ID: 901930009

View in Genome Browser
Species Human (GRCh38)
Location 1:12591191-12591213
Sequence AGGTCGTTACAGGTGCCCCA CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 58
Summary {0: 1, 1: 0, 2: 0, 3: 1, 4: 56}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
901930009 Original CRISPR AGGTCGTTACAGGTGCCCCA CGG Intronic
901257926 1:7848044-7848066 AGGTGGGCACAGGAGCCCCACGG - Intronic
901930009 1:12591191-12591213 AGGTCGTTACAGGTGCCCCACGG + Intronic
902680842 1:18042729-18042751 AGGATGTTTCATGTGCCCCAAGG + Intergenic
904811817 1:33168242-33168264 TGGTCTTTACAGTTGCCTCATGG - Intronic
906689095 1:47780976-47780998 AGGGCTTTACAGTTGCCCCAAGG - Intronic
907912762 1:58841352-58841374 AGGTAGATGCAGCTGCCCCAAGG - Intergenic
921588222 1:216973468-216973490 AGGTCGCTGCTGTTGCCCCAGGG + Intronic
1067737653 10:48870769-48870791 AGCAAGTTACAGGTGGCCCAGGG - Intronic
1075095306 10:119467298-119467320 AGGTCGGTCCAGCTGCCCCCTGG - Intergenic
1079452320 11:20607586-20607608 GGGTTGTTGCAGGAGCCCCAGGG - Exonic
1082267935 11:50139634-50139656 AGGTGTTCACAGGTGACCCAAGG - Intergenic
1082288154 11:50338887-50338909 AGGTGTTCACAGGTGACCCAAGG + Intergenic
1088881621 11:113977449-113977471 AGGTCGGAGCAGGTGGCCCACGG - Intronic
1091629507 12:2149005-2149027 AAGTCTTTACAGATGACCCAAGG - Intronic
1092103629 12:5905208-5905230 AGGTGGCTCCAGGTGCCACACGG - Intronic
1092181766 12:6451302-6451324 TTGTCATTACAGCTGCCCCAGGG + Exonic
1092552383 12:9517246-9517268 ATGTCTTTACATGTTCCCCAAGG - Intergenic
1094519736 12:31173365-31173387 ATGTCTTTACATGTTCCCCAAGG + Intergenic
1095625350 12:44307811-44307833 ATGTCCTAACAGGTGGCCCATGG + Intronic
1102700392 12:114834172-114834194 AGGTCATTACAGATTCCCAATGG + Intergenic
1118867450 14:69714566-69714588 CAGTCCTTACTGGTGCCCCAAGG + Exonic
1135591061 16:23705570-23705592 GTGACCTTACAGGTGCCCCAAGG - Intronic
1152409660 17:80117080-80117102 AGGTCGTACCATGTGCCCAAGGG - Intergenic
1153294147 18:3529719-3529741 AGGGCATTACAGGAGCACCAGGG + Intronic
1158041595 18:53101171-53101193 AGCTAGTTCCAGGTGGCCCAAGG + Intronic
1161289446 19:3485164-3485186 AGGTGCTCACAGGTGCCCCCTGG + Intergenic
1161488266 19:4547637-4547659 AGGTGCTTACAGGTGCCCTCTGG - Intronic
1165730683 19:38142833-38142855 AGGTCCTCAGAGGAGCCCCATGG + Intronic
932892480 2:75609044-75609066 AGCTCGTCCCAGGAGCCCCAGGG - Intergenic
937881963 2:126875149-126875171 AGGTCGGAGCAGGTGACCCAGGG - Intergenic
945276399 2:207991719-207991741 AAGTGGCTACAGCTGCCCCAAGG - Intronic
946868889 2:224068138-224068160 AGGTCATTACAGCTGCCCACAGG - Intergenic
1171045655 20:21807997-21808019 AAGTCATTTCAAGTGCCCCAAGG + Intergenic
1171066173 20:22017760-22017782 AGGGCATTTCAGGTGCTCCAAGG - Intergenic
1175269763 20:57725523-57725545 AGGTTCTTACTGGTGACCCAAGG - Intergenic
1182228955 22:28821824-28821846 AAGTCTTTACAGGTTACCCAAGG - Intergenic
950565312 3:13766496-13766518 AGCTCGGTACAGATGCTCCATGG - Intergenic
952955140 3:38552203-38552225 AGGTAGTCACAGGAGACCCAGGG - Intronic
953589971 3:44242043-44242065 AGGTCGTCGCATGTGCCCCGGGG - Exonic
956909655 3:73804347-73804369 AGGTGTTCACAGGTGACCCAAGG - Intergenic
965120083 3:164543012-164543034 CTGTCGCTACAGGTGCCCAATGG - Intergenic
969285599 4:6200232-6200254 AGGTGGGTACAGGTGCGCCGGGG - Exonic
969680411 4:8640119-8640141 GGGTGGTGACAGGGGCCCCAGGG - Intergenic
975651572 4:76598645-76598667 AGGTGGATACAGCTGCACCAGGG - Intronic
979302454 4:119102362-119102384 AGAACCTTACAGGGGCCCCATGG - Intergenic
996912833 5:128675077-128675099 AGGTCGTTAGTGGGGCTCCATGG + Intronic
1000003965 5:157166076-157166098 TTGTCGTTGCAGGTCCCCCATGG + Exonic
1001219553 5:169888356-169888378 AGGTGGTCACAGCTGCCCTACGG + Intronic
1003613266 6:7632110-7632132 CCGTCGTTAAAGGTGTCCCATGG + Intergenic
1005709102 6:28486462-28486484 AGGTGGTTACAGGAACACCAAGG - Intergenic
1013167952 6:107610498-107610520 AGGTCCTCGCAGGTGCCACATGG + Intronic
1015307522 6:131726351-131726373 AGGTTGTTATAGGTGCTACACGG + Intronic
1034343256 7:150371250-150371272 ACGTCGTTGCAGGGGCCCCCTGG + Exonic
1034836171 7:154353154-154353176 ATGTGGTTACAGGTCACCCAGGG - Intronic
1035378237 7:158421187-158421209 AGGACATGACAGGTGCACCAGGG - Intronic
1043587385 8:81784770-81784792 AGGAGGTTACAGGTGCTACAGGG + Intergenic
1055603974 9:77948969-77948991 AACTCCTTTCAGGTGCCCCAGGG + Intronic
1194055510 X:89127291-89127313 GGGTAGTCACAGGTACCCCAGGG - Intergenic