ID: 901932044

View in Genome Browser
Species Human (GRCh38)
Location 1:12602183-12602205
Sequence CTTGTGCAGGGGAAGTTGGA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 264
Summary {0: 1, 1: 0, 2: 1, 3: 25, 4: 237}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
901932035_901932044 29 Left 901932035 1:12602131-12602153 CCGGTCCTGACCAATTGAGCTAC 0: 1
1: 0
2: 0
3: 4
4: 47
Right 901932044 1:12602183-12602205 CTTGTGCAGGGGAAGTTGGATGG 0: 1
1: 0
2: 1
3: 25
4: 237
901932037_901932044 24 Left 901932037 1:12602136-12602158 CCTGACCAATTGAGCTACTTGGA 0: 1
1: 0
2: 1
3: 7
4: 65
Right 901932044 1:12602183-12602205 CTTGTGCAGGGGAAGTTGGATGG 0: 1
1: 0
2: 1
3: 25
4: 237
901932034_901932044 30 Left 901932034 1:12602130-12602152 CCCGGTCCTGACCAATTGAGCTA 0: 1
1: 0
2: 0
3: 4
4: 68
Right 901932044 1:12602183-12602205 CTTGTGCAGGGGAAGTTGGATGG 0: 1
1: 0
2: 1
3: 25
4: 237
901932038_901932044 19 Left 901932038 1:12602141-12602163 CCAATTGAGCTACTTGGACGCAG 0: 1
1: 0
2: 0
3: 2
4: 43
Right 901932044 1:12602183-12602205 CTTGTGCAGGGGAAGTTGGATGG 0: 1
1: 0
2: 1
3: 25
4: 237

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
901932044 Original CRISPR CTTGTGCAGGGGAAGTTGGA TGG Intronic
900419692 1:2550530-2550552 CTTTTGCACGGGAAGTGAGATGG - Intergenic
900425531 1:2576741-2576763 CTTTTGCACGGGAAGTGAGATGG + Intergenic
901144489 1:7055915-7055937 CTTGTGCAGAGGAAGGGGCAGGG - Intronic
901842823 1:11964585-11964607 CTGGTGGTGGGGAAGATGGAGGG - Intronic
901932044 1:12602183-12602205 CTTGTGCAGGGGAAGTTGGATGG + Intronic
903929860 1:26855963-26855985 CTGAGGCAGGGGAAGGTGGAGGG - Exonic
904036463 1:27561611-27561633 CTTGTTCAGGGGGTGTTGGCTGG + Intronic
904663978 1:32105939-32105961 CTTAAGCAGGGGCAGTAGGAAGG + Intergenic
905629376 1:39510370-39510392 CAGGTGCTGGGGAAGTCGGAGGG - Intronic
905668382 1:39775823-39775845 CAGGTGCTGGGGAAGTCGGAGGG + Intronic
905786542 1:40762495-40762517 CTGGGGCAGGTGAATTTGGAGGG - Intronic
907701040 1:56788620-56788642 TTTGTGCAGGAGAAGTGGGGAGG - Intronic
908390514 1:63679428-63679450 CAAGGGCAGTGGAAGTTGGAAGG - Intergenic
910624955 1:89296703-89296725 CATTGGCAGGGGAGGTTGGAGGG - Intergenic
913106343 1:115617172-115617194 CATTTGCAGGGGAAGGGGGATGG + Intergenic
913180057 1:116312316-116312338 CTTGTTCAGGAGAGGTTGGGAGG + Intergenic
913427802 1:118753892-118753914 CTTGAGCAGGGAAGGTGGGAAGG - Intergenic
920110320 1:203582900-203582922 CCTTTGCAGGGGAAGTAGGAAGG + Intergenic
920305459 1:205015540-205015562 CTTGTGCAGGGAGAGCTGGGAGG - Intronic
920916728 1:210263691-210263713 CCTTGGCAGGGGAAGTTTGAAGG + Intergenic
1063803099 10:9603850-9603872 CTTGTGTGGGGGAAGGTGTAGGG + Intergenic
1064593624 10:16921003-16921025 ATTTTGCAAGGGAAGTTTGAAGG - Intronic
1065755199 10:28924645-28924667 CACGTGCAGGGGAGGTGGGAAGG + Intergenic
1067180794 10:43984546-43984568 CTAGTGCATGGGAAGTGTGATGG + Intergenic
1067713622 10:48670788-48670810 CTGGTGGAGGGGAAGGTGAAGGG - Intergenic
1069370924 10:67746940-67746962 CTGGTGCTGGGGAAACTGGATGG + Intergenic
1069704746 10:70451269-70451291 CCCGTGGAGGGGAAGTGGGAAGG - Intergenic
1070955557 10:80461180-80461202 CCTGTGCAGGGTAGGCTGGAGGG - Intronic
1072942971 10:99783996-99784018 CTTGTGAAGTGGAAGTTGGGGGG - Intronic
1074247459 10:111709269-111709291 CTTCTGGAGGGGGATTTGGAAGG + Intergenic
1074284884 10:112088739-112088761 CTTTTGGGGAGGAAGTTGGATGG - Intergenic
1076055633 10:127370054-127370076 CATGTGCAGGGGGAGGTGGGTGG - Intronic
1077060401 11:615370-615392 CTTCTGCAGGGGCAGTTAGGTGG + Exonic
1077473320 11:2774970-2774992 CTTTTGCTGGGGAATTTGCAAGG - Intronic
1078880338 11:15442030-15442052 TTTCTGCAGGAGAAGATGGATGG + Intergenic
1079935277 11:26608837-26608859 CCTGGGCAGGGGAAGATGGCAGG - Intronic
1083366010 11:62141803-62141825 CTGGTGCAGGGGAGGAGGGAGGG - Intronic
1085122075 11:73973690-73973712 CTGGGGCAGGGGCAGGTGGAGGG + Intergenic
1085337396 11:75706556-75706578 CTCGTGCAGGGCAAGTGGGAGGG - Intergenic
1086171491 11:83841792-83841814 CTTGTCTATTGGAAGTTGGATGG - Intronic
1086532424 11:87801413-87801435 CCTATGCAGGGGAAGTTGTGAGG - Intergenic
1088850424 11:113699551-113699573 CTGGTGTGGGGGAGGTTGGAAGG - Intronic
1089307225 11:117534208-117534230 CTTGTGCTTGGGATGGTGGAGGG - Intronic
1091309833 11:134564509-134564531 ATTGTGGAGGAGGAGTTGGAGGG + Intergenic
1091433537 12:456071-456093 CTTCTGCAGGGGAACTTCCAGGG + Intergenic
1092999632 12:13982102-13982124 CATGTGCTGGGGAAGTGGGGTGG + Intergenic
1093078981 12:14787878-14787900 TTTGTGCAGGGGAAATGGTATGG - Intronic
1094856448 12:34405024-34405046 CTTGTGCATGTGCAGTGGGAAGG - Intergenic
1096465910 12:51847813-51847835 CTTGCGGTGGGGAAGTTTGAGGG + Intergenic
1097867031 12:64567488-64567510 ATTGTGCAGGAGAGGTTTGAGGG - Intergenic
1099653268 12:85456664-85456686 TTTGGCCAGGGGCAGTTGGAGGG + Intergenic
1100121651 12:91375564-91375586 GTTGTGCATGTGAAGTTAGAGGG + Intergenic
1100391035 12:94147048-94147070 CTCGAGCTGGGGAACTTGGAGGG + Intergenic
1101076479 12:101134592-101134614 CCTGTGCTGGGAAAGTTGGAGGG - Intergenic
1103909786 12:124345861-124345883 CTTGTGAAGGGGAAGGAGAATGG - Intronic
1105629924 13:22153017-22153039 CTTGGCCAGGGAAAGTTGCAGGG - Intergenic
1108243334 13:48490063-48490085 CTTTTGCAGGGGAAATGGAAAGG + Exonic
1110658977 13:78035877-78035899 CAAGTGCAGAGGAAGTTTGAGGG + Intergenic
1113490356 13:110686874-110686896 TTTGTGCAGGGGAGGGTGGGTGG + Intronic
1113522674 13:110951659-110951681 CTTGGGCAGGGGTAATTGCAAGG + Intergenic
1114389852 14:22295573-22295595 GTTCTGCAGGAGAAGTTGAATGG - Intergenic
1114700224 14:24670158-24670180 CATGTGCAGGGGAAATTATAGGG - Intergenic
1116091472 14:40312511-40312533 CCTGTGCAGGGGAAGCAGGCTGG + Intergenic
1118722477 14:68604250-68604272 CTTGTGCAGGGGGAGTTTCTCGG - Intronic
1121592879 14:95132469-95132491 GTTGTGCAGGGGAAATTGGATGG - Intronic
1122263416 14:100535697-100535719 CTTCTGCAGAGGAAGGGGGAGGG + Intergenic
1122598230 14:102908033-102908055 TTTGTGAAGGGGAAGTTGCAGGG - Exonic
1122931757 14:104936356-104936378 CATGAGCAGGGGAAGTGGGAAGG - Exonic
1123805768 15:23871024-23871046 CTTGTGCAGTGGATGTAAGAAGG - Intergenic
1124581828 15:30962597-30962619 CATGTTCATGGGACGTTGGAGGG - Intronic
1125364939 15:38903570-38903592 ATAGAGCAGGGGAGGTTGGAAGG - Intergenic
1125536831 15:40445833-40445855 ATTGTGCTGGGGACTTTGGAGGG + Intronic
1126492328 15:49251660-49251682 CTGGTGCAGGGTGAGGTGGATGG - Intronic
1126559245 15:50025444-50025466 CCTGTGGAGGGGAAGGAGGATGG - Intronic
1128083029 15:64867481-64867503 CTTGTCCTGGGGCAGATGGAGGG - Exonic
1128330575 15:66753067-66753089 ATTTTGCAGGTGAAGTTGAAGGG + Intronic
1129333980 15:74841701-74841723 CTTGTGAAGGGGCAGAGGGAAGG - Intronic
1132303052 15:100788263-100788285 CTGCTGCAGGGGAAGTAGCAGGG - Intergenic
1132304364 15:100800829-100800851 CATCTGCAGGGTAAGATGGATGG + Intergenic
1133339111 16:5025400-5025422 CTTCTGCAGGGGAAATTTCAAGG - Exonic
1133699200 16:8293566-8293588 CCTGTGCTGGGGAAGATGGAGGG - Intergenic
1136504172 16:30692246-30692268 CTGGTGAAGTGAAAGTTGGATGG - Intergenic
1139512061 16:67433163-67433185 CTTGTACAGGGCAGGTTGGGTGG - Intronic
1140552624 16:75883387-75883409 CTTGGGCAGGGGCAGGTGAAGGG + Intergenic
1143360516 17:6365447-6365469 CTTCTGCAGGGAAAGCAGGAAGG - Intergenic
1143490966 17:7285033-7285055 TTTGGGCACGGGAAGTAGGAGGG - Intronic
1144037709 17:11382320-11382342 CTTTGGGAGGGGAAGGTGGAAGG - Intronic
1144750085 17:17642505-17642527 CTTGTGGTTGGGAAGTAGGATGG + Intergenic
1144914768 17:18715322-18715344 CTTGAGCAGGGGGTGGTGGATGG - Intronic
1146058491 17:29592887-29592909 CTTTTGCTGGGGAAGTGGGGGGG - Intronic
1146314145 17:31794266-31794288 CATGTGGAAGGTAAGTTGGATGG - Intergenic
1146684319 17:34830603-34830625 CTTGTGCTGGGGGAGTGGGGTGG - Intergenic
1148077710 17:44948530-44948552 CATATGCTGGGGACGTTGGAAGG - Intergenic
1148258762 17:46160597-46160619 TTTGTGGAGTAGAAGTTGGATGG - Intronic
1148700128 17:49582121-49582143 CTTAGCCAGAGGAAGTTGGATGG - Intronic
1148835936 17:50465773-50465795 CTGTCGAAGGGGAAGTTGGAGGG + Exonic
1149784717 17:59425226-59425248 CCTGGGCAGGGAAAGTGGGAAGG + Intergenic
1150439401 17:65179163-65179185 GGTGTGCAGGGGAAGGAGGAGGG + Intronic
1150809788 17:68347397-68347419 CCTGTGATGGGGCAGTTGGAAGG - Intronic
1151848056 17:76671781-76671803 CTTGAGGTGGGGAAGATGGAAGG + Intergenic
1155200286 18:23511319-23511341 CTTGAGCAGGGGAGGGTGGGAGG + Intronic
1156876466 18:42019913-42019935 CTGGTGGAGAGGAAGTAGGAAGG - Intronic
1160192175 18:76723380-76723402 CTTGTCCAGAGGCAGTGGGAGGG + Intergenic
1160853266 19:1205058-1205080 CTAGTGCAGGAAAAGGTGGAAGG + Intronic
1160868751 19:1267612-1267634 CTTGTAGGGGGGGAGTTGGAGGG - Intronic
1161160295 19:2757877-2757899 CTCCTGCAGGGGAAGGTGAAGGG - Intronic
1161798555 19:6402133-6402155 CTGGTGCTGGGAAGGTTGGAGGG + Intergenic
1161927145 19:7309445-7309467 CTTGGGCAGGGAAAATTGGGGGG + Intergenic
1162333472 19:10045285-10045307 CTTTTGGGGTGGAAGTTGGAAGG + Intergenic
1162776993 19:12985897-12985919 CCTATGGAGGGGAAGATGGAGGG - Intergenic
1163190345 19:15672857-15672879 AGTTTGCAGGGGAAGTTGGAGGG - Exonic
1165199137 19:34131305-34131327 CTTGGGCTGGGGAGGTTGGGAGG - Intergenic
1165265085 19:34655181-34655203 CTAGTTCAGGTGAAGATGGAAGG + Intronic
1166317011 19:41994674-41994696 CTGCAGGAGGGGAAGTTGGAAGG + Intronic
1168466407 19:56605457-56605479 CTTGTGTGGTGGCAGTTGGATGG - Intronic
925047090 2:780716-780738 CTTGTGCAGGGGCTGGAGGAAGG + Intergenic
925340273 2:3131158-3131180 CTAGAGCAGGGAAAGCTGGAGGG + Intergenic
925377543 2:3398967-3398989 ACTGTGCAGGGGAGGTGGGAGGG - Intronic
925629963 2:5882061-5882083 CTTTTGCAGAGGAAGTTGCAGGG - Intergenic
925866732 2:8234636-8234658 CATGTTCAGGGGATGTAGGATGG + Intergenic
926226840 2:10972922-10972944 CTGGTGCAGGGGAAGCGGGGTGG + Intergenic
927441267 2:23119673-23119695 CTTGTGAAGGAGAAGCTGGCAGG - Intergenic
929279173 2:40059657-40059679 CATGTGCAGGAGAGGTTAGAAGG - Intergenic
929899976 2:45992496-45992518 CTTGTGCAATGGAAGTTGGCAGG - Intronic
930270524 2:49251185-49251207 ATTTTGCAGGGGAAGTTTAAAGG - Intergenic
930574660 2:53131719-53131741 CATGTGCTGGGGAAGTAGGAGGG + Intergenic
932445325 2:71777458-71777480 CTGGTGCTGGGGAACTGGGAGGG + Intergenic
932610015 2:73191944-73191966 CAGGTGCAGGGGAAGCAGGAGGG + Intergenic
933126498 2:78614564-78614586 CTTTAGCAGGTGAAGTTGAAAGG - Intergenic
933912741 2:86957719-86957741 ATTGTGAAGGTGAAGATGGATGG + Exonic
934010254 2:87812171-87812193 ATTGTGAAGGTGAAGATGGATGG - Exonic
934139817 2:89035659-89035681 CCAGTTCAGGGGAAGTTGGTGGG - Intergenic
934229423 2:90164892-90164914 CCAGTTCAGGGGAAGTTGGTGGG + Intergenic
935773818 2:106452891-106452913 ATTGTGAAGGTGAAGATGGATGG - Exonic
935906245 2:107843022-107843044 ATTGTGAAGGTGAAGATGGATGG + Exonic
935992712 2:108735545-108735567 ATTGTGAAGGTGAAGATGGATGG + Exonic
936128028 2:109808187-109808209 ATTGTGAAGGTGAAGATGGATGG + Exonic
936155806 2:110046862-110046884 CTTTTTCAGAGGAAGTTGGAGGG - Intergenic
936188882 2:110324566-110324588 CTTTTTCAGAGGAAGTTGGAGGG + Intergenic
936216669 2:110563298-110563320 ATTGTGAAGGTGAAGATGGATGG - Exonic
936425808 2:112417879-112417901 ATTGTGAAGGTGAAGATGGATGG - Exonic
936487427 2:112938208-112938230 CTTTGGCATGGGAAGTTCGAAGG + Intergenic
937080766 2:119137964-119137986 CTGGAGGAGGGGAAGTTTGAAGG + Intergenic
937983504 2:127628318-127628340 CTGGATCAGGGGAAGGTGGAGGG + Intronic
938196186 2:129330796-129330818 CATGTGCTGGGGAAGGTGGAGGG + Intergenic
938361560 2:130692303-130692325 CCTGTGCAGGGCAAGGTGGGCGG + Intergenic
939768845 2:146289348-146289370 CTTCTGCAGGGGAGGATGGCTGG - Intergenic
939772270 2:146336159-146336181 TTTGTGCAGGGGAAGAGGTAAGG - Intergenic
946199905 2:218065365-218065387 CTTGTGCTGGGGAAGGTGCAGGG + Intronic
946758553 2:222971223-222971245 TGTGTGCAGTGGAATTTGGAGGG + Intergenic
946909384 2:224444480-224444502 CTTTTGCAGGCAAGGTTGGACGG - Intergenic
1169022476 20:2340242-2340264 CTTCAGCAGGGGAAGCAGGAGGG - Intronic
1169344790 20:4821646-4821668 CCTGTGCTGGGGAGGCTGGAAGG - Intronic
1171019821 20:21574926-21574948 CTTGTGTAGGGGAAGTTCATGGG - Intergenic
1172017340 20:31885550-31885572 CTAGTGTTGGGGGAGTTGGAAGG + Intronic
1172435443 20:34925935-34925957 CTAGAGTAGGGGAACTTGGATGG + Intronic
1172935559 20:38617517-38617539 CATGAGCAGGGGAGCTTGGATGG + Intronic
1173319236 20:41972575-41972597 CTTGAGCAGGGGAACTTGCGTGG + Intergenic
1173597023 20:44265114-44265136 CTTGGGCAGGGCAAGTGGGATGG - Intronic
1174625203 20:51908588-51908610 CTTATGCATAGGAAATTGGAAGG + Intergenic
1175825607 20:61934879-61934901 CTTGCAAAGGGGAAGATGGAAGG - Intronic
1177539702 21:22476876-22476898 CTTGTGCAGGGGAAGGTTGCTGG - Intergenic
1178767936 21:35471983-35472005 CTTATGCAAGGGTAGTCGGATGG - Intronic
1179126822 21:38598395-38598417 CTTGTTCAGGGCCAGGTGGATGG - Intronic
1179577807 21:42318525-42318547 CTTGTGCAGGGGCTCCTGGATGG + Intergenic
1180632266 22:17237760-17237782 CTTGTCCATGGGCAGTTTGATGG - Intergenic
1180956688 22:19744430-19744452 CTGGTGGAGGGGAAGGTGAAGGG - Intergenic
1183212022 22:36457121-36457143 CGGGTGCAGGGGAGGTTGGAAGG - Intergenic
1184479059 22:44736663-44736685 CCTGTGCAGGGGCAGCTGCAGGG - Intronic
1184570833 22:45323938-45323960 CTGGTGCAGGGGAAGGTGCGTGG + Intronic
1184677225 22:46050351-46050373 CCTGTGAAGGGGAAGAAGGATGG - Exonic
1185276407 22:49951825-49951847 CTGGGGCAGGGCCAGTTGGAAGG + Intergenic
949157357 3:845551-845573 CTGCTGCAGGGGCAGTGGGAGGG - Intergenic
949977800 3:9476809-9476831 CTTGGGAAGGGGGAGTAGGATGG - Exonic
950964193 3:17134761-17134783 CCTGTGCAGGGGCATTTGGAAGG - Intergenic
951452708 3:22856963-22856985 CTTCTGCTGGGGAGGTTGGCAGG + Intergenic
954529261 3:51304231-51304253 CTGGTGCTGGGGAAACTGGACGG - Intronic
954749100 3:52803788-52803810 CCAGTGCAGGGGAAGTGGGCAGG + Intronic
955985557 3:64570572-64570594 CTTAGGTAGGGGAAGTTGGGAGG + Intronic
956361286 3:68450569-68450591 CTTGTGCAGTGGTGTTTGGAGGG - Intronic
957279203 3:78128035-78128057 TTGGGGCATGGGAAGTTGGAGGG - Intergenic
958447490 3:94233348-94233370 CTTGTGGAGGTGATGTTGCATGG + Intergenic
960341822 3:116484216-116484238 TGTGTGCTGGGGAGGTTGGATGG + Intronic
960574840 3:119219214-119219236 CTTTTGCAGGGGAGGGTTGAAGG + Intronic
960701243 3:120441353-120441375 CCTGTGCAGAGGCAGTAGGATGG - Intronic
961406452 3:126682998-126683020 CTTGTGCAGGCCCAGTTGAAGGG + Intergenic
962086631 3:132198351-132198373 CTTCAGTAGGGGAAGTGGGAAGG - Intronic
963356803 3:144218144-144218166 CTGGAGCAGGGGAAGTTTGGTGG + Intergenic
965259189 3:166458427-166458449 CATGTGCAGGGTCAGTAGGATGG - Intergenic
969263267 4:6046895-6046917 CTGGGGCAGGGGGTGTTGGAGGG - Intronic
970454784 4:16212345-16212367 ACAGTGCAGGGGAAGTGGGAAGG - Intronic
977334188 4:95675136-95675158 CAAGTGCAGGAGAAGATGGATGG + Intergenic
980166320 4:129232414-129232436 CTTGAGAAGTGGAAGTTTGATGG + Intergenic
980492434 4:133545326-133545348 CTTGTGCAGTGAGAGGTGGAGGG + Intergenic
982570943 4:157050104-157050126 CTTGAGCAGGAGCATTTGGATGG + Intergenic
984136840 4:175951926-175951948 ATGGTGTAGGGAAAGTTGGAAGG - Intronic
986501130 5:8401032-8401054 CTTGAGCAGGTGAAGATGGATGG + Intergenic
986826075 5:11524193-11524215 CCTGTGGAGGGGACGTGGGAAGG - Intronic
987509581 5:18819225-18819247 CTTGAGCATAGGAAGTTGGAAGG + Intergenic
988280679 5:29142630-29142652 CTTGTGATGAGGAAGTTGGAAGG + Intergenic
989578529 5:43010772-43010794 CCTGTGCAGCAGAAGGTGGATGG + Intergenic
991396066 5:66206559-66206581 ATTGTGCATGGGAAGGTGAAAGG + Intergenic
991402925 5:66273126-66273148 CTGCTGAAGGGGAAGCTGGAAGG - Intergenic
993276941 5:85872118-85872140 CTTTTTCAGGGACAGTTGGAAGG - Intergenic
993594423 5:89834887-89834909 CTTGGGGAGGCCAAGTTGGAAGG + Intergenic
994337869 5:98590344-98590366 CGTGTGCAGGGGACATAGGACGG - Intergenic
994528820 5:100940078-100940100 ATGGTGCAGGTGAAGTTGAAAGG - Intergenic
995643505 5:114284980-114285002 CTTGGGCAGAGTAAGTTGGCAGG + Intergenic
998188325 5:140000365-140000387 CTGCGGCAGGGGAAGCTGGAAGG - Intronic
999135413 5:149315721-149315743 CATGTGCTGGGGGAGTTGGAGGG + Intronic
1001568446 5:172715141-172715163 CTAGTTCTGGGGAAGTGGGATGG + Intergenic
1001884946 5:175281195-175281217 TGTGTGTGGGGGAAGTTGGAGGG - Intergenic
1002458087 5:179357364-179357386 CTTGTGCAGGTGACTTTGGCAGG - Intergenic
1004322189 6:14640644-14640666 TTTGGGCAGGAGAAGTGGGAGGG - Intergenic
1006027524 6:31157076-31157098 CTTGTCCAGGGGAACATAGATGG - Exonic
1006176002 6:32121984-32122006 CCTGAGCAGGGGAAGTGGCAGGG + Intronic
1007482998 6:42162494-42162516 CTGGTGGAGGGCAAGCTGGAGGG + Intronic
1012489599 6:99766520-99766542 CTTGGGCAGGGAAAGGTGAAGGG - Intergenic
1012678804 6:102153136-102153158 CTTATGCAGGGGAAAATCGAGGG - Intergenic
1013108866 6:107049116-107049138 CTTGTTCTGGGGAGGTTGAAAGG + Intronic
1016332948 6:142972971-142972993 CTTGTGGTGGGGAGGTTGGGAGG + Intergenic
1019936061 7:4258736-4258758 CTTGTGGTAGGGAAGTTGAATGG + Intronic
1022327315 7:29344028-29344050 CTTGGGCAGAGGAAGATGAATGG - Intronic
1022385247 7:29893091-29893113 TCTGTGCAAGGGAGGTTGGATGG + Intronic
1022823725 7:33987417-33987439 CTTGAGAAGGGAATGTTGGATGG - Intronic
1022895892 7:34750200-34750222 CCTGTGCAGGGTAACTTGTAGGG - Intronic
1024238144 7:47413727-47413749 CTTGTGCAGGGCAGGAGGGAGGG + Intronic
1024324277 7:48096515-48096537 CTGGGGAAGGGGAAGTGGGAGGG - Intronic
1024365490 7:48515737-48515759 CCTGTGCAGTGGATGCTGGAAGG + Intronic
1026550863 7:71367377-71367399 TGTGTGCAGGGGAGGTGGGAAGG + Intronic
1028506080 7:91571649-91571671 TTTGTGCATGGCAAGTTGGGTGG + Intergenic
1029272445 7:99385285-99385307 ATGGGGCAGGGGAAGTTGGGTGG + Intronic
1029364195 7:100106743-100106765 CGTGTGCCGGGGAAGCTCGAAGG - Exonic
1030370627 7:108695170-108695192 CTTGTGAAGGGGAAGATCCATGG + Intergenic
1031083208 7:117278117-117278139 CTTGTAGAAGGGAAGGTGGATGG + Exonic
1031339424 7:120580430-120580452 CTTGTGGAGCAGAAGGTGGAAGG - Intronic
1032059591 7:128713415-128713437 GGTTTGCAGGGGAAGTAGGAAGG + Intronic
1033652496 7:143353460-143353482 CTTGGCCTGGGGAAGTGGGAGGG - Exonic
1034516646 7:151586039-151586061 TCTGTGCAGGGGCAGTGGGACGG - Intronic
1035797943 8:2376470-2376492 CTGGTGAAGGGGAAGCTGGCAGG + Intergenic
1037897923 8:22670434-22670456 CTTGAGCAGGAGAGGTAGGAGGG + Intergenic
1040444303 8:47478001-47478023 CATGTGAAGGGGAAGTGGTATGG + Intronic
1043132144 8:76474574-76474596 CTTGTGAAGGTGAAGATGGCTGG + Intergenic
1046259205 8:111744397-111744419 ATTGTGGAGAGGAGGTTGGATGG + Intergenic
1049376324 8:142291049-142291071 CCTGGGCAGGAGAGGTTGGAGGG - Intronic
1049494959 8:142925619-142925641 CCTGTGCTGGGGAGGTGGGAAGG + Intergenic
1050498688 9:6271284-6271306 CTTGGGCAGGGGAGTGTGGAGGG - Intergenic
1054837503 9:69693378-69693400 ATTGTGCTGGGGAAACTGGATGG - Intergenic
1055559629 9:77510124-77510146 CTAGAGCTGGGGGAGTTGGAAGG - Intronic
1056832354 9:89927510-89927532 TTTGGGAAGGGGAAGTTGGCAGG - Intergenic
1056879828 9:90380517-90380539 CTGGGGGTGGGGAAGTTGGAAGG - Intergenic
1057796129 9:98159487-98159509 CAGGTGCTGGGGAAGCTGGAAGG - Intronic
1058326837 9:103708923-103708945 CATGTGAAGGAGATGTTGGATGG + Intergenic
1058850293 9:109005379-109005401 TTTGTGGAGGGGGAGTGGGAGGG - Intronic
1060823349 9:126673765-126673787 CTTGTGCAGGGGTGGTGGGAGGG + Intronic
1062269600 9:135702475-135702497 CGGGTCCTGGGGAAGTTGGATGG - Intronic
1189966134 X:46375739-46375761 CTTGTGCTGGTGAAAGTGGAGGG + Intergenic
1192025914 X:67451253-67451275 CCTGTGCTGGGGAGGCTGGAGGG + Intergenic
1194445873 X:93986702-93986724 CTGGAGCAGGGGATGCTGGATGG + Intergenic
1194455458 X:94097850-94097872 CTTCCTCAGGGGAATTTGGAAGG - Intergenic
1194501625 X:94689358-94689380 TTTGTGCAGGGAAATTTGGGTGG - Intergenic
1199704870 X:150415237-150415259 CTTGGGCATTGGAAGTTAGAGGG - Intronic
1200070255 X:153525704-153525726 CTGGTGCAGGAGAAGAGGGAGGG + Intronic
1201558634 Y:15291438-15291460 CTTGTGCAGTGGAGGTGGGAAGG + Intergenic