATGGATGATGG + Intronic
1183304128 22:37073010-37073032 ATGGATGGATGGATGGATGATGG + Intronic
1183321929 22:37170114-37170136 ATGGATGGATGGATGGATGAAGG + Intronic
1183342206 22:37287644-37287666 ATGCAGGGATGGAAGGTGTAAGG - Intronic
1183600024 22:38834597-38834619 ATGGATGGATGGATGGATGATGG - Intronic
1184089355 22:42284119-42284141 AGGGATGGATGGATGGAGGAGGG + Intronic
1184293097 22:43508664-43508686 ATGGATGAATGCATGGATGATGG - Intergenic
1184293193 22:43508991-43509013 ATGGATGGATGGATGGGGGATGG - Intergenic
1184293202 22:43509018-43509040 ACGGATGGATGGATGGAGGATGG - Intergenic
1184293266 22:43509227-43509249 ATGGATGGATGGATGGGGGATGG - Intergenic
1184321289 22:43743991-43744013 ATGGATGAATGAATGGATGAAGG + Intronic
1184321293 22:43744030-43744052 ATGAATGAATGAATGGGTTATGG + Intronic
1184321301 22:43744104-43744126 ATGAATGAATGGATGGGTTATGG + Intronic
1184389375 22:44194576-44194598 AGGCATGAATGGATGGATGGAGG - Intronic
1184389412 22:44194731-44194753 AAGCATGAATGGATGGATGGAGG - Intronic
1184410416 22:44323022-44323044 ATGGATGGATGGATGGTGGATGG - Intergenic
1184410476 22:44323254-44323276 ATGGATGGATGGATGGTGGATGG - Intergenic
1184410502 22:44323362-44323384 ATGGATGGATGGATGGTGGATGG - Intergenic
1184930765 22:47679633-47679655 ATGGATGGATGGATGGATGATGG - Intergenic
1184930769 22:47679652-47679674 ATGGATGGATGGATGGATGATGG - Intergenic
1184991045 22:48170278-48170300 ATGAATGAATGGATGGAAAGAGG - Intergenic
1184996775 22:48212978-48213000 ATGGATGGATGGATGGATGATGG - Intergenic
1185005498 22:48274179-48274201 ATGAATGGATGGATGGATGAAGG - Intergenic
1185018768 22:48360983-48361005 ATGCATGGATGGATGGAAGCTGG + Intergenic
1185018867 22:48361823-48361845 ATGGATGAATGCATGCAGGAAGG + Intergenic
1185053514 22:48566062-48566084 ATGGATGGATGGATGGATGATGG + Intronic
1185076692 22:48687024-48687046 ATGGATGGATTGATGGAGGATGG + Intronic
1185076745 22:48687265-48687287 GTGGATGAATGGATGGTGGACGG + Intronic
1185104358 22:48858911-48858933 ATGGATGAATGGATGATGGAGGG - Intergenic
1185104427 22:48859202-48859224 AGGGATGGATGGATGGAGGATGG - Intergenic
1185104449 22:48859291-48859313 ATGAATGGATGGATGGATGATGG - Intergenic
1185104467 22:48859355-48859377 ATAGATGAATGGATGGAGGGTGG - Intergenic
1185108523 22:48887690-48887712 ATGAATGGATGGATGGTGGATGG - Intergenic
1185154565 22:49185410-49185432 ATGGATGGATGGATGGTGAATGG - Intergenic
1185165589 22:49260430-49260452 ATGGATGAATGGATGGATGATGG - Intergenic
1185165597 22:49260477-49260499 ATGGATGAATGGATGATGGATGG - Intergenic
1185193336 22:49452606-49452628 ATGTGTGAATGGATGGATGATGG + Intronic
1185193499 22:49453471-49453493 AAGGATGGATGGATGGAGCATGG + Intronic
1185196791 22:49476767-49476789 ATGGATGAATGGATGCTGGATGG + Intronic
1185196810 22:49476847-49476869 ATGGATGGATGGATGGTGGATGG + Intronic
1185196815 22:49476870-49476892 ATGGATGGATGGATGGATGATGG + Intronic
1185196821 22:49476893-49476915 ATGGATGGATGGATGGTGGATGG + Intronic
1185196871 22:49477125-49477147 ATGGATGGATGGATGGTGGATGG + Intronic
1185196886 22:49477190-49477212 ATGGATGGATGGATGGTGGATGG + Intronic
1185196932 22:49477385-49477407 ATGGATGGATGGATGGTGGATGG + Intronic
1185196952 22:49477460-49477482 ATGGATGGATGGATGGTGGATGG + Intronic
1185196988 22:49477593-49477615 ATGGATGGATGGATGGTGGATGG + Intronic
1185196996 22:49477630-49477652 ATGGATGGATGGATGGATGATGG + Intronic
1185197001 22:49477649-49477671 ATGGATGGATGGATGGTGGATGG + Intronic
1185197036 22:49477771-49477793 ATGGATGGATGGATGGTGGATGG + Intronic
1185197042 22:49477794-49477816 ATGGATGGATGGATGGTGGATGG + Intronic
1185197048 22:49477817-49477839 ATGGATGGATGGATGGTGGATGG + Intronic
949114006 3:297631-297653 ATGAATGAATGGTTGTATTACGG + Intronic
949845357 3:8364686-8364708 ATGAATGAATGGATGGATGAAGG - Intergenic
950015020 3:9749383-9749405 AAGCATGAGCAGATGGAGTATGG + Intergenic
950177755 3:10887237-10887259 ATGCATGGATGGATGATGAATGG + Intronic
950352852 3:12374210-12374232 AGGAATGAATAGGTGGAGTATGG + Intronic
950574019 3:13820273-13820295 ATGAAAGAATGAATGGAGGAAGG + Intronic
951186767 3:19722638-19722660 GTGTATGAATGGTTGAAGTATGG - Intergenic
951334821 3:21407627-21407649 ATGCACGAATGGATGAAGAGTGG + Intergenic
951600916 3:24373832-24373854 GTGTATGAATGGTTGCAGTATGG - Intronic
951601673 3:24383291-24383313 ATGGATGAATGGATGAGGGATGG - Intronic
951836096 3:26984944-26984966 ATGGATAAATGGTTGGATTAAGG + Intergenic
951894088 3:27594597-27594619 AAGCAGGAAAGGAGGGAGTAAGG + Intergenic
952245035 3:31578689-31578711 CTGCATGCATGGAAGGAGAAAGG - Intronic
952307669 3:32160308-32160330 ATGGGTGAATGGATGGATGATGG + Intronic
952307686 3:32160367-32160389 ATGGATGGATGGATGGATTATGG + Intronic
952307703 3:32160427-32160449 ATGGGTGAATGGATGGATGATGG + Intronic
952307733 3:32160533-32160555 ATGGGTGAATGGATGGATGATGG + Intronic
952681434 3:36098063-36098085 ATGGATGAAATGATGGAGTTAGG + Intergenic
952978548 3:38716875-38716897 ATGGATGAATGGATGATGAATGG + Intronic
953170398 3:40501713-40501735 CTGTATAAATGGATGGAGTGCGG + Intergenic
953221439 3:40975351-40975373 ATGCAAGAATGCAGAGAGTATGG - Intergenic
953707431 3:45241864-45241886 ATGCCTGAATGGCTGGGGTTGGG + Intergenic
954676160 3:52316565-52316587 ATGCAGGAGTGGATGGAGACAGG + Intronic
954954847 3:54510147-54510169 ATGGATGAATGGATGAAGGGTGG + Intronic
954954871 3:54510238-54510260 ATGGATGAATGGATGAAGGGTGG + Intronic
955385357 3:58474932-58474954 ATGGACGAATGGATGGATGAAGG - Intergenic
955410472 3:58652461-58652483 ATGGATGAGTGGGTGGAGAAGGG - Intronic
955410493 3:58652544-58652566 ATGGATGAGTGGGTGGAGAAGGG - Intronic
955410529 3:58652706-58652728 ATGAATGAGTGGGTGGAGAATGG - Intronic
956069754 3:65435488-65435510 ATGGATGGATGGATGGAAGATGG + Intronic
957243661 3:77691119-77691141 ATCATTAAATGGATGGAGTAGGG - Intergenic
957604504 3:82379718-82379740 GTGCATGAATGGTTGAAGTATGG + Intergenic
958029348 3:88088782-88088804 ATGGATGGATGGATGGAGTCTGG + Intronic
960367728 3:116794155-116794177 ATGGATGGATGGATGGATGAAGG + Intronic
960686719 3:120302123-120302145 ATGCATGGCTGGTTGGGGTAGGG + Intergenic
961281975 3:125771282-125771304 GTGCATGAGGGGATGGAGGATGG - Intergenic
961413747 3:126742595-126742617 ATTCATGAGTTGATGGATTAAGG + Intronic
962100494 3:132337037-132337059 ACGCATGTATGTATGGAGAAAGG - Intronic
962543932 3:136412238-136412260 ATGAATGAATAAATGGAGAAAGG + Intronic
962804076 3:138914887-138914909 ATGGATGAATGGATGGATGAAGG + Intergenic
963059815 3:141216309-141216331 ATGAATGAATGAATGGATGATGG + Intergenic
964474202 3:157084024-157084046 ATGAATGAATGAATGAATTATGG - Intergenic
964559910 3:157982890-157982912 TCTCATGATTGGATGGAGTATGG - Intergenic
964743467 3:159990068-159990090 AAGCATGAATGGATGGGTGAAGG + Intronic
965356563 3:167681487-167681509 ATGAATGAATGGATGGATCAGGG + Intergenic
966058733 3:175729511-175729533 ATGTATGAGTGGTTGAAGTATGG - Intronic
966567465 3:181398862-181398884 ATGGATGAATGGGTGGATGATGG + Intergenic
966916943 3:184590033-184590055 ATGGATGAATGGATAGACAATGG + Intronic
967787188 3:193510000-193510022 ATGCATGAATGGAGGGGAGAAGG + Intronic
968598371 4:1496920-1496942 ATGGATGGATGGATGGATAATGG + Intergenic
968598424 4:1497280-1497302 ATGGATGGATGGATGGATAATGG + Intergenic
968931178 4:3580322-3580344 ATGGTTGGATGGATGGAGGATGG - Intronic
968931215 4:3580482-3580504 ATGGATGGATGGATGGAGGATGG - Intronic
968935815 4:3609860-3609882 ATGCATGGATGGATGATGGATGG - Intergenic
968935816 4:3609864-3609886 ATGTATGCATGGATGGATGATGG - Intergenic
968935820 4:3609895-3609917 ATGGATGAGTGGATGGAGGATGG - Intergenic
969166124 4:5315628-5315650 AGGAAGGAATAGATGGAGTAAGG + Intronic
969370618 4:6728970-6728992 TTGCATGAATGAGTGGAGGACGG - Intergenic
969424797 4:7117963-7117985 ATGGATGAATGGATGGATGGAGG + Intergenic
969465126 4:7351799-7351821 ATGGATGAATGGATGGGTGATGG - Intronic
969499509 4:7544176-7544198 ATGGATGAAGGGATGGAGGATGG - Intronic
969499513 4:7544188-7544210 ATGCACGAGTGGATGGATGAAGG - Intronic
969510293 4:7613866-7613888 GTGAATGAATGGATGGTGAATGG - Intronic
969510330 4:7614090-7614112 ATGGATGAATGGATGGTGATGGG - Intronic
969510410 4:7614441-7614463 ATGGGTGAATGGATGGATTATGG - Intronic
969510492 4:7614811-7614833 ATGGATGAATGGATGGTGGTTGG - Intronic
969510521 4:7614940-7614962 ATGGGTGAATGGATGGTGAATGG - Intronic
969510736 4:7616373-7616395 ATGGATGAGTGGATGGTGAATGG - Intronic
969510739 4:7616392-7616414 ATGGATGGATAGATGGATTATGG - Intronic
969523049 4:7689924-7689946 GTGAATGGATGGATGGAGGATGG + Intronic
969612265 4:8234017-8234039 ATGAATGGATGGATGGATGATGG - Intronic
969612280 4:8234121-8234143 ATGGATAAATGGATGGATGATGG - Intronic
969612291 4:8234179-8234201 ATGGATGAATGGATGGATGATGG - Intronic
969612300 4:8234220-8234242 ATGGGTGAATGGATGGATGATGG - Intronic
969674077 4:8605377-8605399 ATGAATGAATGGGTGGATGATGG - Intronic
969738208 4:9005237-9005259 GCGCATGAAGGGATGGAGGATGG - Intergenic
970796872 4:19923335-19923357 GTGTATGAATGGTTGAAGTATGG + Intergenic
970835759 4:20404629-20404651 ATGCATGAATGAATGAACAAGGG + Intronic
971127399 4:23769385-23769407 ATGGATGGATGGATGGATGATGG - Intronic
971149796 4:24020095-24020117 ATGAAGGAGTGGATGGAGTTTGG - Intergenic
972382482 4:38532213-38532235 AGGCATCAGGGGATGGAGTAAGG - Intergenic
973057576 4:45679750-45679772 ATGCATGAATTGATATAGTTTGG + Intergenic
973587136 4:52404742-52404764 ATGAATGAATGTATAGAGTTTGG - Intergenic
973902364 4:55489033-55489055 ATGGATAAATGGATAGTGTAAGG - Intronic
975133311 4:70849433-70849455 GTGTATGAATGGTTGAAGTATGG - Intergenic
976075547 4:81295227-81295249 ATGGATGGATGGATGGATGATGG + Intergenic
976239301 4:82937001-82937023 ATACATGAATCACTGGAGTAGGG - Intronic
977061405 4:92261522-92261544 ATGCATGAGTGAATGAAGGATGG - Intergenic
978724379 4:111953151-111953173 ATGCATTTATTGATTGAGTATGG - Intergenic
979324399 4:119361899-119361921 TTGCATGACGGGATGGAGGAAGG + Intergenic
979752252 4:124293616-124293638 AAACATGAATAGATGGTGTAAGG - Intergenic
979800928 4:124907962-124907984 ATGTATGAATGGTTGAAGTATGG - Intergenic
979971000 4:127135177-127135199 ATGGATGAATGAATGGATGAAGG + Intergenic
981259222 4:142699600-142699622 ATGCATGAGTGAATGGATCAGGG - Intronic
982304300 4:153913762-153913784 ACGGATGAATGGCTGGAGAAAGG - Intergenic
983622127 4:169772920-169772942 CTGAATGAATGGATGGATGAAGG - Intergenic
983649120 4:170020952-170020974 ATTAATGAATGGATGGAATATGG + Intronic
984746803 4:183228847-183228869 ATGGATGAATGCATTGTGTATGG + Intronic
985119554 4:186626580-186626602 ATGCATGAATGAATGAATGAGGG + Intronic
985179236 4:187238485-187238507 CTGGATGAATGGAGGGTGTAGGG - Intergenic
985547489 5:517203-517225 ATGCGTGAATGGTTGGTGGATGG - Intronic
985547612 5:517901-517923 ATGGATGGATGGATGGATGATGG - Intronic
985709173 5:1418704-1418726 ATGGATGGATGGATGGATGATGG - Intronic
985709183 5:1418739-1418761 ATGGATGGATGGATGGATGATGG - Intronic
985709207 5:1418855-1418877 ATGGATGGATGGATGGATAATGG - Intronic
985709258 5:1419117-1419139 ATGGATGAATGGATGATGCATGG - Intronic
986761023 5:10879750-10879772 ATGGATAAATGGAAGGAGTAGGG - Intergenic
987067999 5:14308515-14308537 ATGGATAAATGGATGGAGGTTGG - Intronic
987761061 5:22163328-22163350 ATACAGGAATGGAGGGAGTCTGG - Intronic
988662062 5:33281621-33281643 ATTAATGAATGGATGAAGTTTGG - Intergenic
988879778 5:35488740-35488762 ATGCAAGAGTAGATGGAGCATGG - Intergenic
989080329 5:37612727-37612749 ATGAATGACTGGCTGGAGCAAGG - Intronic
989447197 5:41543845-41543867 ATGCATGCATGGATGCTTTAGGG + Intergenic
990082108 5:51929667-51929689 GTGTATGAATGGTTGAAGTATGG - Intergenic
990364873 5:55060360-55060382 ATGCATGAATGGATAAAGTGTGG + Intergenic
990521686 5:56587465-56587487 ATGAATGAATGGATGGGATAGGG - Intronic
991689359 5:69211617-69211639 CTGCATGAAAGGATGCAGAAAGG - Intergenic
991895847 5:71396780-71396802 ATACAGGAATGGAGGGAGTCTGG - Intergenic
992389839 5:76320296-76320318 AGGAATGAATAGATGGAGCATGG + Intronic
992462086 5:76970534-76970556 ATGGATGGATGGATGGATGACGG + Intronic
994177711 5:96729903-96729925 ATGCATGGATGGCTTGAGAAGGG + Intronic
994282835 5:97926577-97926599 GTGCATGACTGGTTGAAGTATGG - Intergenic
994847726 5:105011421-105011443 AAGCATTATTGGATGGAGGAAGG - Intergenic
999098295 5:149001077-149001099 ATGCAGGAATGGAGGGTGTTAGG - Intronic
999445012 5:151632319-151632341 ATGGATGCATGGATGGATAATGG + Intergenic
999516420 5:152306460-152306482 AGGCATGAAGGGATGGTGTGAGG + Intergenic
999711206 5:154320154-154320176 ATGAATGGATGGATAGAGGAGGG + Intronic
999746741 5:154598182-154598204 ATGGATGAATGGATGGATGATGG + Intergenic
1000327165 5:160181038-160181060 ATGCATGAATGAATGAATGAAGG + Intergenic
1000838194 5:166182115-166182137 ATGCATGAAGGTATGGAGGTAGG - Intergenic
1000948381 5:167450047-167450069 ATGGATGGATGGATGGATGATGG + Intronic
1000978549 5:167791929-167791951 ATGAGAGAGTGGATGGAGTATGG - Intronic
1001278400 5:170367518-170367540 ATGGATGGATTGATGGAGGATGG + Intronic
1001435457 5:171695939-171695961 ATGGATGGATGGATGGATGATGG + Intergenic
1001543443 5:172555151-172555173 CTGGATGAATGAATGGAGGAGGG - Intergenic
1001686513 5:173598016-173598038 ATGGATGGATGGATGGAGGGAGG - Intergenic
1001701722 5:173711651-173711673 ATGGGTGAATGGATGGAAGAGGG + Intergenic
1001701737 5:173711741-173711763 ATGGATGGATGGATGGATGATGG + Intergenic
1001751435 5:174134546-174134568 ATGGATGGATGGATGGATGATGG - Intronic
1001751445 5:174134588-174134610 ATGGGTGAATGGATGGATGATGG - Intronic
1001751459 5:174134668-174134690 ATGGATGGATGGATGGATAATGG - Intronic
1001751483 5:174134820-174134842 ATGGATGGATGGATGGATGATGG - Intronic
1002067640 5:176660128-176660150 ATGGGTGAATGGATGGAGGAAGG - Intergenic
1002067648 5:176660155-176660177 ATGGGTGAATGGATGGAGGAAGG - Intergenic
1002067656 5:176660182-176660204 ATGGGTGAATGGATGGAGGAAGG - Intergenic
1002067664 5:176660209-176660231 ATGAGTGAATGGATGGAGGAAGG - Intergenic
1002303300 5:178269547-178269569 ATGGATGGATGGATGGATGATGG - Intronic
1002341632 5:178520069-178520091 ATGGATGGATAGATGGAGGATGG + Intronic
1002439099 5:179255001-179255023 ATGGATGGATGGATGGATGATGG + Intronic
1003366111 6:5476542-5476564 ATGAATGAATGAATGGAGTGAGG + Intronic
1003520586 6:6855434-6855456 TTGAATGAATGGATGGAAAATGG - Intergenic
1003971689 6:11306280-11306302 TTGCATGAATGAATGGATGATGG - Intronic
1004733316 6:18380269-18380291 AGCCAGGGATGGATGGAGTATGG - Intergenic
1004980350 6:21016597-21016619 ATGGATGAATGGAAGGCGTGGGG - Intronic
1005642681 6:27811580-27811602 ATACAAGAATGGATGAGGTAAGG - Intergenic
1005817640 6:29568797-29568819 ATGCATGAATGGATAAACTGTGG + Intronic
1006706141 6:36023158-36023180 ATGGATGGATGGATGGATAAGGG - Intronic
1007246748 6:40468776-40468798 ATGCATGAGGAGATGGGGTAAGG - Intronic
1008422135 6:51313640-51313662 ATGGATGAATGGATGGATGATGG - Intergenic
1008511075 6:52276356-52276378 ATCCATGAAGTGATGGAGCAGGG - Exonic
1008610793 6:53183041-53183063 TTGCAGTAAAGGATGGAGTAAGG + Intergenic
1008612602 6:53197898-53197920 ATGAATGTATGGAAGGTGTATGG - Intergenic
1008741163 6:54610117-54610139 ATGAATGAATGGAGGGATCAAGG - Intergenic
1009035760 6:58115736-58115758 ATGAATGAATGAATGAAGAATGG - Intergenic
1009211582 6:60869337-60869359 ATGAATGAATGAATGAAGCATGG - Intergenic
1009723716 6:67508642-67508664 ATTCATGAATGAATGGATGAAGG - Intergenic
1010149347 6:72712139-72712161 ATGAATGAATGAATGAAGAATGG + Intronic
1010816733 6:80366679-80366701 ATGGATGAATGGATGGATAGAGG - Intergenic
1011477524 6:87762640-87762662 ATGCCTGAAAAGATGGAGAAAGG - Intergenic
1011543276 6:88456692-88456714 TTGAATGAATGGATTGTGTAAGG - Intergenic
1012397079 6:98810934-98810956 ATGGATGAATGGATGGCTGATGG + Intergenic
1012456594 6:99413442-99413464 ATGGATGGATGGATGGATCATGG - Intronic
1013320444 6:108982855-108982877 ATGCTGGAGTGCATGGAGTACGG + Intergenic
1013657800 6:112263663-112263685 TTGAATGAATGGATGGTGAATGG - Intergenic
1013661630 6:112303559-112303581 GTGTATGAATGGTTGAAGTACGG - Intergenic
1014695284 6:124613329-124613351 ATGCATGAAAGGCTAGATTATGG - Intronic
1015141544 6:129939856-129939878 ATGAATGAATGGATGGATGATGG - Intergenic
1015164150 6:130184752-130184774 ATGGATGAATGGATGGAAGATGG - Intronic
1016285523 6:142468533-142468555 CTGCTAGAATGGATGGAGTTGGG + Intergenic
1016317775 6:142808772-142808794 AAGGATGAATGGATGGAGGGAGG + Intronic
1016317776 6:142808776-142808798 ATGAATGGATGGAGGGAGGAAGG + Intronic
1016352807 6:143185772-143185794 ATGCATGAATGAATGGTTGAGGG + Intronic
1017053883 6:150420512-150420534 CTGAATGAATGTATGGAGCAGGG - Intergenic
1017659036 6:156656056-156656078 ATGAATGAATGGATGGATGAGGG - Intergenic
1017821766 6:158054062-158054084 ATGGCTGAATGGATGGATAATGG - Intronic
1018853066 6:167655061-167655083 ATGGATGGATGGATGGATGATGG + Intergenic
1018853166 6:167655635-167655657 ATGGATGAATGGATGGATGATGG + Intergenic
1019095404 6:169575385-169575407 ATGGATGGATGGATGGAGAGAGG - Intronic
1019327000 7:443437-443459 ATGGATGGATGGATGGTGAATGG + Intergenic
1019327023 7:443520-443542 ATGGATGGATGGATGGTGGATGG + Intergenic
1019345542 7:528314-528336 ATGAATGGATGGATGGATTATGG + Intergenic
1019503692 7:1379584-1379606 ATGGATGGATGGATGGATGATGG + Intergenic
1019503714 7:1379825-1379847 ATAGATGAATGAATGGAGGATGG + Intergenic
1019510810 7:1416372-1416394 ATGGATGGATGGATGGAGGATGG + Intergenic
1019567252 7:1690425-1690447 ATGGGTGAATGGATGGATGAAGG + Intronic
1019567286 7:1690608-1690630 ATGGATAAATGGATGGATGAAGG + Intronic
1019567328 7:1690785-1690807 ATGGGTGAATGGATGGATGAAGG + Intronic
1019704490 7:2491068-2491090 ATGGATGGATGGATGGGGGATGG - Intergenic
1019704562 7:2491351-2491373 ATGGATGGATGGATGGGGGATGG - Intergenic
1019704598 7:2491469-2491491 ATGGATGGATGGATGGATGATGG - Intergenic
1019776027 7:2912715-2912737 ATGGATGGATGGATGGATAAGGG - Intronic
1019914668 7:4125069-4125091 ATGGATGGATGGATGGATGATGG + Intronic
1019914725 7:4125361-4125383 ATGGATGAATGGATGGGTGATGG + Intronic
1019932055 7:4230295-4230317 ATGAATGAATTGATGAAGGAAGG + Intronic
1020365839 7:7379665-7379687 ATGAATAAATGAATGGAGAAAGG + Intronic
1020482052 7:8673600-8673622 ATGCATGAAAGCATGAAGCATGG - Intronic
1020696832 7:11423305-11423327 ATGCATGAAAGGTTGGGTTATGG + Intronic
1020860091 7:13481727-13481749 ATGTATGAGTGGTTGAAGTATGG - Intergenic
1020944857 7:14590656-14590678 ATTAATGAATGAATGTAGTAAGG - Intronic
1022477237 7:30719598-30719620 ATGGATGGATGGATGGATGATGG - Intronic
1022857009 7:34324687-34324709 ATGCAAGAATGAATGGAAAATGG + Intergenic
1022908979 7:34882095-34882117 ATGAATGGATGGATGGATGATGG + Intergenic
1023343656 7:39249069-39249091 AGGCATGGATGGGTGGAATATGG - Intronic
1023575509 7:41622210-41622232 AAGCAGGAATGGAGGGAGAAAGG + Intergenic
1023729918 7:43181223-43181245 AGACATGAATGGATAAAGTATGG - Intronic
1024937857 7:54729854-54729876 GTGCATGAATGAAAGGATTATGG - Intergenic
1024997243 7:55281263-55281285 GTGCATGAATGGTTGAAGAATGG + Intergenic
1025113153 7:56236189-56236211 ATGAATGAATGAATGAAATAGGG + Intergenic
1025606884 7:63045842-63045864 ATGGATGAATGGATGATGGATGG - Intergenic
1026161169 7:67870061-67870083 ATGGATGAATGGATGGATGGAGG + Intergenic
1026203537 7:68235736-68235758 ATGGATGAATGGATGGAAGGTGG + Intergenic
1026203561 7:68235896-68235918 ATGAATGAATGGATGGATGAAGG + Intergenic
1026234740 7:68517135-68517157 GTGTATGAATGGTTGAAGTACGG - Intergenic
1026275212 7:68870368-68870390 ATAGATGAATGGATGGATGATGG + Intergenic
1026319638 7:69257610-69257632 ATGGATGGATGGATGGATGACGG + Intergenic
1026705358 7:72686787-72686809 ATGTATGCATGCATGGAATAGGG + Intronic
1026903401 7:74049299-74049321 ATGGAAGAATGGATGGAGGGAGG - Intronic
1026903409 7:74049331-74049353 ATGGAAGAATGGATGGAGGGAGG - Intronic
1029074424 7:97924758-97924780 GTGCATGAGGGGATGGAGGATGG + Intergenic
1029599728 7:101556647-101556669 ATGGATGGATGGATGGATGATGG + Intronic
1029604804 7:101592117-101592139 ATGGATGGATGGATGGAGGGAGG - Intergenic
1029604861 7:101592455-101592477 ATGGATGGATGGATGGATGATGG - Intergenic
1029622488 7:101698796-101698818 ATGTATGAATGGATGGCTTGGGG - Intergenic
1029810686 7:103045214-103045236 GTGTATGAATGGTTGAAGTATGG + Intronic
1030075635 7:105733929-105733951 ATGGATGGATGGATGGATGATGG - Intronic
1030350236 7:108476742-108476764 ATGGATGAATGAATGGATAAAGG + Intronic
1031888486 7:127265849-127265871 ATGGATGCATGGATGGATGATGG + Intergenic
1031888487 7:127265853-127265875 ATGCATGGATGGATGATGGAAGG + Intergenic
1031922588 7:127612751-127612773 ATGGATGGATGAATGGAGGATGG + Intronic
1032067358 7:128781686-128781708 CTGCTTGAAAGGATGGAGTGTGG + Intergenic
1032725165 7:134584346-134584368 ATGGATGAATGGATGGATGGAGG + Intergenic
1032725167 7:134584350-134584372 ATGAATGGATGGATGGAGGGAGG + Intergenic
1033642702 7:143277563-143277585 ATGCATTGATGGATGGATAAAGG + Intergenic
1034745513 7:153520298-153520320 ATGCCTGGATGGAAGGGGTAAGG + Intergenic
1034883634 7:154780991-154781013 ATGAGTGAATGGATGGATGATGG + Intronic
1035278884 7:157765135-157765157 ATGGATGGATGGATGAAGGATGG - Intronic
1035278964 7:157765505-157765527 GTGGGTGAATGGATGGAGGAAGG - Intronic
1035279030 7:157765788-157765810 GTGAGTGAATGGATGGAGGAAGG - Intronic
1035279089 7:157766047-157766069 ATGGATGGATGGATGGAGGAAGG - Intronic
1035279101 7:157766093-157766115 ATGGATGAATGGAAGAAGAATGG - Intronic
1035279134 7:157766247-157766269 AAGGATGGATGGATGGAGGAAGG - Intronic
1035279151 7:157766328-157766350 ATGGATGGATGGATGAAGGAAGG - Intronic
1035279181 7:157766477-157766499 ATCAATGGATGGATGGAGGAAGG - Intronic
1035288681 7:157823073-157823095 ATGCATGCATGGATGGATGATGG - Intronic
1035452563 7:158987609-158987631 ATGGATGCATGGATAGTGTATGG - Intergenic
1036113655 8:5934094-5934116 ATACATGAATGGTTGGATTGAGG - Intergenic
1036662984 8:10720297-10720319 ATGAATGGATGGATGGAGAGTGG + Intergenic
1037598690 8:20375276-20375298 ATGGATGGATGGATGGTGGATGG - Intergenic
1037747947 8:21661696-21661718 ATGAATGAATGAATGGAGAGTGG - Intergenic
1038120468 8:24608692-24608714 ATGAATGAATGAATGGACGAAGG - Intergenic
1038324685 8:26563861-26563883 ATGAATGAATGAATGAAGTGTGG + Intronic
1038440769 8:27569564-27569586 ATGGATGGATGGATGGATGAAGG + Intergenic
1038440910 8:27570180-27570202 ATGGATGGATGGATGGATGAAGG + Intergenic
1038440913 8:27570192-27570214 ATGGATGAAGGGATGGATGAAGG + Intergenic
1038440918 8:27570216-27570238 ATGGATGCATGGATGGATGAAGG + Intergenic
1039411123 8:37356068-37356090 ATGCATGTATGCATGCATTATGG + Intergenic
1040793435 8:51261772-51261794 ATGGATGAATGGATAAAGAAAGG + Intergenic
1041010257 8:53534936-53534958 ATGGATGGATGGATGGATGATGG + Intergenic
1041366512 8:57111640-57111662 ATGTGTGAATGGAGGGGGTAGGG + Intergenic
1041413749 8:57584678-57584700 ATGAATGAATGAATGGAGAACGG + Intergenic
1041738796 8:61137931-61137953 ATGAATGAATGAATGGAGGCAGG - Intronic
1041929066 8:63267367-63267389 AGGCATGAATGGATAGAGTCTGG + Intergenic
1042056729 8:64771943-64771965 GTGGATGAGTGAATGGAGTAGGG - Intronic
1042215343 8:66425437-66425459 ATGGATGGATGGATGGATGAAGG + Intergenic
1042964295 8:74334439-74334461 ATGGATGGATGGATGATGTATGG - Intronic
1044624625 8:94225019-94225041 ATGCCTCAATGCATTGAGTAAGG + Intergenic
1045007025 8:97925222-97925244 GTGTATGAATGGTTGAAGTACGG + Intronic
1045359868 8:101423089-101423111 ATTCATGAATGGGTGGTGCATGG + Intergenic
1045621711 8:103985539-103985561 ATGCTTGAAGGGATGGATTTGGG + Intronic
1045628598 8:104087387-104087409 ATGGATGGATGGATGGACAAGGG + Intronic
1045757628 8:105563406-105563428 ATCCATAAAAGGATGAAGTAGGG + Intronic
1046112171 8:109738478-109738500 ATGGATGGATGGATGGATGAGGG - Intergenic
1046518392 8:115292765-115292787 ATGCAAAAAGGGTTGGAGTAGGG - Intergenic
1047303644 8:123635927-123635949 ATGCATGAATGAATGAATGATGG - Intergenic
1047306784 8:123659094-123659116 ATGAATGGATGGATGGATGATGG - Intergenic
1047306820 8:123659286-123659308 ATGGATGAATGGATGATGGATGG - Intergenic
1047306832 8:123659343-123659365 ATGGATGAATGGATGATGGATGG - Intergenic
1047306897 8:123659744-123659766 ATGGATGGATGGATGGATGATGG - Intergenic
1047306906 8:123659783-123659805 ATGGATGAATGGATAGATGATGG - Intergenic
1047306946 8:123660041-123660063 ATGGATGAATGGATGATGGATGG - Intergenic
1047333774 8:123917148-123917170 ACGGATGAATGGATGGATAAAGG - Intronic
1048059987 8:130909033-130909055 ATGGATGGATGGATGGTGGATGG - Intronic
1048176773 8:132159846-132159868 ATGGATGAATGGGTGGATGATGG - Intronic
1048289839 8:133172288-133172310 ATGAATGAATGGATGATGGATGG - Intergenic
1048297016 8:133221903-133221925 ATTAATGGATGGATGGAGGATGG + Intronic
1048297048 8:133222117-133222139 ATGGATGGATGGATGGAGGATGG + Intronic
1048598225 8:135889554-135889576 ATAAATGAATGAATGGAGGAAGG + Intergenic
1048989541 8:139753155-139753177 ATGGATGGATGGATGGTGGATGG - Intronic
1049042169 8:140120762-140120784 ATGAATGAATGGATGGATGTTGG - Intronic
1049042181 8:140120835-140120857 ATGGATGGATGGATGGATGATGG - Intronic
1049155278 8:141062478-141062500 ATGGATGACTGGATGGAGAGAGG + Intergenic
1049348313 8:142150734-142150756 ATGGATGGATGGATGGACGATGG + Intergenic
1049350623 8:142162606-142162628 ATTCAAGGATGGATGGAGGATGG + Intergenic
1049350867 8:142163930-142163952 ATGGGTGGATGGATGGAGGATGG + Intergenic
1049350926 8:142164221-142164243 ATGGATGGATGGATGGATGAAGG + Intergenic
1049359964 8:142207692-142207714 ATGGATGAATAGATGGGGGATGG + Intergenic
1049359990 8:142207796-142207818 ATGCATGGATGGATGGGGAATGG + Intergenic
1049364269 8:142229156-142229178 ATGGATGAATGGAGGGTGGATGG + Intronic
1049364289 8:142229240-142229262 ATGGATGAATGGATGGATGGTGG + Intronic
1049364290 8:142229244-142229266 ATGAATGGATGGATGGTGGATGG + Intronic
1049364302 8:142229294-142229316 ATGGATGGATGGATGGTGGATGG + Intronic
1049464101 8:142743356-142743378 ATGGATGGATGGATGGGGGATGG + Intergenic
1049464629 8:142745148-142745170 AAGGATGGATGGATGGAGGATGG + Intergenic
1049474756 8:142791674-142791696 ATGACTGGATGGATGGAGGATGG - Intergenic
1049474813 8:142791975-142791997 ATGACTGGATGGATGGAGGATGG - Intergenic
1050635309 9:7606121-7606143 ATAAATAAATGGATGGAGTGGGG - Intergenic
1051707219 9:19893294-19893316 ATGCATGGATTGATGGGGAATGG - Intergenic
1052284760 9:26772421-26772443 ATGAATGGATGGATGGCTTATGG + Intergenic
1052565066 9:30139541-30139563 ATACATGAGTGGATGAAGAAGGG - Intergenic
1052659717 9:31412777-31412799 ATGGATGACTGGATGGGATATGG - Intergenic
1052804871 9:33003880-33003902 GTGGATGAATGGATAAAGTATGG - Intronic
1053420586 9:37975069-37975091 ATTCATGAGTGGATGGAGGCAGG - Intronic
1053802979 9:41775744-41775766 ATGGATGGATGGATGGTGGATGG - Intergenic
1054142280 9:61539362-61539384 ATGGATGGATGGATGGTGGATGG + Intergenic
1054454248 9:65421401-65421423 ATGGATGAGTGGATGGATAATGG + Intergenic
1054454367 9:65422002-65422024 ATGTATGCATGGATGGATGATGG + Intergenic
1054454368 9:65422006-65422028 ATGCATGGATGGATGATGGATGG + Intergenic
1054458884 9:65451342-65451364 ATGGATGGATGGATGGATGATGG + Intergenic
1054458905 9:65451432-65451454 ATGGATGGATGGATGGAGGATGG + Intergenic
1054458943 9:65451600-65451622 ATGGATGGATGGATGGAGGATGG + Intergenic
1054462029 9:65470513-65470535 ATGGATGGATGGATGGTGGATGG + Intergenic
1055049716 9:71966060-71966082 GTGTATGAATGGTTGAAGTATGG - Intronic
1055448089 9:76403196-76403218 GTGAATGAATGGATGAAGGAAGG - Intergenic
1056135482 9:83625918-83625940 ATGGATGGATGGATGGAAGACGG + Intronic
1056316975 9:85399600-85399622 AGGCATGAATGGACTGAGTCAGG + Intergenic
1056621018 9:88214627-88214649 ATGGATGAATGGATAAACTATGG - Intergenic
1056922111 9:90800574-90800596 GTGTATGAATGGTTGAAGTATGG - Intergenic
1057008701 9:91583223-91583245 CTGGATGGATGGATGGAGGATGG + Intronic
1057082630 9:92184424-92184446 ATGGATAAATGGATGGATAATGG - Intergenic
1057181092 9:93030838-93030860 ATGCGTGGATGGATGGATGAGGG + Intronic
1057426654 9:94956044-94956066 ATGTATGACTGGAGGGGGTATGG + Intronic
1057603629 9:96481776-96481798 ATGCATGGATGGATGGTTTGGGG + Intronic
1057690922 9:97284092-97284114 ATGGATGAATGTATGGAATGTGG - Intergenic
1057821622 9:98335837-98335859 GTGCATGAATGAATGGATGATGG - Intronic
1058340155 9:103885804-103885826 GTGCATCAATGGACTGAGTAAGG + Intergenic
1058439252 9:104991970-104991992 GTGCATGAAGCGATGGAGTGGGG + Intergenic
1058941921 9:109821495-109821517 ATGCATGAATGGATACACCATGG - Intronic
1059409111 9:114120969-114120991 ATGGATGGATGGATGGTGGATGG + Intergenic
1059416404 9:114165340-114165362 ATGGATGGATGGATGGATGATGG - Intronic
1059739447 9:117135473-117135495 ATTAATGAATGGATGGAGACGGG - Intronic
1060037185 9:120265514-120265536 ATGGATGGATGGATGGAAAATGG + Intergenic
1061244648 9:129395190-129395212 ATGAAAAAATGGATGGAGGATGG + Intergenic
1061244988 9:129397005-129397027 ATGGATGGAAGGATGGAGGATGG + Intergenic
1061256674 9:129457476-129457498 ATGGATGGATGGATGGATGATGG + Intergenic
1061399583 9:130361047-130361069 ATGACTGAATGGATGGTGAATGG - Intronic
1061417446 9:130454783-130454805 ATGGATGGATGGATGGATGATGG - Intronic
1061417458 9:130454829-130454851 ATGGATGGATGGATGGATGATGG - Intronic
1061417477 9:130454914-130454936 ATGAATGGATGGATGGATAATGG - Intronic
1061417487 9:130454972-130454994 ATGGATGAATGGACGGAGGATGG - Intronic
1061417499 9:130455029-130455051 ATGGATGAATGGATGGATGATGG - Intronic
1061417502 9:130455048-130455070 ATGGATGGATGGATGGATGATGG - Intronic
1061417516 9:130455132-130455154 ATGGATGGATGGATGGATGATGG - Intronic
1061417522 9:130455169-130455191 ATGGATGAATGGATGATGCATGG - Intronic
1061417559 9:130455394-130455416 ATGGATGGATGGATGGGGGATGG - Intronic
1061950523 9:133933489-133933511 ATGGATGGATGGATGGTGAATGG + Intronic
1061950533 9:133933543-133933565 ATGGATGGATGGATGGTGGATGG + Intronic
1061950538 9:133933562-133933584 ATGGATGGATGGATGGTGGATGG + Intronic
1061950597 9:133933828-133933850 ATGGATGGATGGATGGTGGATGG + Intronic
1061950625 9:133933937-133933959 ATGGATGGATGGATGGTGGATGG + Intronic
1061981085 9:134104006-134104028 ATGGATGGATGGATGGTGGATGG - Intergenic
1061981092 9:134104032-134104054 ATGGATGGATGGATGGATTGTGG - Intergenic
1061981101 9:134104077-134104099 ATGGATGGATGGATGGTGGATGG - Intergenic
1061981184 9:134104430-134104452 ATGGATGGATGGATGGTGGATGG - Intergenic
1061981191 9:134104467-134104489 ATGGATGGATGGATGGTGGATGG - Intergenic
1061981249 9:134104706-134104728 ATGGATGGATGGATGGTGGATGG - Intergenic
1062092317 9:134684933-134684955 ATGGATGAATGGATGGTGGATGG - Intronic
1062092341 9:134685049-134685071 ATGGATGGATGGATGGTGGATGG - Intronic
1062092354 9:134685095-134685117 ATGAATGGATGGATGGTGGATGG - Intronic
1062092355 9:134685099-134685121 ATGGATGAATGGATGGATGGTGG - Intronic
1062092368 9:134685157-134685179 ATGAATGGATGGATGGTGGATGG - Intronic
1062092369 9:134685161-134685183 ATGAATGAATGGATGGATGGTGG - Intronic
1062092378 9:134685208-134685230 ATGGGTGAATGGATGGTGGATGG - Intronic
1062092399 9:134685301-134685323 ATGAATGGATGGATGGTGGATGG - Intronic
1062092400 9:134685305-134685327 ATGGATGAATGGATGGATGGTGG - Intronic
1062092411 9:134685356-134685378 ATGGGTGAATGGATGGTGGATGG - Intronic
1062092430 9:134685445-134685467 ATGGATGGATGGATGGATGATGG - Intronic
1062092459 9:134685580-134685602 ATGGATGGATGGATGGAGGATGG - Intronic
1062092471 9:134685629-134685651 ATGCATGGATGGATGGTGGATGG - Intronic
1062092538 9:134685934-134685956 ATGGATGGATGGATGGTGGATGG - Intronic
1062092820 9:134687455-134687477 ATGAATGGATGGATGGATGATGG - Intronic
1062172222 9:135141221-135141243 ATGGATGAATGGATGATGGATGG + Intergenic
1062172226 9:135141240-135141262 ATGGATGGATGGATGGATGATGG + Intergenic
1062172231 9:135141274-135141296 ATGGATGAATGGATGATGGATGG + Intergenic
1062217119 9:135395196-135395218 ATGCATGGATGGGTGGTGGATGG + Intergenic
1062247737 9:135578117-135578139 ATGGATGAATGGATGGATGCAGG - Intergenic
1062247806 9:135578463-135578485 ATGGATGAATGGATGGATGCAGG - Intergenic
1062247875 9:135578809-135578831 ATGGATGAATGGATGGATGCAGG - Intergenic
1062247979 9:135579411-135579433 GTGAATAAATGGATGGTGTATGG - Intergenic
1062520696 9:136956669-136956691 ATGGATGGATGGATGGATGATGG + Intronic
1062520725 9:136956815-136956837 ATGGATAAATGGATGGATGAAGG + Intronic
1062649818 9:137569715-137569737 ATGGATGGATGGATGGATCATGG - Intronic
1185497532 X:566589-566611 ATGGATAAATGGATGGATGATGG + Intergenic
1185543743 X:925356-925378 ATGGATGGATGGATGGTGGATGG + Intergenic
1185543748 X:925375-925397 ATGGATGGATGGATGGTGGATGG + Intergenic
1185546998 X:953845-953867 CTGAATGAATGGATGGATGAGGG - Intergenic
1185547110 X:954450-954472 CTGGATGAATGGATGGATGAGGG - Intergenic
1185583201 X:1226649-1226671 ATGGATAAATGGATGGATTGAGG + Intergenic
1185583286 X:1227041-1227063 ATGAATGGATGGATGGATTGAGG + Intergenic
1185611416 X:1395598-1395620 ATGGATGGATGGATGGATGATGG + Intergenic
1185611443 X:1395726-1395748 ATGGATGGATGGATGGATAATGG + Intergenic
1185611447 X:1395745-1395767 ATGGATGGATGGATGGATAATGG + Intergenic
1185611456 X:1395802-1395824 ATGGATGGATGGATGGATAATGG + Intergenic
1185629963 X:1508678-1508700 ATGGATGGATGGATGGATGATGG - Intronic
1185629975 X:1508838-1508860 ATGGATGAATGGATGGATGGAGG - Intronic
1185630011 X:1509340-1509362 ATGGATGGATGGATGGATGATGG - Intronic
1185630024 X:1509500-1509522 ATGGATGAATGGATGGATGGAGG - Intronic
1185639257 X:1577641-1577663 ATGGATGGATGGATGGATGATGG + Intergenic
1185741469 X:2536428-2536450 GTGTATGAATGGTTGAAGTATGG + Intergenic
1185780599 X:2841432-2841454 ATGGATGGATGGATGGATGATGG + Intronic
1185867852 X:3639265-3639287 ATGGATGGATGGATGGATGAAGG + Intronic
1185874552 X:3691882-3691904 ATGGATGGATGGATGGACAATGG + Intronic
1185883520 X:3761207-3761229 ATGAATGTATGGATGGATGAGGG + Intergenic
1186001900 X:5021914-5021936 ATGGATGAATGGATGGAAGATGG - Intergenic
1186055577 X:5646182-5646204 ATGGATGGATGGATGGATGATGG - Intergenic
1186149021 X:6654783-6654805 GTGTATGAATGGTTGAAGTATGG + Intergenic
1186150470 X:6669474-6669496 ATGAATGAATGGATGGAGAGTGG + Intergenic
1186178642 X:6951213-6951235 ATGGATGGATGGATGGATGATGG - Intergenic
1186792964 X:13016807-13016829 GTGTATGAATGGTTGAAGTATGG - Intergenic
1186893552 X:13983851-13983873 GTGTATGAATGGTTGAAGTACGG - Intergenic
1187451048 X:19396641-19396663 ATACATGAATGGATGAATGAAGG + Intronic
1187495846 X:19794845-19794867 CTGAATGAATGGAAGGAGTAAGG - Intronic
1188978069 X:36700091-36700113 ATGTATGAATGGTTAAAGTATGG + Intergenic
1189622821 X:42861197-42861219 GTGCATGAGTGGTTGAAGTATGG - Intergenic
1190622160 X:52298337-52298359 ATGAATGAATGAATGGAGAGAGG - Intergenic
1190942671 X:55057334-55057356 ATGCAAGACTGTATGGAGGATGG + Intergenic
1193853997 X:86576043-86576065 ATGAATGAATGGATGAAGAAAGG - Intronic
1195292633 X:103443944-103443966 ATGGAAGAATGGATGAAGCAGGG - Intergenic
1195416442 X:104625173-104625195 ATGCATGGATGGATGGAGGATGG - Intronic
1195792919 X:108608532-108608554 ATAGATGAATGGATGGAGACAGG - Intronic
1196632176 X:117954414-117954436 ATGGATGGATGGATGGATAAAGG + Intronic
1196650126 X:118159915-118159937 ATGGATGGATGGATGGAGAATGG + Intergenic
1197882207 X:131178561-131178583 ATGAATGTATGAATGGAGCAGGG + Intergenic
1198954521 X:142113260-142113282 ATGGATGAATAGATGGAACACGG - Intergenic
1199986397 X:152955073-152955095 GTGTATGAATGGTTGAAGTATGG + Intronic
1200781575 Y:7221077-7221099 ATGGATGAATGGATGGATGATGG + Intergenic
1201235489 Y:11906555-11906577 ATGAATGAATGGATGAAAGATGG - Intergenic
1201286823 Y:12386365-12386387 ATAGATGAATGGATGGATGATGG + Intergenic
1201303152 Y:12527577-12527599 ATGCAGGAAGGGAAGGAGAAAGG + Intergenic
1201354396 Y:13082416-13082438 AGCCATGAATGGAAGGGGTAGGG - Intergenic
1201917383 Y:19196693-19196715 ATGGATTAATGGATGGATGATGG + Intergenic
1201917407 Y:19196898-19196920 ATGGATGGATGGATGGATTATGG + Intergenic