ID: 901932132

View in Genome Browser
Species Human (GRCh38)
Location 1:12602559-12602581
Sequence TCTAATATGCAGAAGGAGAA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 473
Summary {0: 1, 1: 0, 2: 4, 3: 31, 4: 437}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
901932129_901932132 -7 Left 901932129 1:12602543-12602565 CCTGCTGAGCATCTGCTCTAATA 0: 1
1: 0
2: 0
3: 11
4: 103
Right 901932132 1:12602559-12602581 TCTAATATGCAGAAGGAGAAGGG 0: 1
1: 0
2: 4
3: 31
4: 437
901932127_901932132 25 Left 901932127 1:12602511-12602533 CCAGTGGGTTTTTTGCCTTTTTT 0: 1
1: 0
2: 7
3: 103
4: 1248
Right 901932132 1:12602559-12602581 TCTAATATGCAGAAGGAGAAGGG 0: 1
1: 0
2: 4
3: 31
4: 437
901932128_901932132 10 Left 901932128 1:12602526-12602548 CCTTTTTTCTCTGATGTCCTGCT 0: 1
1: 0
2: 5
3: 50
4: 464
Right 901932132 1:12602559-12602581 TCTAATATGCAGAAGGAGAAGGG 0: 1
1: 0
2: 4
3: 31
4: 437

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
901932132 Original CRISPR TCTAATATGCAGAAGGAGAA GGG Intronic
901932132 1:12602559-12602581 TCTAATATGCAGAAGGAGAAGGG + Intronic
904018843 1:27446026-27446048 TCCTATATGCAGAAAGAGATGGG - Intronic
904054589 1:27661829-27661851 TCTGATCTGCAGAAGGGGTAGGG - Intergenic
904862706 1:33550769-33550791 TGTAAGATGCAGATGGAAAAGGG - Intronic
907157409 1:52347108-52347130 TTTTTTATGGAGAAGGAGAAAGG - Intronic
907393557 1:54174400-54174422 CCTACTATGTAGAAGGAGGATGG - Exonic
908798488 1:67854779-67854801 TTTACCATGGAGAAGGAGAAGGG - Intergenic
909095595 1:71283789-71283811 TCTAATATGCAGAATCTGTAAGG - Intergenic
910128775 1:83877683-83877705 GCTAATATCAAGAAGGAAAAGGG - Intronic
910763484 1:90758075-90758097 ACTAGTATGAAGATGGAGAAGGG + Intergenic
911714255 1:101112499-101112521 TTAAAAATGCAGAAGGAAAAGGG - Intergenic
913137033 1:115901410-115901432 TTTATTATGGAGAAGGGGAAAGG - Intergenic
913320690 1:117586548-117586570 TACAGTATGAAGAAGGAGAAGGG + Intergenic
914735136 1:150409164-150409186 ATTATTATGCAGAAGGGGAAAGG - Intronic
916960695 1:169885650-169885672 AATAAAATGCAGAAAGAGAAAGG + Intronic
919098539 1:193065467-193065489 ACTAATAAGCAGAAGTAGACAGG + Intronic
920058035 1:203206744-203206766 TCTGAGATGCAGAATGAAAAAGG - Intergenic
920626522 1:207607094-207607116 ACTAATTTGCAGATGGAGATGGG + Intronic
920714499 1:208326912-208326934 TATAATAGACAGGAGGAGAAAGG - Intergenic
922516181 1:226209848-226209870 TCAAATCACCAGAAGGAGAAGGG - Intergenic
923648021 1:235844543-235844565 TCTAATCGACAGAAGAAGAAAGG - Intronic
923805820 1:237256766-237256788 TCTAAAATGCAAAGTGAGAACGG + Intronic
924046423 1:240036517-240036539 TCCAATATCAAGCAGGAGAAAGG + Intronic
924268976 1:242312722-242312744 TCCAATTTGCAGAAGGAAATTGG + Intronic
924271326 1:242335840-242335862 TCTAATATGATGAAAAAGAAAGG + Intronic
924860158 1:247911900-247911922 TCTAATATCCAGATGGAAAGGGG + Intergenic
1062822572 10:545856-545878 TCTAATCTGTTGATGGAGAAAGG - Intronic
1063033418 10:2259305-2259327 GGAAATATGCAGAAGGAGATGGG + Intergenic
1063074648 10:2702321-2702343 TCAAATATGAAGAAGGGGATGGG - Intergenic
1064785627 10:18891384-18891406 TCTAATGGGAAGAAGGAAAAAGG + Intergenic
1064939469 10:20716858-20716880 TCTATTTTGAAGCAGGAGAATGG - Intergenic
1065169797 10:23015137-23015159 TCTAATATGGAGAAGAGAAAGGG + Intronic
1066679358 10:37921940-37921962 TCTAATATGCAGAATCTGTAAGG + Intergenic
1066715933 10:38286048-38286070 TCCAATTTGCAGAAGGAAACTGG - Intergenic
1068581166 10:58741267-58741289 ATTGATTTGCAGAAGGAGAAGGG + Intronic
1068829637 10:61478732-61478754 TCTAATATACAGAGGTAAAAAGG - Intergenic
1071085527 10:81864434-81864456 TCTAATATGATGAAGGATATGGG - Intergenic
1071677925 10:87673946-87673968 GATAACATGCAGAAGGAAAAGGG - Intronic
1072028359 10:91489164-91489186 TCTACTTTAAAGAAGGAGAATGG + Intronic
1074358067 10:112803362-112803384 TCTAAAATGAAGAAGGAGGCTGG - Intronic
1079056296 11:17208867-17208889 TCTTTTAAGCAGTAGGAGAAGGG + Intronic
1079414776 11:20223562-20223584 TGTAATAAGCAGAAAGACAAGGG - Intergenic
1080735313 11:35008398-35008420 TCTGGTCTGCAGAAGGTGAAAGG - Intronic
1080797653 11:35580412-35580434 TAGAATATGGAGAAGGAGATGGG + Intergenic
1080887367 11:36378498-36378520 ACTAATATGTAAAAGAAGAAAGG + Intronic
1081074096 11:38647141-38647163 TCCAAAATGCATATGGAGAAGGG - Intergenic
1081448876 11:43154196-43154218 TCTAATATCCAGAGGGGGAGTGG + Intergenic
1081449960 11:43161416-43161438 TCTAATATTCAGTGGGAGAGAGG + Intergenic
1081450936 11:43170226-43170248 TCTAATATCCAGGGGGAGAGAGG - Intergenic
1082304616 11:50556162-50556184 CCTAATATCCATAAGCAGAATGG + Intergenic
1082809273 11:57468793-57468815 TCTGTTATGCAGCTGGAGAATGG + Intronic
1084807817 11:71591224-71591246 CCTAATATCCACAGGGAGAAAGG - Intronic
1085374577 11:76047536-76047558 TCTAATTTAGAGAAGGACAAGGG + Intronic
1086067176 11:82757774-82757796 TCTAATTTTGAGAAGGAGATAGG + Intergenic
1086214324 11:84359736-84359758 TCTAATATGCTTAAGAAGAAAGG - Intronic
1086360532 11:86054373-86054395 TCTAAAATGAAGACGGAGGATGG + Intronic
1086920041 11:92575804-92575826 GTTAATAGGCAGAAGGAGGAAGG + Intronic
1087779711 11:102289413-102289435 TTTATTATAGAGAAGGAGAAGGG - Intergenic
1090130943 11:124141623-124141645 GCTGAGATGCAGAAGGAGGACGG - Exonic
1090433017 11:126662526-126662548 CCTTATATGCAGAAGGTGGAAGG + Intronic
1091261866 11:134241139-134241161 TCAAATATCCAAAAGTAGAAAGG + Intronic
1092431918 12:8417103-8417125 TCTAATATCCAGCAGGGGAGAGG + Intergenic
1092511193 12:9158463-9158485 TCCCAGATGCAGAAGGACAATGG - Exonic
1093183975 12:15999006-15999028 TCTAATATGTTGAAGATGAAAGG - Intronic
1093668899 12:21848850-21848872 GAAAATATGCAGAAAGAGAAGGG + Intronic
1093709429 12:22313095-22313117 TCTCATATGTAGTAGGAGATAGG - Intronic
1095128241 12:38507855-38507877 GTTAATATGCAAAAGTAGAAAGG + Intergenic
1095264140 12:40133751-40133773 TCTAGGAATCAGAAGGAGAATGG - Intergenic
1095697147 12:45155651-45155673 TCTAATATCCAAAAGCAAAAAGG + Intergenic
1096107225 12:49003481-49003503 TTAAATATGGAGAGGGAGAAGGG - Intronic
1096508686 12:52114759-52114781 CCTAATATCCAGAGGGAGAGAGG + Intergenic
1096508698 12:52114833-52114855 CCTAATATCCAGAGGGAGAGAGG + Intergenic
1097435102 12:59545728-59545750 TGTAATATGCGGAAGGGGAGGGG + Intergenic
1097436006 12:59552268-59552290 CCTAATATCCAGAAGGGGAGAGG + Intergenic
1098478886 12:70938784-70938806 TCTAATATCCAGGAGGAAAGAGG - Intergenic
1098479192 12:70940602-70940624 TCTAATATCCAGAAGGGGAGAGG - Intergenic
1098652851 12:72995562-72995584 ACTAAAATGAAGAAGAAGAAAGG + Intergenic
1099180431 12:79469071-79469093 TCTAATATCCAGGGGGAGAGAGG + Intergenic
1099180581 12:79470055-79470077 CCTAATATCCAGAAGGGGAGAGG + Intergenic
1099180813 12:79471448-79471470 CCTAATATCCAGAAGGGGAGAGG + Intergenic
1099181412 12:79475338-79475360 CCTAATATGCAGGGGGAGAGAGG + Intergenic
1100067895 12:90672730-90672752 TCTAATATGTAAAGGGAAAATGG + Intergenic
1100370157 12:93961772-93961794 TTAAAGATTCAGAAGGAGAAGGG + Intergenic
1100692382 12:97052198-97052220 TATAGTTTGCAAAAGGAGAAAGG - Intergenic
1101123643 12:101609058-101609080 TCTGAAAAGGAGAAGGAGAAGGG + Intronic
1101236032 12:102791297-102791319 TCAAATATGGAGAAAGAAAAAGG - Intergenic
1103481737 12:121254477-121254499 TTTAACAAGCAGAAGCAGAAAGG + Intronic
1103719020 12:122963694-122963716 TCTGAGATGCAGAGGGGGAATGG + Intronic
1107326691 13:39251291-39251313 TCTGTTATGTAGAAGGAAAATGG - Intergenic
1107783338 13:43928285-43928307 TCAAATATGAAGAAGGGGTATGG + Intergenic
1107802125 13:44118409-44118431 TCTAGAATCCAGGAGGAGAAAGG - Intergenic
1108494226 13:51008135-51008157 ACTGAAAAGCAGAAGGAGAAAGG - Intergenic
1108749046 13:53427652-53427674 TCTAATATCCAGAAGCTAAAAGG - Intergenic
1109355554 13:61227873-61227895 TCTAATATTCAGAAGGGGAGAGG - Intergenic
1109355961 13:61230206-61230228 CCTAATATCCAGAAGGAGAGAGG - Intergenic
1109409427 13:61943736-61943758 TTTAATATGCAGGAGGGGAGAGG - Intergenic
1110246932 13:73336698-73336720 TCTAGTTTGCAGCAGGAAAATGG - Intergenic
1112788107 13:102973846-102973868 TCTAACATGCACAAGGAAGAAGG - Intergenic
1114436719 14:22712994-22713016 TCTAATATGCGGAAGTGGAGAGG + Intergenic
1114437046 14:22715006-22715028 TCTAATATGCAGAAGGGGAGAGG + Intergenic
1115344045 14:32323273-32323295 AATCTTATGCAGAAGGAGAAAGG - Intergenic
1115758662 14:36556184-36556206 TCTAATATGCAAAATGAAAGAGG - Intergenic
1115920814 14:38371381-38371403 ACTAAGATGAAGAATGAGAATGG + Intergenic
1116516872 14:45815192-45815214 CCTAATATCTAGAAGGGGAAAGG + Intergenic
1116516904 14:45815421-45815443 CCTAATATTCAGAGGGAGATAGG + Intergenic
1116516975 14:45815874-45815896 TCTAATATCCAGGAGGGTAAAGG + Intergenic
1116517425 14:45818534-45818556 CCTAATATCCAGAGGGAGAGAGG - Intergenic
1116517686 14:45820138-45820160 CCTAATATCCAGAAAGAGAGAGG - Intergenic
1116518898 14:45828019-45828041 TCTAATATCCAAAAGGGGAGAGG + Intergenic
1116519437 14:45831682-45831704 CCTAATATCCAGAGGGAGATAGG - Intergenic
1116519840 14:45834327-45834349 CCTAATATCCAGAAAGAGAGAGG - Intergenic
1116712755 14:48389954-48389976 TCTATGAGGCAGAAGGAGAAAGG + Intergenic
1117738015 14:58787378-58787400 ACTAATGTGAAGAATGAGAAAGG - Intergenic
1118573265 14:67215605-67215627 TATAAGATGCAGAAGGATAGAGG + Intronic
1119014059 14:71031192-71031214 GCAAATATGCAAATGGAGAAGGG + Intronic
1120136676 14:80878119-80878141 TCTAATATGCTGGAGGACCAGGG - Intronic
1120311983 14:82840526-82840548 TCTAATAAAGAGAAGAAGAATGG - Intergenic
1120958830 14:90106270-90106292 ACTAATATGCAAAATAAGAAAGG + Intronic
1122322747 14:100865531-100865553 TCTGATGGGCAGAAGGACAAAGG - Intergenic
1122451285 14:101810013-101810035 TCGAATATGGAGAAGGACCACGG - Intronic
1126759925 15:51960733-51960755 TCTTCAATGCAGAAGGAAAAAGG + Exonic
1127847090 15:62879906-62879928 ACAATTATGCAGAAGGTGAAGGG + Intergenic
1127860217 15:62987936-62987958 TCCAAAATGCAAGAGGAGAAGGG - Intergenic
1129662282 15:77559807-77559829 CATAATATCCAGAAGGAGAGAGG + Intergenic
1133506348 16:6416184-6416206 TCGCTTATGCGGAAGGAGAAGGG + Intronic
1133686980 16:8174771-8174793 TCAAGTATGTAGAAGGAGGATGG - Intergenic
1134244102 16:12527144-12527166 TCAAAAAGGAAGAAGGAGAAGGG - Intronic
1134389030 16:13801481-13801503 TCTAACATGCTGAAGAAGACAGG + Intergenic
1135197468 16:20406148-20406170 TCTAATAGGCAGATGGAAAACGG - Intergenic
1136866500 16:33761578-33761600 TCTACAAGTCAGAAGGAGAAGGG - Intergenic
1137937598 16:52649470-52649492 TCAAATATGCAAAATTAGAAAGG + Intergenic
1137970105 16:52976060-52976082 ACTAAAATGCAGAAGAAAAAAGG + Intergenic
1140971021 16:80012610-80012632 TCTTATTTGCAGAATGGGAATGG - Intergenic
1141877311 16:86834715-86834737 TCTAAGCTGCAGGAGGACAAGGG + Intergenic
1144250692 17:13413803-13413825 TGTACCATGAAGAAGGAGAAAGG + Intergenic
1146227589 17:31080162-31080184 TCTGATAGGCAAAATGAGAAAGG - Intergenic
1151263283 17:72933855-72933877 TCTAAAATGTGAAAGGAGAAAGG + Intronic
1152501947 17:80717990-80718012 TCTTCTTTGCAAAAGGAGAAAGG + Intronic
1152690236 17:81714664-81714686 CCTCATCTGCAGAAGGAGAATGG + Intronic
1153016764 18:589720-589742 TCTAACATGCAGAAAGGGAAAGG - Intergenic
1153843119 18:9024582-9024604 GCTCAGATGCAGAAGTAGAATGG + Intergenic
1155216249 18:23645592-23645614 TCTAATCTAGAGAAGCAGAAGGG - Intronic
1155468970 18:26170763-26170785 TCTGATGTCCAGGAGGAGAAAGG - Intronic
1156541390 18:37914895-37914917 TCAAAATTGCAGAAGCAGAATGG + Intergenic
1156705357 18:39875057-39875079 TTTAATATGAAGAAAGAAAAGGG - Intergenic
1157049294 18:44142170-44142192 TCTAATAGGCAAAAGGAATAGGG - Intergenic
1157960017 18:52143034-52143056 TCTAAAATCCAGTAGGACAATGG + Intergenic
1157963265 18:52180489-52180511 GCTAAAATCCAGAAGGAGAAAGG + Intergenic
1158049222 18:53195126-53195148 ACTAATATCAAGTAGGAGAAGGG + Intronic
1158808790 18:61007122-61007144 TCTAATATGCAGAAGTAAGTAGG + Intergenic
1159752694 18:72322586-72322608 TCTAATATCCAGAAGGAAAGTGG + Intergenic
1160062093 18:75540103-75540125 TTGAATCTGCAGAAGGAGGAAGG + Intergenic
1160421708 18:78752109-78752131 TCTCATGTGCGGAAGCAGAATGG - Intergenic
1165268695 19:34684930-34684952 TCTTAGATGCTGAATGAGAAGGG - Exonic
1166236406 19:41460249-41460271 CCTAATATCCAGAAGGGGAGAGG - Intergenic
1166237360 19:41466259-41466281 TCTAATATACAGAGGGGGAGAGG - Intergenic
1166237684 19:41468382-41468404 CCTAATATTCAGAAAGGGAAAGG - Intergenic
1166237829 19:41469290-41469312 TTTAATATCCAGATGGAGAGAGG - Intergenic
1166238054 19:41470738-41470760 GCCAATATGCAGCAGGAGAGAGG - Intergenic
1166243955 19:41512622-41512644 CCTAATATCCAGAAGGAAAGAGG - Intergenic
1166244715 19:41517209-41517231 CCTAATATCCAGAAGGAAAGAGG - Intergenic
1166245583 19:41523258-41523280 TCTAATATTCAGGTGGAAAACGG - Intergenic
1166245802 19:41524729-41524751 CCTAATATCCAGAAAGGGAAAGG - Intergenic
1166631111 19:44408863-44408885 TCTATTATTCAGACTGAGAATGG - Intergenic
1167986399 19:53321007-53321029 TCCAATATAAAAAAGGAGAAAGG - Intergenic
926548967 2:14277897-14277919 TGTAATATGCAGAATGTGTAAGG - Intergenic
926644257 2:15271970-15271992 ATTAATATGCAGAAGGAAAAAGG - Intronic
926819688 2:16838901-16838923 TCTCAGAGGCAGCAGGAGAAGGG - Intergenic
927093823 2:19732633-19732655 TGTAAAATTGAGAAGGAGAAAGG + Intergenic
928911135 2:36422396-36422418 TCAATTATGCAGGGGGAGAAAGG - Intronic
930285882 2:49427318-49427340 TTTAAAATGCAGAAGTAAAATGG - Intergenic
930465612 2:51745232-51745254 TGTACTATGCATAAGGAAAAGGG - Intergenic
931100847 2:58999149-58999171 TATAATATGCAGAAGCTAAAGGG + Intergenic
932083914 2:68740437-68740459 TCCAGTGTGCAGCAGGAGAAGGG - Intronic
933675791 2:85056308-85056330 TCTAATATTGAGAGGGAAAATGG - Exonic
934101976 2:88661746-88661768 TTTAATAGGCAGAATTAGAAAGG - Intergenic
934635188 2:95980161-95980183 TCTACAAGTCAGAAGGAGAAGGG - Intronic
934798443 2:97125076-97125098 TCTACAAGTCAGAAGGAGAAGGG + Intronic
934834985 2:97578419-97578441 TCTACAAGTCAGAAGGAGAAGGG - Intronic
935035203 2:99364481-99364503 CTTAATGTTCAGAAGGAGAATGG + Intronic
936557432 2:113508736-113508758 TCTAATATACAGAAAGGGAGAGG - Intergenic
936592751 2:113819685-113819707 ATTAATATTCAAAAGGAGAAGGG + Intergenic
937655848 2:124375071-124375093 TCTAATGAACAGAAGTAGAATGG + Intronic
937854814 2:126664627-126664649 TCTAATATTTGGGAGGAGAAGGG + Intronic
937885844 2:126899591-126899613 TCTGATGGGCTGAAGGAGAAGGG + Exonic
939597139 2:144139193-144139215 TCTAATATAAATAAGGAGATTGG - Intronic
939656342 2:144830757-144830779 AGAAATATGCAGGAGGAGAAGGG + Intergenic
939832312 2:147087830-147087852 TCTAAATTGCAGAAGGCCAAGGG - Intergenic
940019495 2:149142075-149142097 TCTAATATGCAGCATGGGCAGGG - Intronic
940499672 2:154478219-154478241 TCTAATAGGGAAAAGCAGAAGGG + Intergenic
940872528 2:158871486-158871508 CCTAATATCCAGAGGGAGAGAGG - Intergenic
941319310 2:164034473-164034495 TCCAACATGAAGAAGAAGAAAGG + Intergenic
941533173 2:166693820-166693842 CCTAATATCCAGAGGGAGAGAGG - Intergenic
941594066 2:167453783-167453805 TCAAATATGTAAAAGGAGGAAGG + Intergenic
941766413 2:169301910-169301932 TCTAATATTCAAAAGGATTAGGG - Intronic
942115472 2:172725176-172725198 TCAAATATTCAGCAGAAGAATGG + Intergenic
942317091 2:174706590-174706612 TCTAATATCCAGAAGTGGAGAGG - Intergenic
942317310 2:174707956-174707978 TCTAATATCCAGAAGGTGAAAGG - Intergenic
943763503 2:191635357-191635379 TATAATATGAGGAATGAGAAGGG + Intergenic
943794432 2:191974018-191974040 TCTTATTAGCAGAATGAGAATGG + Intronic
944308387 2:198203955-198203977 TAAAATATGCAGAATGAGAAGGG + Intronic
944991588 2:205243481-205243503 TCTCATCTGTAGAATGAGAATGG + Intronic
945782328 2:214191081-214191103 TCTAGAATTCAGAAGAAGAATGG - Intronic
946220860 2:218225483-218225505 TTTAATATGCTTAAAGAGAAAGG - Intronic
947031108 2:225796323-225796345 TGTTATATGCTGGAGGAGAATGG + Intergenic
947907968 2:233779533-233779555 TCCACTGTGCAGATGGAGAAAGG - Intronic
948418934 2:237840687-237840709 TCTAATATGCAGAATCTGTAAGG + Intronic
1168868709 20:1110582-1110604 TGTCATATGGAGAAAGAGAAGGG - Intergenic
1169215146 20:3789232-3789254 TCAAATAAACAAAAGGAGAATGG - Intronic
1170435362 20:16321694-16321716 TCAGATGTGCAGAAGGAAAATGG + Intronic
1172476344 20:35241062-35241084 GCTAATGTGCATAAAGAGAATGG + Intronic
1173058231 20:39636659-39636681 TGTCATCTGCAGAATGAGAATGG - Intergenic
1174493242 20:50919156-50919178 TAAAATATGCAGCAGGACAAGGG + Intronic
1174794906 20:53513909-53513931 TCTAATCAGCAGAAAGAGAATGG - Intergenic
1174925116 20:54750739-54750761 TACAATAGGCAGAAGGTGAAGGG + Intergenic
1175425281 20:58861037-58861059 TCTAAAAAGAAGAAGGAGCATGG - Intronic
1177410890 21:20729178-20729200 TTTAATATGAACATGGAGAAAGG - Intergenic
1177490162 21:21813544-21813566 TGCAAAATGCAGAAGGACAAGGG + Intergenic
1178251167 21:31004611-31004633 TCCAAGATGCAGAGGGAGCAAGG + Intergenic
1179640587 21:42745155-42745177 TCTCAGAGGCAGAAGGTGAAGGG + Intronic
1183116005 22:35693293-35693315 CCTAATATGCAGGGGGAGAGAGG + Intergenic
1183116951 22:35699667-35699689 CCTAATATGCAGGGGGAGAGAGG + Intergenic
1183758150 22:39790073-39790095 CTGAATGTGCAGAAGGAGAAGGG + Intronic
1183839429 22:40485803-40485825 TCTAAGATGGAGGAGGAGCAAGG + Intronic
1184200855 22:42968404-42968426 TCCAAAATATAGAAGGAGAAGGG - Intronic
949813114 3:8029219-8029241 TCTGATATTCAGAAGGAGCGGGG - Intergenic
952764577 3:36943859-36943881 TTTAAGAAGCAGAAAGAGAATGG - Intronic
953735459 3:45490433-45490455 TTCAATAAGTAGAAGGAGAATGG + Intronic
954655363 3:52191137-52191159 CCTGATATGGAGAAGGAGCATGG - Intergenic
955991665 3:64634254-64634276 TTTAAAATGTAGAAGGTGAAAGG + Intronic
956562967 3:70602583-70602605 TCCAATAAGCAGAAAGAGATAGG + Intergenic
957439161 3:80220146-80220168 TTAAAAATGTAGAAGGAGAATGG + Intergenic
957520621 3:81313839-81313861 TCTAATAAGCAGCATGAGACTGG - Intergenic
958446341 3:94219896-94219918 TGTAAAATGTAGAAGGGGAAAGG - Intergenic
958780435 3:98534447-98534469 TCTAATATTTAGAAGTAAAATGG - Intronic
959410739 3:106018024-106018046 CCCAATATGCAGAATGAGATTGG + Intergenic
959804269 3:110532167-110532189 TCCATTATGCAGATGGAGGAAGG - Intergenic
959982197 3:112528848-112528870 CCTAATATCCAGAGGGAGAGAGG + Intergenic
959982214 3:112528946-112528968 CCTAATATCCAGGAGGAGAGAGG + Intergenic
959982267 3:112529240-112529262 CCTAATATCCAGAGGGAGAGAGG + Intergenic
959982281 3:112529315-112529337 CCTAATATCCAGAGGGAGAGAGG + Intergenic
961059746 3:123818271-123818293 TTTAATCTGCAGAATGATAAAGG - Intronic
961732688 3:128978185-128978207 TCTAGAATGCAGGAGAAGAAAGG + Exonic
961832407 3:129630534-129630556 TCTACTATGGAGAAGTAGGATGG + Intergenic
963124539 3:141802935-141802957 TAGAATATGCAGAAGGGAAAAGG - Intronic
963662254 3:148141750-148141772 ACTTTTATGAAGAAGGAGAAGGG + Intergenic
964888846 3:161515213-161515235 TCTAATATGCAGAGGGGGAGAGG - Intergenic
964888910 3:161515591-161515613 TCTAATATTCAGGTGAAGAAAGG - Intergenic
965327078 3:167319863-167319885 TCAAATAAGCAAAGGGAGAATGG + Intronic
965436166 3:168654743-168654765 TCTATCTTGCAGAATGAGAAAGG + Intergenic
966308063 3:178559663-178559685 TCTAGTATGCAGAGGAAAAAAGG - Intronic
970652810 4:18197407-18197429 TTTAAAATGCAGAAGTAAAAAGG + Intergenic
971007547 4:22391965-22391987 TATAGTCTGCAGGAGGAGAAAGG - Intronic
971366722 4:25983568-25983590 TCTAACTTGCAGAAGGACAGAGG - Intergenic
971550587 4:27950966-27950988 TCTAATATCCAGAATGTGTAAGG + Intergenic
972725993 4:41746696-41746718 TCTAATTGGTAGAAGGAAAAGGG + Intronic
972866196 4:43236068-43236090 TTTAATGTGCAGGAGCAGAAAGG - Intergenic
973726140 4:53777988-53778010 TTTAAAATTCAGAAGGAGATTGG + Intronic
974527708 4:63065459-63065481 TCTAATATCCAGAATCAGTAAGG - Intergenic
975190886 4:71460726-71460748 ACTGATATTCTGAAGGAGAAGGG + Intronic
976463683 4:85343318-85343340 GTTAATATTCAAAAGGAGAAAGG - Intergenic
976770648 4:88648760-88648782 TCCAACATCCAGAAAGAGAATGG - Intronic
977963351 4:103111164-103111186 TCAAATAAGCAGAGGGAGTAAGG - Intronic
978551216 4:109929307-109929329 TCTATTTTACAGAAGAAGAAAGG - Intronic
978896616 4:113896008-113896030 TCTTCTAGGCAGAAAGAGAAAGG + Intergenic
979204443 4:118020658-118020680 TTTAAAATGCAGAATAAGAAAGG - Intergenic
979749663 4:124263152-124263174 TCTGATATACAGAGGAAGAAAGG - Intergenic
982245857 4:153349661-153349683 TCCACTATGCAGAGGAAGAAGGG - Intronic
982341524 4:154304096-154304118 TCTAGGATGCAGATGGAGATGGG + Intronic
982644202 4:158002475-158002497 TCTTAGAAGCAGAAGTAGAATGG + Intergenic
983102293 4:163639781-163639803 TCTAATAAGGAGGAGGAGTAAGG + Intronic
983423337 4:167549200-167549222 TCTAAAATGCAGACGGAAAAGGG + Intergenic
984398848 4:179235666-179235688 TCTATTTTGCAGATGGAAAATGG + Intergenic
984643678 4:182198214-182198236 TCTAATCTGCAGAATGTGTAGGG - Intronic
985870895 5:2555992-2556014 TTTAAAAAGCAGAATGAGAATGG - Intergenic
987961039 5:24809146-24809168 TGTATTATGCAGAGGGAGAAAGG + Intergenic
988343202 5:30001761-30001783 TATTATATGCATAATGAGAAGGG + Intergenic
988518435 5:31924849-31924871 TCTACTAGGCAGAAGGAATAAGG - Intronic
991118317 5:62980365-62980387 TATAAAGTTCAGAAGGAGAAAGG - Intergenic
992563122 5:77972399-77972421 ACTAATGTGCAGGATGAGAACGG - Intergenic
992834749 5:80629127-80629149 TCTGATGTCCAGGAGGAGAAAGG - Exonic
993453612 5:88101831-88101853 ACTAATAGGCATAAGCAGAATGG - Intergenic
993997889 5:94744357-94744379 TCTAAAATGCACAGGGAGCAAGG + Intronic
994364887 5:98902333-98902355 TCTAATATGCAGAATATCAAAGG + Intronic
994394894 5:99219473-99219495 TCTAATATCCAGAAGGGGAAAGG - Intergenic
994395896 5:99225550-99225572 CCTGATATGCAGAGGGGGAAAGG - Intergenic
995954641 5:117761711-117761733 TCTAATAAGCAACAGGAGAAAGG - Intergenic
996382421 5:122875730-122875752 TCTGAAAAGCAGGAGGAGAATGG + Intronic
996852805 5:127971521-127971543 TTTAATAAGAAGAAAGAGAAAGG - Intergenic
997683666 5:135773823-135773845 TCTAATATCCAGAGGGGGGAGGG + Intergenic
997683937 5:135775639-135775661 TCTTATATCCAGAAGGGGAGAGG + Intergenic
997684392 5:135778554-135778576 TTTAATATTTAGAAGGAGACAGG + Intergenic
997684841 5:135781305-135781327 CGTAATATGCAGAAGGGGTAGGG + Intergenic
997687368 5:135797966-135797988 TTTAATATCCAGAGGAAGAAAGG + Intergenic
998620932 5:143793564-143793586 CCTGGTAAGCAGAAGGAGAATGG - Intergenic
999036035 5:148350826-148350848 ACTACTATGCAGAAGCAGTATGG - Intergenic
1000249899 5:159483952-159483974 TTTGTTCTGCAGAAGGAGAATGG + Intergenic
1001163952 5:169346644-169346666 TCTAAGGGGCAGAGGGAGAAGGG - Intergenic
1001291257 5:170463285-170463307 TCTAAAATGTAGAAGAAGAGGGG + Intronic
1001353280 5:170994301-170994323 TCTATTATGTAGAAGGAAAGAGG + Intronic
1001632889 5:173189565-173189587 TCAAATATCCAGCAGGTGAATGG + Intergenic
1002151460 5:177235638-177235660 TCTCATATGCAAAAGGAGCTGGG - Intronic
1002621440 5:180491418-180491440 TCGGATATGCAGAAAGAAAAGGG + Intergenic
1003075602 6:2981332-2981354 TCTCATATGTAAGAGGAGAAAGG - Intergenic
1004792901 6:19048255-19048277 CCTAATATGCAAAAAGAGAAAGG - Intergenic
1006066587 6:31466689-31466711 TCAATTATGCACTAGGAGAATGG + Intergenic
1007103931 6:39270415-39270437 TTGAATATTCAGAGGGAGAAAGG + Intergenic
1007452438 6:41950478-41950500 TCTCATTTGCAAAAGGAGGATGG + Intronic
1007915671 6:45559437-45559459 TCTAACATTAAGAAAGAGAATGG + Intronic
1008358203 6:50581179-50581201 TCTTCTATGCAGAAAGTGAATGG - Intergenic
1008871397 6:56276566-56276588 TCTGATGTCCAGGAGGAGAAAGG - Intronic
1008930967 6:56939446-56939468 TACAATATGCACAAGGAGGAAGG + Intronic
1009046356 6:58241186-58241208 TCTAATATCCAGAGGGGGAGAGG + Intergenic
1009046368 6:58241259-58241281 CCTAATATCCAGAAGGGGAGAGG + Intergenic
1009046517 6:58242171-58242193 CCTAATATCCAGAGGGAGAGAGG + Intergenic
1009047610 6:58248847-58248869 CATAATATGCAGAGGGAGAGAGG + Intergenic
1009048587 6:58254800-58254822 TCTAATATTCAGAGGGTGAGAGG + Intergenic
1009049800 6:58262689-58262711 TCTAATATTCAGAGGGAAAGAGG - Intergenic
1009049828 6:58262903-58262925 TCTAATATCCAGGAAGAGAGAGG - Intergenic
1009049919 6:58263515-58263537 CCTAATATTTAGAAGGAGAGTGG - Intergenic
1009050161 6:58265183-58265205 TCTAATATACAGGATGAGAGAGG - Intergenic
1009216855 6:60931659-60931681 TCAAAAATGCAGAAGAAGAATGG + Intergenic
1009222185 6:60995576-60995598 CCTAATATCCAGAAGGGGAGAGG + Intergenic
1009222332 6:60996487-60996509 CCTAATATCCAGAGGGAGAGAGG + Intergenic
1009223189 6:61001901-61001923 TGTAATATCCAGAAGGGGAGAGG + Intergenic
1009224450 6:61009561-61009583 TCTAATATTCAGAGGGTGAGAGG + Intergenic
1009225377 6:61016162-61016184 TCTAATATCCAGGAAGAGAGAGG - Intergenic
1009225464 6:61016774-61016796 CCTAATATTTAGAAGGAGAGTGG - Intergenic
1009225691 6:61018429-61018451 TCTAATATACAGTATGAGAGAGG - Intergenic
1009226640 6:61025752-61025774 CCTAATATCCAGAAGGGGAGAGG - Intergenic
1009228564 6:61038733-61038755 CCTAATATGCAGAAGGGTAGAGG - Intergenic
1009333902 6:62460980-62461002 TCTGATGTGGAGGAGGAGAAAGG - Intergenic
1009362686 6:62834982-62835004 TCTAATATTCAGGAGGAAAGAGG + Intergenic
1009363160 6:62838260-62838282 TCTAATATCCAGAAGAGGAGAGG + Intergenic
1009365257 6:62852914-62852936 CCTAATATCCAGAAGGGAAAAGG + Intergenic
1009365463 6:62854413-62854435 TCTAATATCCAGGAGGGGAGAGG + Intergenic
1009365511 6:62854792-62854814 CCTAATATCCAGACGGAGAGAGG + Intergenic
1009365580 6:62855398-62855420 TCTAATATCCAGAGGAAGAGAGG + Intergenic
1009365866 6:62857335-62857357 TCTAATATCCAGGAGGCGAGAGG + Intergenic
1009365990 6:62858232-62858254 TCTAATATTCAGAGGGAAAGAGG + Intergenic
1009367834 6:62869409-62869431 TGTAATATCCAGAAGGAAAGAGG + Intergenic
1009369104 6:62879158-62879180 TCTAATATGCAGTGGAAGAGAGG + Intergenic
1009907209 6:69884736-69884758 TCTAATTTTTGGAAGGAGAAGGG + Intronic
1010034361 6:71306344-71306366 ACTAGAATGCAGAAGGAGCAGGG - Exonic
1010715649 6:79226347-79226369 TCTCATATGTAAAATGAGAACGG + Intronic
1010982288 6:82381907-82381929 TATACTATCCAGAAGGAGGATGG - Intergenic
1012774045 6:103480252-103480274 CCTCATATGCAGAAGGGGAGAGG + Intergenic
1012774055 6:103480329-103480351 TATAATATCCAGAAGGTGGAGGG + Intergenic
1012774109 6:103480720-103480742 TCTAATATCCAGAAGGGGAGAGG - Intergenic
1015312030 6:131776807-131776829 TCTGATAAGCACAAGGAGAGAGG + Intergenic
1015494835 6:133869692-133869714 TCTAATATGGAAAATGAGACAGG + Intergenic
1017843091 6:158238135-158238157 TCTAATATTGAGAAGCAGAGAGG - Intronic
1019174190 6:170151719-170151741 TCTACTCAGCAGAAGGAGACAGG - Intergenic
1020335662 7:7060394-7060416 TTTAATATGCAGGAGGGGAGAGG - Intergenic
1020336318 7:7065058-7065080 CCTAATATCCAGAAGGGGAGAGG + Intergenic
1020909442 7:14110156-14110178 TCTACTGGGCAGAAGTAGAAGGG - Intergenic
1021768422 7:23972189-23972211 TCCACTATGCAGAAGTAGACTGG - Intergenic
1021981100 7:26056346-26056368 TCAAATATGCAAAAAGAAAAAGG - Intergenic
1022484710 7:30769561-30769583 TCTTATATGTAGAGAGAGAAGGG - Intronic
1022639082 7:32164480-32164502 TAGAATATGCTGAAGGAGCATGG + Intronic
1022681545 7:32551970-32551992 TCTAAAATGTAGAGGGAGAAAGG + Intronic
1023068031 7:36398910-36398932 TCTAAGTTGCTGAAAGAGAATGG + Intronic
1023636187 7:42213166-42213188 TGTAAAATTCAGAAGTAGAAGGG - Intronic
1024910904 7:54445652-54445674 TGTACTATGCAGAAGCAGGAAGG - Intergenic
1026701982 7:72655190-72655212 TCTAAGACACAGAAGGAGAGGGG + Intronic
1027403353 7:77831956-77831978 TCTTATATGCAGAAGTAAGATGG + Intronic
1027518058 7:79167349-79167371 TCTCATATTAAGAAGGAAAAAGG - Intronic
1027961647 7:84953614-84953636 TCTAAGATGCAGAACAAGATGGG - Intergenic
1028057440 7:86264009-86264031 TCTTATATACCAAAGGAGAATGG - Intergenic
1028213956 7:88109023-88109045 ACTAATATAAAGAAGGAGTAGGG - Intronic
1028449516 7:90965375-90965397 TCTAACATGCAGAAGAATTAGGG - Intronic
1028534422 7:91876002-91876024 TGTAATATGGTGATGGAGAAGGG - Intronic
1028735362 7:94205402-94205424 TCCCAAAGGCAGAAGGAGAATGG + Intergenic
1029301003 7:99582377-99582399 CCTAATATCCAGGGGGAGAAAGG - Intronic
1029301174 7:99583289-99583311 TTTAATATCCAGAAGGGGAGAGG - Intronic
1029301653 7:99586275-99586297 TCTAATATCCAGAGGGAGAGAGG - Intronic
1029342850 7:99958769-99958791 TGTAATATCCAGAAGGGGAGAGG + Intergenic
1029343084 7:99960141-99960163 TGTAATATTCAGAAGGGGAGAGG + Intergenic
1029343486 7:99962592-99962614 TTTAATATCCAGAAGGAGAGAGG + Intergenic
1029343828 7:99964559-99964581 TGTAATATCCAGAAGGGGAGAGG - Intergenic
1029384597 7:100235109-100235131 TCAAATATGCAAATGGAAAAGGG + Intronic
1029881292 7:103813157-103813179 ATTAATATGTAGAAAGAGAAAGG - Intronic
1029971227 7:104791436-104791458 TCTGTGATGCAAAAGGAGAATGG - Intronic
1030519308 7:110577969-110577991 ACTAATATTGAGAAAGAGAAAGG + Intergenic
1030660697 7:112216051-112216073 TCTCAAATGAAGGAGGAGAAGGG + Intronic
1031591745 7:123601345-123601367 TCTGATATACAGACGGAGATAGG - Intronic
1031639780 7:124147779-124147801 TCTAGTATCCAGAAGATGAAAGG + Intergenic
1032276992 7:130466496-130466518 TTTAATATGTAGAAGGAAAACGG - Intergenic
1032541359 7:132705702-132705724 CCTTATATGCAGAAGGAAACAGG + Intronic
1032876071 7:136039613-136039635 TATAAAATGGAGAAGGAGGAAGG - Intergenic
1034481957 7:151328730-151328752 ATTCTTATGCAGAAGGAGAAAGG + Intergenic
1034710593 7:153187895-153187917 TCTATTATGCAATAGGAGAATGG - Intergenic
1034749008 7:153551228-153551250 TTGAAAATGCAGAAGGAGCAGGG - Intergenic
1035123577 7:156590618-156590640 CCAAATCTGCAGCAGGAGAAGGG + Intergenic
1036612479 8:10362366-10362388 TCAACAATGCAGGAGGAGAAAGG - Intronic
1036819842 8:11931760-11931782 TCTTATATTCAGAAGGAGAGAGG + Intergenic
1036905667 8:12706796-12706818 CCTAATATCCAGAGGGAGAGAGG + Intergenic
1036951258 8:13141731-13141753 TTTAATAGTCAGCAGGAGAATGG + Intronic
1038637527 8:29299815-29299837 CATAATATCCAGAAGGAGAGAGG + Intergenic
1038637961 8:29302561-29302583 TCTAATATCCAGGAGGAGAGAGG - Intergenic
1039150711 8:34502265-34502287 ACAATTATGCAGAAGGTGAAAGG + Intergenic
1040985386 8:53288403-53288425 AGGAATATGCAGAAGGAGAAAGG - Intergenic
1041338640 8:56817088-56817110 TCAATTAGGCAAAAGGAGAAAGG + Intergenic
1042682410 8:71400408-71400430 TCTAATATCCAGAAGGTACAAGG + Intergenic
1043633598 8:82365861-82365883 TCTAATATGCAGAAAGAAATAGG + Intergenic
1043633792 8:82367072-82367094 CCTAATATCCAGAGGGGGAAAGG + Intergenic
1043634680 8:82372599-82372621 TGTAATATCCAGAAAGGGAAAGG - Intergenic
1043635258 8:82376179-82376201 CCTAATATCCAGAAAGGGAAAGG + Intergenic
1044288659 8:90441163-90441185 TCTGAGATGTAGAAGGAAAAAGG - Intergenic
1045261441 8:100578368-100578390 GCTAATATGTTGGAGGAGAAAGG - Intronic
1045925749 8:107577616-107577638 CCTAATATTCAGAAGGAAAGAGG + Intergenic
1045925759 8:107577691-107577713 TTTATTATGCAGAAGGAAAGAGG + Intergenic
1045926235 8:107580975-107580997 CCTAATATACAGAGGGAGAGAGG + Intergenic
1045926611 8:107583552-107583574 TTTAATTTGCAGAAGGAAAGAGG - Intergenic
1045927924 8:107592329-107592351 TTTAATATGCAGAAGGAAAAAGG + Intergenic
1046101097 8:109615009-109615031 TGTATGATGCAGAAGAAGAAGGG - Intronic
1046557680 8:115795800-115795822 TCGAATAGGAAGAAGGATAAGGG - Intronic
1047524796 8:125623600-125623622 TCCAGTAGGAAGAAGGAGAAAGG - Intergenic
1048812196 8:138298827-138298849 TCTGAAATGCAAAATGAGAAAGG + Intronic
1048955401 8:139531924-139531946 ACTAAGGTGGAGAAGGAGAAAGG + Intergenic
1049566510 8:143341872-143341894 GCTAATAAGAAGAAGAAGAAGGG - Intronic
1049895571 9:108562-108584 TCTAATATACAGAAAGGGAGAGG + Intergenic
1050063931 9:1738850-1738872 CCTAATTTGGAGAAGGAGGAGGG - Intergenic
1050218007 9:3350367-3350389 TCTAAAATGCTGAATTAGAATGG + Intronic
1050536234 9:6633266-6633288 TAAAACATGCAGAAGGAGAGAGG - Intronic
1050803858 9:9649303-9649325 TGTAATATGTAGTATGAGAAGGG - Intronic
1050902494 9:10965027-10965049 CCTAATATGCAGTGGGAGAGAGG - Intergenic
1051044578 9:12857718-12857740 GCTAATAGGGATAAGGAGAAAGG + Intergenic
1051232246 9:14965848-14965870 TCTAATATACAGGGGGGGAAAGG - Intergenic
1051232338 9:14966381-14966403 CCTAATATTCAGAAAGAGAGAGG - Intergenic
1051263893 9:15292511-15292533 TTTAATAGGTAGAAGGAGAAGGG - Intronic
1051557286 9:18398776-18398798 TCTGATATACAGTAGGAGTAAGG + Intergenic
1052210819 9:25901163-25901185 TCTAATATCCAGAATCTGAAAGG + Intergenic
1052391494 9:27883478-27883500 TCTAATATGAAGGAGATGAATGG - Intergenic
1053238920 9:36480427-36480449 TCCAAGGTGCAGAAGCAGAATGG + Intronic
1053738732 9:41118662-41118684 TCTAATATACAGAAAGGGAGAGG + Intergenic
1054689613 9:68312653-68312675 TCTAATATACAGAAAGGGAGAGG - Intergenic
1055417531 9:76099646-76099668 TCTGATATCTAGAAGGAAAAGGG - Intronic
1055486757 9:76763743-76763765 CCCAATATGGAGAAGGAGAGGGG + Intronic
1055857393 9:80706631-80706653 TGTAATATGAGGAATGAGAATGG - Intergenic
1055932581 9:81574679-81574701 TCTTTTATGCAGAAGGATATGGG + Intergenic
1056668917 9:88606617-88606639 TTTAATGTGCACATGGAGAAAGG - Intergenic
1056866187 9:90228941-90228963 CCTAATATCCAGAGGGAGAGAGG - Intergenic
1056916840 9:90753968-90753990 CCTAATATCCAGAGGGAGAGAGG + Intergenic
1057885690 9:98828000-98828022 TCTATGATGCAGAAACAGAAAGG - Intronic
1058310772 9:103499355-103499377 TCCAATATACAGAAGAAAAATGG - Intergenic
1058368802 9:104240446-104240468 TCTACTAAGCAGCAGCAGAAAGG + Intergenic
1058472986 9:105300074-105300096 TCTGATATTTAGAAGTAGAAAGG + Intronic
1058518381 9:105797291-105797313 TCTAATATCCAGGGGGAGAGGGG - Intergenic
1058519397 9:105803674-105803696 TCTAATATTTAGGAGGAGAGAGG - Intergenic
1058521236 9:105815772-105815794 CCTAATATGCAGGGGGAGAGAGG - Intergenic
1058522037 9:105821077-105821099 CCTAATATGCAGGGGGAGAGAGG - Intergenic
1058656528 9:107226980-107227002 ACTTATGTGCAGAAGGAGGATGG + Intergenic
1186550977 X:10505373-10505395 TCCAAAATGAAGAAGCAGAATGG + Intronic
1186792703 X:13014429-13014451 ACTTATCTGCAGAAGGATAAGGG - Intergenic
1190114326 X:47616300-47616322 TCTGAGATGCAGAAGGGGAAGGG + Intronic
1190864015 X:54369491-54369513 TCTAAAATGGAGAGGGATAAAGG - Intergenic
1191784741 X:64905333-64905355 TATAAAATACAGAAGGAGAGAGG + Intergenic
1193370035 X:80684637-80684659 TTTAAAATCAAGAAGGAGAAAGG - Intronic
1193655582 X:84193150-84193172 ACAAATATGCAGATGGATAAAGG - Intergenic
1193746720 X:85290819-85290841 TCTAATATGCAGAATCTGTAAGG - Intronic
1193956490 X:87870414-87870436 TCAAATATGCAGAAACAGGAGGG + Intergenic
1194030869 X:88812318-88812340 TCTAATATCCAGAATGAATAAGG - Intergenic
1194126731 X:90027539-90027561 TCTAATATGCAGATTTAGTATGG - Intergenic
1194613237 X:96070025-96070047 TGTGACTTGCAGAAGGAGAAAGG - Intergenic
1197125972 X:122946681-122946703 TCTAAGAGGCAGCAGGGGAAAGG - Intergenic
1198948167 X:142038955-142038977 ACTAATATGTATAAGAAGAAGGG + Intergenic
1199866084 X:151851490-151851512 TCTAATAGGCAAAAGCAGTAAGG - Intergenic
1200961369 Y:8999063-8999085 CCTATTATGTAGGAGGAGAATGG + Intergenic
1201647063 Y:16246430-16246452 TACAATATGCAGAGAGAGAAGGG + Intergenic
1201655748 Y:16338872-16338894 TACAATATGCAGAGAGAGAAGGG - Intergenic
1201710164 Y:16982549-16982571 ACTAGAAAGCAGAAGGAGAAAGG - Intergenic
1202585494 Y:26420996-26421018 TCTACAAGTCAGAAGGAGAAGGG + Intergenic