ID: 901933447

View in Genome Browser
Species Human (GRCh38)
Location 1:12612185-12612207
Sequence CAGGCTGCACAGAGTGAGGA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 550
Summary {0: 1, 1: 0, 2: 6, 3: 47, 4: 496}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
901933440_901933447 19 Left 901933440 1:12612143-12612165 CCAGATGTCACAGGTAGGACAGG 0: 1
1: 0
2: 0
3: 19
4: 179
Right 901933447 1:12612185-12612207 CAGGCTGCACAGAGTGAGGATGG 0: 1
1: 0
2: 6
3: 47
4: 496
901933443_901933447 -7 Left 901933443 1:12612169-12612191 CCTACCTGCCTGCTTTCAGGCTG 0: 1
1: 0
2: 4
3: 40
4: 354
Right 901933447 1:12612185-12612207 CAGGCTGCACAGAGTGAGGATGG 0: 1
1: 0
2: 6
3: 47
4: 496

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
901933447 Original CRISPR CAGGCTGCACAGAGTGAGGA TGG Intronic
900017029 1:159034-159056 AAGGCTGGACAGAGTGAGATTGG - Intergenic
900047288 1:517630-517652 AAGGCTGGACAGAGTGAGATTGG - Intergenic
900069502 1:759499-759521 AAGGCTGGACAGAGTGAGATTGG - Intergenic
900964703 1:5949871-5949893 GAGGCAGCACATAGTGAGGCAGG + Intronic
901127443 1:6939569-6939591 CAGGCTGGAGACAGAGAGGACGG - Intronic
901933447 1:12612185-12612207 CAGGCTGCACAGAGTGAGGATGG + Intronic
902037492 1:13468236-13468258 CAGGGTGGACAGTTTGAGGAAGG + Intergenic
902350537 1:15850175-15850197 CAGAATGCACAGAGGGAGGAGGG + Intronic
902555766 1:17245741-17245763 CAGCCTGCACTGAGTCAAGAAGG + Exonic
902781220 1:18706133-18706155 CCACCTGCCCAGAGTGAGGAGGG - Intronic
903233494 1:21935877-21935899 GAGGCTGCCCAGAGTGGGGATGG + Intronic
903791195 1:25894235-25894257 CAGTCTGCACACTGTGAGCAGGG + Intronic
904437348 1:30507435-30507457 GAGGTTGCACAGAGGAAGGAGGG - Intergenic
904712971 1:32444891-32444913 CAGTCTGAGCAGAGTCAGGAGGG + Intergenic
904953794 1:34266336-34266358 CAGGATGCACAGAGAGTGAATGG - Intergenic
906058511 1:42933690-42933712 CAGGCTGCTCTGAATGAGGGTGG + Intronic
906852804 1:49270013-49270035 CAGATTGCACAGAGAGAGGTTGG - Intronic
907057383 1:51382875-51382897 CTGGCTTCACAGAATGAGTATGG - Intronic
907804317 1:57803064-57803086 CAAGCTGCATGGAGTGAGGTCGG - Intronic
907977321 1:59444589-59444611 CTGGCTGCACAGCATGAGGTGGG + Intronic
908358356 1:63344083-63344105 CTGGATGCAGAGAGGGAGGAAGG - Intergenic
909919036 1:81357218-81357240 CATGGTGCAAAGAGTGAGCAAGG - Intronic
911664566 1:100538891-100538913 CAGGCAGGACAGTGTCAGGATGG + Exonic
912000763 1:104831969-104831991 GAGGCTGCACAGAGCCAAGATGG + Intergenic
912840040 1:113031257-113031279 TAGGCTGGACACAGTGTGGAGGG - Intergenic
913226046 1:116699325-116699347 GAGCCTGCAGAAAGTGAGGAAGG - Intronic
915839828 1:159204968-159204990 CTGTCTGCACAGGGTGAGTATGG + Intronic
916055248 1:161064690-161064712 GAGGCTGCAGTGAGTGATGATGG + Intronic
918215172 1:182387082-182387104 CAGCATTCACAGATTGAGGAGGG + Intronic
919213207 1:194515330-194515352 CAGGCTGCAGTGAGTCATGATGG + Intergenic
919467370 1:197938641-197938663 AAGGCTGCAGAGAGTGAAGATGG - Intergenic
919552398 1:199007531-199007553 CAGGCTCCCAAGAGTGAGGTTGG - Intergenic
920157838 1:203969878-203969900 CAGTCTGCACAGAGAGAGAGAGG + Intergenic
920190586 1:204191123-204191145 CAGGCTGCTCACAGCCAGGAAGG - Intronic
920347725 1:205317450-205317472 CAGGCTGGGCAGAGTGGGGGTGG + Intronic
920357536 1:205385845-205385867 CAGGCTGCAGACAGTGAGTCAGG + Intronic
920866319 1:209756829-209756851 CAGGCTGCAGAGAGAGAACAGGG - Intronic
921500712 1:215899352-215899374 CAAGCTACACAGAGTGAATAAGG - Intronic
923642210 1:235775667-235775689 AAGGCTACACAGAGAGAAGATGG + Intronic
924852626 1:247845630-247845652 AAGGCTGCACTGAGGGAGGCTGG - Intergenic
1063074724 10:2703250-2703272 CAGGCTGGAAAGAATCAGGAAGG - Intergenic
1063238369 10:4142523-4142545 CAGACTGCACAGGGTGGGTAAGG - Intergenic
1063981661 10:11457521-11457543 CGGGCTCCACAGAGACAGGATGG - Intronic
1064119922 10:12609720-12609742 CAGGCTGCACAGCAAGAGGGGGG - Intronic
1064213916 10:13383690-13383712 CAGGGTGCTCCGAGTGAAGAGGG - Intergenic
1065307835 10:24385097-24385119 CAGGCAGCACAGAAAGGGGAGGG + Intronic
1065991080 10:31011151-31011173 CAGGCTGAGCAGAGAGAGCATGG + Intronic
1066477891 10:35765315-35765337 CAGGCTGCACGGTGGGAAGACGG - Intergenic
1067098510 10:43317990-43318012 AAGGCTGCAGAGAGTTGGGATGG + Intergenic
1067201429 10:44175401-44175423 GAGGCTGCAGAGAGTCATGATGG - Intergenic
1067567491 10:47349437-47349459 GGCGCTGCGCAGAGTGAGGATGG - Exonic
1067745869 10:48935272-48935294 CAGCCTGCAAAGTGAGAGGACGG + Intronic
1068353497 10:55880893-55880915 CAGCCTGCACAGAGCCAAGAAGG + Intergenic
1068798757 10:61115111-61115133 CAGGCTGAAAAGAGAGAGGTTGG - Intergenic
1070379586 10:75868773-75868795 CAGGATGGAGAGAGAGAGGAGGG - Intronic
1070521813 10:77260306-77260328 CAGGAAGGACAGAGAGAGGAAGG + Intronic
1070799228 10:79235307-79235329 AAGGCTGCACCGGGTGATGAAGG + Intronic
1070849466 10:79551881-79551903 CGGGAAGCACACAGTGAGGAGGG - Intergenic
1071339078 10:84626066-84626088 CAGGATGCACAGCCTGAAGAAGG + Intergenic
1071503489 10:86219435-86219457 TAGGCTGGGCAGAGTGAGGGAGG - Intronic
1072717085 10:97759431-97759453 CCAGCTGGAGAGAGTGAGGAAGG - Exonic
1073527108 10:104193971-104193993 ACGGCTGCAGAGAGGGAGGATGG + Exonic
1075589157 10:123678819-123678841 CAGGCTGGGCAGGGTGTGGAGGG + Intronic
1075953345 10:126501217-126501239 CAGCCTGCACAACGTGTGGAGGG - Intronic
1076394652 10:130129758-130129780 CAGGCTGCGCAGTGGGAGAAGGG - Intergenic
1076638157 10:131896421-131896443 GAGGGTGCACAGGGTGAGCAGGG + Intergenic
1076649084 10:131975214-131975236 CAGCCAGCGCAGAGTGAGGCGGG - Intronic
1076973629 11:154263-154285 AAGGCTGGACAGAGTGAGATTGG - Intergenic
1077491637 11:2863335-2863357 CAGGCTGGGCAGAGTGAGGGAGG + Intergenic
1077501475 11:2911484-2911506 CAGGGTGGCCAGGGTGAGGAAGG + Intronic
1078105468 11:8355555-8355577 CAGGCTGGACAAGGAGAGGAAGG - Intergenic
1078280157 11:9893168-9893190 CTGGCTGGACAGTATGAGGATGG + Intronic
1078440303 11:11359543-11359565 CAGAGTCCACAGAGTCAGGAAGG - Intronic
1079009167 11:16814401-16814423 CAGGCTGTACAGAGGTAGGCAGG - Intronic
1079315524 11:19404947-19404969 CAGAGAGCACAGAGAGAGGAGGG - Intronic
1081311437 11:41578818-41578840 CAGGCGGGACAAAGTGAGAAAGG - Intergenic
1081753871 11:45531103-45531125 CAGGCTGGAGTGAGAGAGGAGGG + Intergenic
1081804644 11:45883870-45883892 TGGCCTGCACAGAGTGAAGAAGG + Intergenic
1083365785 11:62140795-62140817 CTGGCTGGGCAGGGTGAGGAAGG - Exonic
1083722140 11:64608701-64608723 CAGGGAGCAGAGAGTGAGGGAGG - Intronic
1083731734 11:64655970-64655992 CTGGCTGGACAGAGAGAGCAGGG + Intronic
1083835821 11:65266599-65266621 CAGTATGGACAGAATGAGGAGGG + Exonic
1083956186 11:65984176-65984198 CAGGCTGGTCAGGGTGAGTAGGG + Intergenic
1084357746 11:68651233-68651255 AAGACTGCACTGGGTGAGGATGG - Intergenic
1084365175 11:68693021-68693043 CAGGCTGCACACCGTGGGGCTGG - Intergenic
1084627968 11:70323426-70323448 GAGGCTGGACAGAGGTAGGAAGG + Intronic
1085946359 11:81277904-81277926 CAGTTTGCACAGAGAGAGGGAGG - Intergenic
1086037869 11:82438719-82438741 GAGGCTGCACAAGGTGGGGAGGG + Intergenic
1086478795 11:87210651-87210673 CTGGCTTCACAGAGTGAGTTAGG - Intronic
1086929052 11:92672315-92672337 CAGGCTGCAGAGCATGTGGATGG - Intronic
1087630751 11:100647799-100647821 GAAGCTACACAAAGTGAGGAGGG + Intergenic
1088861743 11:113806655-113806677 CAGGCTGAACAGAGTGCTAAAGG + Intronic
1088875863 11:113935797-113935819 CAGGCTGCCCAGCGGGAGGTTGG + Intronic
1089130396 11:116207826-116207848 CATCCTGCAGAGAGAGAGGACGG - Intergenic
1089427880 11:118394900-118394922 AAGGCTGCACTGAGTTATGATGG + Intronic
1090590567 11:128262544-128262566 GAGGATGCACAGAGAGAAGACGG - Intergenic
1090695754 11:129239775-129239797 CTGTTTGCACAGATTGAGGATGG - Intronic
1091490251 12:926437-926459 AAGGCTGCACTGAGCGATGACGG + Intronic
1092651688 12:10641784-10641806 CTGGCTGTACAGAATGAGGCAGG - Intronic
1092725933 12:11485655-11485677 CAGGCTGCATAGCGGGAGGTGGG - Intronic
1093413659 12:18895952-18895974 TAGGCTCCACCCAGTGAGGAAGG + Intergenic
1094476338 12:30843520-30843542 CAGGCTGGACATAGTGGAGAGGG + Intergenic
1094850279 12:34379297-34379319 CAGGATGCACAGGGTGACGAGGG + Intergenic
1096252341 12:50041171-50041193 AAGGCTTCACAGAGGCAGGAGGG - Intergenic
1096252379 12:50041363-50041385 CAGGCCTGACAGAGTGAGGAGGG + Intergenic
1096535643 12:52270958-52270980 CAGGCTGCACAAGGTCAGGTAGG - Intronic
1096769989 12:53928913-53928935 CAGGCTCCACTGTGTGAGGCGGG + Intergenic
1097349734 12:58535755-58535777 CAGTCTGGAAAGAGAGAGGAAGG - Intergenic
1098757059 12:74377972-74377994 CAGGATGCAAAAAGTGACGAGGG + Intergenic
1098981223 12:76958396-76958418 TAGGGTCCACAGAGTGAGGAAGG - Intergenic
1099504887 12:83461584-83461606 CAGGCTGCCCAGAGGAAGAAGGG + Intergenic
1099912100 12:88846497-88846519 GAGGCTGCAGAGAGTCATGATGG + Intergenic
1101166114 12:102035621-102035643 CAGGTAGCACAAAGTGAAGAAGG + Intronic
1101349931 12:103920124-103920146 CAGGCTGCAGTGAGTTATGATGG + Intergenic
1102114991 12:110396141-110396163 CAGGCTGCACAGCAGGAGGTGGG - Intronic
1102431673 12:112888987-112889009 CAGGCTGCCCAGAGAGACCAGGG - Intronic
1103459000 12:121089101-121089123 CAGGCTGAACAGTGTGAGGAGGG + Intergenic
1104714236 12:131005953-131005975 CAGGCTGCAGAGAGAGCAGAGGG - Exonic
1104896546 12:132167702-132167724 GAGGCTGCAGAGAGGGAGGGTGG - Intergenic
1105783701 13:23726711-23726733 GAGGCTTCACAGAATGTGGAGGG - Intergenic
1105881785 13:24612352-24612374 CAGCCTGGAAAGATTGAGGAAGG + Intergenic
1106469618 13:30042771-30042793 CAGGCAGTACAGCCTGAGGAGGG + Intergenic
1106595230 13:31129816-31129838 GAGGTTGCACAAAGTGAGGGTGG - Intergenic
1106800076 13:33247304-33247326 CAGGCGGCAGAGAGTCAGAATGG + Intronic
1107440478 13:40422980-40423002 CAGACTCCCCAGAGGGAGGAGGG - Intergenic
1107870700 13:44744076-44744098 CAGGCTGAATAGAGTGAATAAGG - Intergenic
1107915494 13:45145836-45145858 AAGCCTGAACAGGGTGAGGAGGG - Intronic
1108194382 13:47977417-47977439 CTGGCTTCATAGAGTGAGTATGG - Intronic
1111077987 13:83263975-83263997 GAGGCTGCACAGAGTATGGTGGG - Intergenic
1111200343 13:84927908-84927930 GAGGCTCCACCCAGTGAGGAAGG - Intergenic
1112175394 13:97018494-97018516 CCGGCTGCACCGAGTTAGAATGG - Intergenic
1112251534 13:97785076-97785098 AAGGCAGGCCAGAGTGAGGAGGG - Intergenic
1112651034 13:101398778-101398800 CAGGGTGCACAGCGTGGGGAGGG + Intronic
1113576080 13:111396214-111396236 CAGCATGCACCGAGGGAGGAGGG + Intergenic
1113756741 13:112817577-112817599 CTGGCTGCAGAGAGTGTGAAGGG - Intronic
1114613487 14:24056549-24056571 CAGGTGGCACAGAGTCAGGTTGG - Intronic
1115747394 14:36451566-36451588 CAGGCTGCAGAGACTCAGGAGGG - Intergenic
1117118885 14:52547794-52547816 TAGGCTTCACATAGTGAAGATGG + Intronic
1118003313 14:61543492-61543514 TAAGCTGCACAGAGTGAGTGAGG - Intronic
1118571763 14:67201227-67201249 CAGGCTGCAGTGAGCTAGGATGG + Intronic
1118746885 14:68780757-68780779 CAGGATGCACAGAGAGAAGCAGG + Intergenic
1119712025 14:76829250-76829272 CAGGCAGCAGAGATGGAGGAAGG + Intronic
1120369000 14:83607862-83607884 GAGGCTCCACCCAGTGAGGAGGG + Intergenic
1120727091 14:87956251-87956273 CAGGCTTTACAGTGTGTGGAGGG + Intronic
1120782052 14:88494184-88494206 CAGGCTGCAATGAGGGAGCAAGG + Intronic
1120823062 14:88930790-88930812 CAGGCTGGCCACAGTAAGGATGG + Intergenic
1121281439 14:92701982-92702004 CAGGCAGCACAGAGTGGGATGGG - Intergenic
1121586739 14:95067963-95067985 CAGGCTGCACAGAGGCTGGAAGG - Intergenic
1121635323 14:95450102-95450124 CAGGCTGCAAGGAGCGTGGAGGG + Exonic
1121978365 14:98428175-98428197 CTGGCTGTATAGAGTAAGGAAGG + Intergenic
1122076413 14:99237926-99237948 CAGGCTGCAGGAAGTGAGGTGGG + Intronic
1122353139 14:101109033-101109055 CTGGCTGACCAGGGTGAGGATGG - Intergenic
1122595886 14:102891749-102891771 CAGACAACACAGAGTGAGTAAGG - Intronic
1122659728 14:103287332-103287354 CACACAGCACAGAGTGAGGATGG - Intergenic
1122660027 14:103288932-103288954 CAGGCTGCACAGCAAGAGGTGGG + Intergenic
1122800279 14:104225870-104225892 CGGGCTGCTCAGAGTGAAGGTGG + Intergenic
1122800303 14:104225975-104225997 CGGGCTGCTCAGAGTGAAGGTGG + Intergenic
1122907149 14:104806929-104806951 GAAGCTCCACTGAGTGAGGAGGG - Intergenic
1202904297 14_GL000194v1_random:59616-59638 CAGGCTGGGCACAGTGGGGAGGG + Intergenic
1124187680 15:27544291-27544313 GAGTCTGCACAGAATGAGGCTGG + Intergenic
1124621885 15:31278647-31278669 CATGCTCCATACAGTGAGGAGGG + Intergenic
1124674644 15:31673863-31673885 CAGCCTTCACAGAGAGAAGAAGG - Intronic
1125129869 15:36271415-36271437 AAGGCTGCAGAGAGTGAAGTGGG - Intergenic
1125769665 15:42156626-42156648 CAGGCAGCACTGAGTTGGGAGGG + Exonic
1126105660 15:45145357-45145379 CAGGCTGAGATGAGTGAGGATGG - Intronic
1126434715 15:48624826-48624848 GAGCCTGCACAGAGAGAGGCCGG + Intronic
1128324570 15:66715919-66715941 TAAGCGGGACAGAGTGAGGACGG + Intronic
1128726630 15:69992705-69992727 CAGGCTGGAGTGAGTGAGGAGGG - Intergenic
1129225749 15:74169483-74169505 GGGGCTGCACACAGTGAGCAGGG + Intergenic
1129249511 15:74301172-74301194 CAGGGTGCCCAGAGAGTGGAGGG - Intronic
1129298704 15:74613508-74613530 CAGGCTGCAAAGTGTGGAGAGGG + Intronic
1130148256 15:81292028-81292050 CAGGGTAGACAGAGGGAGGACGG + Intronic
1130253546 15:82315566-82315588 AGGGCTGTACAGAGTGAGGCAGG + Intergenic
1130616984 15:85419839-85419861 AAGGCTGTAAAGAGTGAAGAGGG + Intronic
1131097985 15:89667785-89667807 CAGGCTGCTCTGAGGGAGGATGG + Exonic
1131225048 15:90617592-90617614 GAGGCTGCACTGAGTCATGACGG - Intronic
1131599885 15:93836596-93836618 CAGGCTTCAGAGAGAAAGGATGG + Intergenic
1132340955 15:101078462-101078484 CAGGGTGCAGAGAGGAAGGAAGG - Intergenic
1132699925 16:1217985-1218007 CACGCGGAACAGCGTGAGGAAGG - Exonic
1132804869 16:1770824-1770846 CAGGCTGAACAGGGGGAGGCCGG + Intronic
1132883909 16:2174060-2174082 CAGGCTGCAGAGACTGAGGTAGG - Intronic
1133927363 16:10204072-10204094 AAGGCTGCACAGATTTAAGATGG - Intergenic
1134691905 16:16196591-16196613 CAGGAGGCACAGAGAGAGTAGGG + Intronic
1134843352 16:17419275-17419297 GAGGCTGCAGAGAGCCAGGATGG + Intronic
1135133629 16:19872171-19872193 CTTGCCGCACAGAGTGAAGAGGG + Exonic
1136108959 16:28052757-28052779 CAGGCTGCCCTGGCTGAGGAGGG + Intronic
1136232402 16:28894401-28894423 CAGGCAGCAGAGGGTAAGGAAGG - Intronic
1136398048 16:30003792-30003814 CATGCTGCGCACAGTGGGGAAGG + Intronic
1137020393 16:35420022-35420044 CAGGCTGTGCAGATTGAGCAGGG + Intergenic
1138079807 16:54079689-54079711 CAGGCCGCACAGAGAGAGCCTGG + Intronic
1138189044 16:54999358-54999380 CACGCTGCACAGATGGAGGCTGG + Intergenic
1138199588 16:55078848-55078870 AAGGCTGCTGAGAGTGAGGCTGG - Intergenic
1138613716 16:58147764-58147786 CAGGCAGCACTGAGGGAGGAGGG - Intergenic
1139051968 16:63135069-63135091 CAGGCAGCACAGAATGATGTCGG + Intergenic
1139392551 16:66614178-66614200 CAGGCTGCACAGCAGGAGGTGGG - Intergenic
1140057680 16:71539635-71539657 CAGTGTGAACAGAGTGAAGAGGG + Intronic
1140177939 16:72683575-72683597 AAGGCTGCAGAGAGTCATGATGG + Intergenic
1140653578 16:77115900-77115922 CAGGCTGTACAGAATTAGGAAGG - Intergenic
1141717422 16:85734902-85734924 CAGGCTGTGGAGAGTGAGGGAGG - Intronic
1142016260 16:87749646-87749668 GAGGCTGCAGTGAGTGATGATGG - Intronic
1142446633 16:90143423-90143445 AAGGCTGGACAGAGTGAGATTGG + Intergenic
1142460872 17:92042-92064 AAGGCTGGACAGAGTGAGATTGG - Intergenic
1142495517 17:304571-304593 CCAGCTGCTCAGAGTGAGAAGGG - Intronic
1142537759 17:631602-631624 AAGGCTGCACAGACTGAGTTAGG - Exonic
1142993469 17:3747193-3747215 CCGGAGGCACATAGTGAGGAGGG + Intronic
1143646631 17:8234608-8234630 CAGGGTGGCCAGAGTGGGGAAGG + Exonic
1143670226 17:8391830-8391852 CAGGCTGGGCTGGGTGAGGAAGG - Exonic
1143784649 17:9247393-9247415 CAGGCCACACAGGGTGGGGACGG - Intergenic
1144395670 17:14840569-14840591 CAGCCTGAACAGACTAAGGAAGG + Intergenic
1146531327 17:33609944-33609966 CAGGCTGCTCACCGGGAGGAGGG - Intronic
1148346697 17:46908193-46908215 CAGACCTCACAGAGTGAGGGGGG - Intergenic
1148438466 17:47699541-47699563 CAGTCTGCACACAGTGGGGAAGG - Intronic
1148807136 17:50269594-50269616 CAGGCTGCACGGGGTGCCGATGG + Intergenic
1148867654 17:50637228-50637250 CAGGCTGCACCCAGTGTGGCTGG + Intronic
1150301442 17:64050297-64050319 CAGGCTGCAGAGAGTGTGGGGGG - Intronic
1151366594 17:73621084-73621106 CAGGCACCAGAAAGTGAGGATGG + Intronic
1151482747 17:74379960-74379982 CAAGCTCCCCAGAGTGGGGAAGG - Intergenic
1151668132 17:75557323-75557345 CAGGCGGCAGAGAGTGGAGAGGG + Intronic
1152408584 17:80110892-80110914 GACTCTGCCCAGAGTGAGGAGGG - Intergenic
1152686209 17:81695017-81695039 CCGGCTGCACAGCCTGGGGAAGG + Exonic
1152922121 17:83071351-83071373 GAGGCTTCTCAGAGTCAGGAGGG + Intergenic
1153826397 18:8878872-8878894 CAGTCTGAAGAGAGTCAGGAGGG + Intergenic
1154113336 18:11589559-11589581 CAGGCTCCACAGATCAAGGATGG + Intergenic
1154293485 18:13130649-13130671 CTGGCTGCACCCAGTGGGGATGG - Intergenic
1154308951 18:13253030-13253052 CAGGGTGCCCAGAGTGAAGCAGG - Intronic
1155294346 18:24371632-24371654 CAGGGAGCACAGAGTAGGGAGGG - Intronic
1155925252 18:31649086-31649108 GAGGCAGCACAGAGTGTGGGAGG - Intronic
1156540600 18:37906102-37906124 CAGGCATCCCACAGTGAGGAAGG - Intergenic
1156578862 18:38351790-38351812 CTGGCTGCCCAGAGTGGGGATGG + Intergenic
1156945335 18:42822651-42822673 CAGGATGCACAGTTTTAGGAAGG - Intronic
1157256595 18:46145071-46145093 GAGGCTGCACTGAGTGGTGATGG + Intergenic
1157509719 18:48262196-48262218 AAGGCTGCACAGTGAGAGGACGG + Intronic
1157585672 18:48799696-48799718 CTGGGTGCACAGAGAGAGGTGGG - Intronic
1157783863 18:50464712-50464734 CCAGCTGCACAGGGTGGGGAAGG + Intergenic
1157810989 18:50695687-50695709 AAGGCTGCATAGGATGAGGACGG + Intronic
1159011862 18:63065607-63065629 CAGGAAGCACAGAGCCAGGAAGG - Intergenic
1159069731 18:63610532-63610554 CAGGCTTGAGAGAGTCAGGAGGG + Intergenic
1159784491 18:72697157-72697179 CAGTTTGCACAGAGAGAGGGAGG - Intergenic
1160145442 18:76360040-76360062 CAGGGTGCACAGAGTGCAGGAGG - Exonic
1160173030 18:76570159-76570181 AAGCCTGCACTGAGTGAAGAGGG + Intergenic
1160455652 18:78997165-78997187 CATGCTGCCCAGAGGGGGGAGGG - Exonic
1160650574 19:224408-224430 AAGGCTGGACAGAGTGAGATTGG - Intergenic
1161277318 19:3425817-3425839 CAGGCTGCAGTGAGCTAGGATGG - Intronic
1161455510 19:4367876-4367898 GATGCCGCACAGAGTGAGGATGG + Intronic
1161719710 19:5896062-5896084 AAGGCGGCACAGAGCGAGGGCGG + Intronic
1161734395 19:5982085-5982107 CAGGCTGCAGTGAGGTAGGATGG + Intergenic
1161973913 19:7598359-7598381 GAGGCTGGTCAGACTGAGGAAGG + Intronic
1162186337 19:8907726-8907748 GGGGCTGGGCAGAGTGAGGAGGG + Intronic
1162471070 19:10872128-10872150 CAAGGTGCCCAGAGTGAGCAAGG + Intronic
1162743114 19:12784125-12784147 CTGGCTGGACAGACGGAGGAGGG + Intronic
1162776965 19:12985758-12985780 CAGGCTGCACAGGGAGAGCTGGG + Intergenic
1162976493 19:14209500-14209522 CAGGAGGCAAAGAGTGCGGAGGG + Intergenic
1163092917 19:15033688-15033710 CCTGCAGCACAGAGGGAGGAGGG - Intergenic
1163594875 19:18215225-18215247 CAGGGTGTGCAGAATGAGGAAGG - Intronic
1163748069 19:19059732-19059754 AAGGCTGCAGTGAGTTAGGATGG + Intronic
1163822269 19:19502730-19502752 CTGGGTGCAGAGAGTGAGGGTGG - Intronic
1164064751 19:21706357-21706379 CTGGCTCCACAAACTGAGGAGGG - Intergenic
1164416293 19:28048897-28048919 CAGGCTGGCCCCAGTGAGGATGG + Intergenic
1164416564 19:28050672-28050694 CAGGCTGGCCCCAGTGAGGATGG - Intergenic
1164416622 19:28051038-28051060 CAGGCTGGACCCAATGAGGATGG - Intergenic
1164451833 19:28372723-28372745 CAGGTTCCACAGGGTGAGGAGGG - Intergenic
1164826668 19:31289353-31289375 AAGGCTGCCCAGAGTGAGGAGGG - Intronic
1165885702 19:39076703-39076725 CAGACTGCAGGGGGTGAGGAGGG + Intergenic
1165991754 19:39819270-39819292 TAGTCTGCACAGAGGAAGGAGGG - Intergenic
1168260246 19:55189482-55189504 CCGACTGAGCAGAGTGAGGAAGG - Intronic
1168385128 19:55956743-55956765 CATGCAGCACAGAGGGAGGGAGG - Intronic
1168556635 19:57348224-57348246 AAGGCTGCACAGAGTTCTGATGG - Intergenic
925138275 2:1534410-1534432 GAGGCTGCACAGGGTGGGGGCGG - Intronic
925216437 2:2099989-2100011 GAGGATGGACAGGGTGAGGATGG - Intronic
925611710 2:5706894-5706916 CAGGACGCACGGAGAGAGGAGGG - Intergenic
926001872 2:9339835-9339857 CAGGCTGGACACAGAGAGGTGGG - Intronic
926665340 2:15515884-15515906 TAGGAAGCACAGAGTGAAGAAGG + Intronic
926905985 2:17806072-17806094 CAGGGTGCACAGAGCCAGCAGGG + Intergenic
927436857 2:23073955-23073977 CAGGTTGAACAGAGCAAGGATGG - Intergenic
928205644 2:29281333-29281355 CAGGCTGCCCACAGAGAGGAAGG - Intronic
928459335 2:31456248-31456270 CAGTTTGCACAGGGAGAGGAAGG + Intergenic
929393418 2:41496646-41496668 CAGGCTGGACAGGGTCAAGATGG - Intergenic
929591536 2:43150671-43150693 AGGGGTGCACAGAGGGAGGAAGG - Intergenic
930021642 2:47005209-47005231 CGGGCTGGACACAGAGAGGAAGG + Intronic
930551230 2:52837156-52837178 CTGGCTTCAAAGAGTGAGGAAGG - Intergenic
931314685 2:61117519-61117541 CAGGATGCACAAAGAGAAGACGG + Exonic
932401877 2:71486340-71486362 CAGGCTGTAAAGAATGAGGGAGG - Intronic
932799189 2:74724330-74724352 CTGGCTGCGTAGAGTGAGGAAGG - Intergenic
933260414 2:80125787-80125809 CAGGCTGCAGAGATTAGGGATGG - Intronic
933441562 2:82321152-82321174 CAATCAGCATAGAGTGAGGATGG + Intergenic
933779083 2:85788917-85788939 CAGACTGGACAGAGTGGGCATGG + Intergenic
934681018 2:96284001-96284023 CAGGCTGGAAAGAGGGAGGGAGG + Exonic
935654067 2:105406851-105406873 CAGGCAGAAGAGAGTGAGGAAGG - Intronic
936092518 2:109510561-109510583 TGGGCTGCAGAGGGTGAGGATGG - Intergenic
936538677 2:113332533-113332555 CAGCCTGAGCAGAGTGATGATGG - Intergenic
937763681 2:125634802-125634824 TGGGCTGCAAAGAGTGGGGAGGG + Intergenic
937954815 2:127416238-127416260 CAGGCTGCCCAGAGGGCGGAAGG - Intergenic
938462842 2:131509156-131509178 CAGGCTGCCCAGAGAGAGAGTGG - Intergenic
939375170 2:141355980-141356002 CAGGCTGTGTAGACTGAGGAAGG - Intronic
939831290 2:147074697-147074719 CTGGCTTCATAGAGTGAGTAAGG + Intergenic
940642999 2:156366818-156366840 CAGGATGCACAGAGTGAGAGAGG + Intergenic
941671778 2:168301507-168301529 CAGGCTGCGCCAAGTGGGGAAGG - Intergenic
942237831 2:173929590-173929612 CAGGCTGAACAGATTGTGCAAGG + Intronic
943828019 2:192420804-192420826 CAGGCAAGACAGAGTGAAGATGG - Intergenic
944696266 2:202202860-202202882 CAGGCTGCACTGAGCTATGACGG + Intergenic
945460289 2:210100068-210100090 CAGGCTGCACAGCAGGAGGTGGG + Intronic
946869330 2:224071783-224071805 AAGGCTGCACAGTGGGAAGAAGG - Intergenic
947077353 2:226359778-226359800 CAGGCAGGAGAGAGGGAGGAAGG + Intergenic
947430612 2:230024517-230024539 CAGGCTGCACAGGTAGGGGAAGG - Intergenic
947505650 2:230706439-230706461 CAAGCTGCACGGGGAGAGGAAGG + Intergenic
947862817 2:233374397-233374419 AAGGCTGCAGTGAGTGATGATGG - Intronic
948293929 2:236847219-236847241 CAGGCTGCACAGGGCCACGAGGG + Intergenic
948659029 2:239495417-239495439 AGGGCTGCAGAGAGTGAGAAAGG + Intergenic
948881456 2:240859601-240859623 CAGGCTGCAGAGAGTGTGATGGG - Intergenic
948884484 2:240875952-240875974 CAGGCTGTACAGGCTGATGACGG - Exonic
1169289925 20:4340863-4340885 CAGGCTGCCCACAGTGGTGATGG + Intergenic
1170671770 20:18440766-18440788 CAGGAGGCACAGAGTGACAAGGG + Intronic
1170931550 20:20773406-20773428 CAGGGTGGAGAGAGTGGGGAAGG - Intergenic
1172882889 20:38213229-38213251 CAGGCTGCAGAGGCTGAAGACGG - Exonic
1173018208 20:39245748-39245770 CAGTTTTCACAGAGGGAGGAGGG + Intergenic
1174066105 20:47867277-47867299 GTGGCTGCACAGAGCGAGGCTGG - Intergenic
1174393292 20:50231398-50231420 CAGGCAGAACAGTGGGAGGAAGG + Intergenic
1175434204 20:58931184-58931206 GAGGTGGCACAGAGAGAGGAGGG + Intergenic
1175516874 20:59575688-59575710 CTGGGTCCACAGAGTGGGGAAGG + Intergenic
1175695467 20:61099921-61099943 CAGGCTGCACAGAGCAGCGAAGG + Intergenic
1175794390 20:61762573-61762595 CAGGCTGGACAGAGTGCAGTGGG - Intronic
1175996136 20:62813089-62813111 AAGGCTGGACACAGTGAGAACGG + Exonic
1176023433 20:62974049-62974071 CAGGCTGCCTAGAGTGGGGGGGG - Intergenic
1176112157 20:63415691-63415713 CTGGCAGGACAGTGTGAGGAAGG - Intronic
1177376155 21:20273267-20273289 CAGACTGCAAAGATTGGGGAAGG + Intergenic
1179948920 21:44698638-44698660 CTGGCTGCAGACAGAGAGGATGG + Intronic
1180182047 21:46122424-46122446 AAAGCTGCCCAGAGGGAGGAAGG + Intronic
1180713472 22:17855890-17855912 CAGGCTGCAGAGAATGATGAAGG + Intronic
1180844783 22:18975136-18975158 CAGGCTGCTCTGAGTGAGGCTGG - Intergenic
1180953434 22:19730980-19731002 CAGGCTGCCCCTAGTGAGGGCGG + Intergenic
1181056684 22:20263576-20263598 CAGGCTGCTCTGAGTGAGGCTGG + Intronic
1181295504 22:21835201-21835223 GAGGCTGAACTGAGGGAGGAAGG + Intronic
1181494488 22:23280308-23280330 CAGGCTGGTGGGAGTGAGGAGGG - Intronic
1181549299 22:23627817-23627839 CAGGCTGGACAGGCTGAGAAGGG + Intronic
1181582625 22:23836650-23836672 GAGGCCACACTGAGTGAGGACGG + Intronic
1181799313 22:25334063-25334085 CAGGCTGGACAGGCTGAGAAGGG - Intergenic
1182142040 22:27967788-27967810 GAGGCTGGCCAGGGTGAGGAGGG - Intergenic
1183033839 22:35125846-35125868 GAGCCTGCAGAGAGTGAGGCTGG + Intergenic
1183323229 22:37177642-37177664 CAGGCTGCAGAGGGTGAAGCTGG - Intergenic
1183545442 22:38452806-38452828 CTGGCCCCTCAGAGTGAGGAGGG - Intronic
1183648405 22:39140071-39140093 GGGGCTGCAGAGAGTGTGGATGG - Intronic
1183669004 22:39261208-39261230 CAGGCTGCACAGAGTGGAGCAGG + Intergenic
1184549996 22:45199424-45199446 GAGGCTGCACAGAGCCAGGAGGG + Intronic
1184639689 22:45863819-45863841 GAGGGGGCACAGAGTGGGGAAGG - Intergenic
1184711884 22:46255353-46255375 AAGGCTGCACACAGTTAGCAAGG - Intergenic
1184910022 22:47525559-47525581 CAGACTGAACACAGTGGGGATGG + Intergenic
949479151 3:4476984-4477006 CAGCCTGCACCTAGTGATGATGG - Intergenic
950077393 3:10196687-10196709 CAGGCAGCACTGAGGCAGGAAGG - Intronic
950454794 3:13086246-13086268 CAGAATGGACAGACTGAGGAGGG + Intergenic
950881010 3:16322624-16322646 CAGGCTGCTCAGGGTGGGGTGGG + Intronic
951266751 3:20577230-20577252 CAGGCAGCACAGTGTGGAGAAGG + Intergenic
951510922 3:23501153-23501175 AAGGATGCACAGAGTGAGGAAGG + Intronic
951558657 3:23945388-23945410 CAGGCTGCAGCGAGAGAGGGTGG - Exonic
952198993 3:31105942-31105964 CAGGGATCACAGATTGAGGATGG + Intergenic
952862754 3:37828299-37828321 AATGCTGCACAGAGGGATGATGG - Intergenic
953090381 3:39718915-39718937 CAGGCTCCAGAGAGAAAGGAAGG - Intergenic
953880940 3:46690996-46691018 GAGGCTGCAGAGAGAGAGGCAGG + Intronic
954406164 3:50346109-50346131 CAGTCTGGACATAGGGAGGATGG - Exonic
954554261 3:51505809-51505831 CAGGCTGTAGTGGGTGAGGAGGG + Intergenic
954995688 3:54879525-54879547 AAGGCTGGAAAGAGTGAGGAAGG + Intronic
956847927 3:73200979-73201001 CAGGCTGAAGGGAATGAGGAGGG - Intergenic
957928457 3:86845820-86845842 CAGGCAGCATAGAGGGAGGGAGG - Intergenic
962362555 3:134754410-134754432 ATGGCTGCCCAGTGTGAGGAGGG + Intronic
965862129 3:173160401-173160423 AAGGCTGCCCATAGTGAAGAAGG + Intergenic
966054002 3:175659896-175659918 CAGCCTGAACAGACTGAGGCAGG - Intronic
966721326 3:183064950-183064972 CAGTTTGCACAGAGAGAGAAAGG - Intronic
967062205 3:185882260-185882282 CAGGGTGCCCAGAGGGGGGAGGG + Intergenic
967186347 3:186948019-186948041 AAGGCAGCAGAGAGTGAGGGAGG + Intronic
967807544 3:193728999-193729021 CCGGGTGCACTCAGTGAGGAAGG - Intergenic
968055632 3:195689714-195689736 CACGCTGCACAGGTTCAGGATGG + Intergenic
968367259 3:198195581-198195603 AAGGCTGGACAGAGTGAGATTGG + Intergenic
968955060 4:3714171-3714193 CAGGCAGCACAGAATAGGGAAGG - Intergenic
969182212 4:5450957-5450979 CAAGAAGCACAGAGTGTGGATGG - Intronic
969308743 4:6340034-6340056 GAGGCTGTACACAGTGGGGAGGG + Intronic
969340295 4:6536080-6536102 CAGGCTACACAGAGTGAGGTGGG - Intronic
969349956 4:6592685-6592707 GAGGCTGCACAGTGTGAGCAAGG + Intronic
969471668 4:7392726-7392748 CAGGCATCACAGAGGGGGGAGGG + Intronic
969491871 4:7504074-7504096 CAGGCTGCAGTGAGTGACCAGGG - Intronic
969593453 4:8134654-8134676 CAGGCTCCACAGTGCCAGGAAGG + Intronic
969897581 4:10319650-10319672 CAGGATGCAGAAAGTGAGAAAGG + Intergenic
971097396 4:23423419-23423441 CAGGCAGAAGACAGTGAGGATGG + Intergenic
972397775 4:38672455-38672477 CTGGCTGCACAGAGTGGGGAGGG + Intronic
972557184 4:40193339-40193361 CAGACTGCACAGCGTCAGAAGGG + Intronic
972921002 4:43941699-43941721 CAGTCTGCAGAGAGGCAGGAAGG - Intergenic
973166759 4:47087464-47087486 AGGGCTTCACACAGTGAGGAGGG + Intronic
973626234 4:52775301-52775323 CAGCCTGCACAGAGCGAGACCGG + Intergenic
974071231 4:57126203-57126225 AAGGCTGCAGTGAGTGATGATGG - Intergenic
975891137 4:79029140-79029162 CAGGCAGGAGAGAGGGAGGAGGG - Intergenic
975892843 4:79050027-79050049 CAGGCGGCACAGAGCGAGCACGG - Intergenic
976966223 4:91044524-91044546 CAGTCTGCACAAAATGAGGCTGG - Intronic
980998872 4:139808997-139809019 CAGGCTCCAAAGAGTGAGTGGGG - Intronic
981452172 4:144911255-144911277 CTGTCAGCTCAGAGTGAGGATGG + Intergenic
982602655 4:157470895-157470917 CAGGTTGCACAGAGAGAGGGAGG - Intergenic
983294485 4:165849113-165849135 AAGGCTGCAGAGAGTCAGGATGG - Intergenic
983622585 4:169775713-169775735 CAGGCTGCAGTGAGTTATGATGG - Intergenic
984933330 4:184867713-184867735 GAGGCTGCAGTGAGTGATGATGG - Intergenic
985010154 4:185573857-185573879 CAGCGTGCACAGAGTGGTGAGGG + Intergenic
985416460 4:189740813-189740835 CAGCCTGCACATGCTGAGGATGG + Intergenic
985487283 5:158637-158659 CAGGATGGGCAGAGGGAGGAGGG - Intronic
985503546 5:264491-264513 CACGCTCCACAGGGTCAGGATGG + Intergenic
985573740 5:664183-664205 CAGGGTGCAGCTAGTGAGGACGG + Exonic
986024492 5:3837898-3837920 CAGGCTGCCCAGACTGGGGAAGG + Intergenic
986283101 5:6339434-6339456 AAAGCTGCAGAGAGTGTGGAAGG + Intergenic
986471528 5:8081298-8081320 CAGAGTGCACAGAGTGTGCAGGG + Intergenic
986796635 5:11219028-11219050 GAGGCTGCTCAGAGAGAGAAAGG - Intronic
988607977 5:32697495-32697517 CTGGCTGCATAGAGTGAGTTTGG + Intronic
989032836 5:37136863-37136885 TAGGCTGCACACAGCAAGGAGGG + Intronic
989213435 5:38880067-38880089 CAGTCTGCAGAGAGTGAGAAAGG + Intronic
994005663 5:94834699-94834721 CAATCTGGACAGAGTGTGGAGGG + Intronic
996058069 5:119001982-119002004 CTGGCTTCACAGATGGAGGATGG - Intergenic
996259249 5:121445775-121445797 CAGGCTGCACTGCCTGAGGTTGG - Intergenic
996317417 5:122176057-122176079 GATGCTGCAAAGAGTGATGAGGG - Intronic
996709025 5:126525731-126525753 CAGCCTGCACACTGGGAGGATGG + Intergenic
996713732 5:126569049-126569071 CAGGCTGCACAGCAGGAGGTAGG + Intronic
997296737 5:132773299-132773321 CTGGCAGCACAGAGGCAGGAAGG + Intronic
997532300 5:134589253-134589275 TAGGAGGCACAGAGTCAGGACGG + Intergenic
997651372 5:135523860-135523882 GAGGCTGCACAGAGCGTGGGGGG + Intergenic
998919902 5:147056564-147056586 CAGGGTTCACAGATTGATGAAGG - Intronic
1000609593 5:163359745-163359767 AAGGCTGCACACAGCAAGGAGGG - Intergenic
1001284966 5:170416153-170416175 CAGCCTTCCCAGAGTGAGGCTGG - Intronic
1001350917 5:170963734-170963756 CAGGCTGCACAGCAGGAGGTGGG - Intronic
1001692638 5:173644285-173644307 GAGACTGCACAGACTAAGGAGGG - Intergenic
1002457573 5:179354281-179354303 CAGGCTGCTGGGAGGGAGGATGG + Intergenic
1002726481 5:181300778-181300800 AAGGCTGGACAGAGTGAGATTGG + Intergenic
1002908893 6:1473212-1473234 CAGGATGCACAGCGTGGGAAGGG - Intergenic
1003011008 6:2427577-2427599 CAGCCTCCACAGAGTGGGGAGGG + Intergenic
1005076989 6:21918445-21918467 CAGGTTGCAAGGAGAGAGGACGG + Intergenic
1005198944 6:23321458-23321480 GAGGCTGTACAGTGTGATGAGGG + Intergenic
1005676325 6:28159206-28159228 GAGGCAGCACAGAATGAGGGAGG - Exonic
1005825860 6:29631655-29631677 CAGGCTCCCCAGTGGGAGGAAGG + Intronic
1005926615 6:30450596-30450618 AAGGCCCCACAGTGTGAGGAAGG - Intergenic
1006300505 6:33191496-33191518 CTGGCTGGCCAGAGGGAGGAGGG + Intronic
1006582694 6:35085995-35086017 CAGGGTGGTCAGCGTGAGGAGGG + Intronic
1006982610 6:38158067-38158089 CAGCCTGCAGGGAGTGAGGGAGG + Intergenic
1007301223 6:40869359-40869381 CAGGACTCAGAGAGTGAGGAGGG + Intergenic
1007662751 6:43496579-43496601 CAGGCTGTCCAGACAGAGGAGGG + Intronic
1007838212 6:44693900-44693922 CTGGGTGCACAGTGCGAGGAAGG - Intergenic
1007935127 6:45726217-45726239 CAGAGTGCCCAGAGTGAGGTGGG + Intergenic
1008315437 6:50033817-50033839 CTGGCTTCACAGAATGAGGTAGG - Intergenic
1009032779 6:58080833-58080855 CAGTCTGCACAGAGCCTGGAGGG + Intergenic
1009500940 6:64413110-64413132 ATGGCTGCACAAGGTGAGGAAGG - Intronic
1010931593 6:81810678-81810700 CAGGCAGCATAGGGAGAGGAAGG - Intergenic
1011510989 6:88100669-88100691 CACGCTCCACAGGGTGAGAACGG + Intergenic
1011634246 6:89355074-89355096 CAGGCTGCAGTGAGTCATGATGG + Intergenic
1012487281 6:99736437-99736459 CAGGATGTACTGAGTGAGGCTGG - Intergenic
1012512201 6:100014831-100014853 CAGGCTGGAGAGAAAGAGGAGGG + Intergenic
1013839788 6:114377746-114377768 AAGTCTGGTCAGAGTGAGGAAGG + Intergenic
1014005354 6:116411430-116411452 CAGGCTGCACTCTGGGAGGAGGG + Intronic
1014214963 6:118744630-118744652 CAGCCTGCACAGTGCGGGGAGGG - Intergenic
1016839941 6:148516179-148516201 CAGGCTTCACAGATGGAAGATGG + Intronic
1016993429 6:149944877-149944899 CTGGTTGAACAGAGTGAGGATGG - Intronic
1017004904 6:150022653-150022675 CTGGTTGAACAGAGTGAGGATGG + Intronic
1017017238 6:150111429-150111451 CAGGATGCACAGAATGTTGATGG - Intergenic
1017609361 6:156168059-156168081 CAGGCTGGAGGGAGGGAGGAAGG + Intergenic
1017611523 6:156191311-156191333 GAGGCTGCAGAGAGCCAGGATGG + Intergenic
1017734980 6:157354609-157354631 GAGGCTGAACAGTGGGAGGATGG - Intergenic
1019322404 7:421711-421733 CGGGCTGCAGAGACTGAGGCTGG - Intergenic
1019328741 7:452489-452511 CTGGCTGCCAAGAGTGAGGATGG - Intergenic
1019697639 7:2455347-2455369 CCGGCTTCACAGAGTGAGGTAGG + Intergenic
1020762848 7:12289765-12289787 CAGACAGCAGAGAGTGAGCAAGG - Intergenic
1021953227 7:25796521-25796543 GAGGCTGCAGAGAGTCATGATGG + Intergenic
1022260009 7:28695160-28695182 CAGGCTGCAGTGAGTCATGATGG + Intronic
1023709224 7:42974248-42974270 CAGTTTGCACTGTGTGAGGATGG + Intergenic
1026111844 7:67464718-67464740 AAGGCAACACAGAGTGAGAAGGG - Intergenic
1026287662 7:68977442-68977464 AAGGCTGGACAGAGTGCAGAGGG + Intergenic
1029352400 7:100023549-100023571 CAGGCTGCACAGGAGAAGGATGG + Exonic
1029374317 7:100168665-100168687 CTGGCGGCACAAAGGGAGGAGGG - Exonic
1030865581 7:114698502-114698524 CAGGCAGCACAGGGAGAGTAGGG - Intergenic
1031979392 7:128115042-128115064 CAGGCTGGACACAGGGAGGGAGG - Intergenic
1032825205 7:135561944-135561966 CAGCCTGGGCAGAGTGAGGGAGG - Intronic
1034272862 7:149811844-149811866 CAGGCTGGACAGGCTGAAGATGG - Intergenic
1034423721 7:151002126-151002148 CAGGGAGGCCAGAGTGAGGAGGG + Intronic
1034590107 7:152131488-152131510 CAGGCTGCAGAGCGTGAGGATGG + Intergenic
1035053396 7:156017666-156017688 CAGGATGCACAGAGCCAGGTGGG + Intergenic
1035297530 7:157875801-157875823 CGGGCTGCAGAGGGTCAGGAGGG + Intronic
1035297576 7:157875921-157875943 CGGGCTGCAGAGGGTCAGGAGGG + Intronic
1035391165 7:158506020-158506042 AGGGCTGCAGAGGGTGAGGAGGG + Intronic
1035682507 8:1498239-1498261 CAGGCTGCAAAGAGGATGGATGG + Intergenic
1035909288 8:3548246-3548268 AGGGCTACAGAGAGTGAGGAAGG - Intronic
1036177764 8:6555524-6555546 CAGGCTGCAGTGAGCCAGGATGG - Intronic
1036693192 8:10957658-10957680 CATGCTGCCCAGAGTGAGACTGG - Intronic
1036911318 8:12759558-12759580 CAGGGTGCACAAAGTGCGCAAGG + Intergenic
1037564480 8:20105935-20105957 AAGGCTGCACAGAGGGAGAAGGG + Intergenic
1037689733 8:21171906-21171928 CCCGCTGCACAGAGGGAGGTGGG - Intergenic
1037742490 8:21618574-21618596 CAGGCTGCACAGCAGGAGGTGGG + Intergenic
1037939015 8:22936587-22936609 CTGGCTTCACAGAGTGAGTCAGG - Intronic
1038441240 8:27572186-27572208 GAGGCTGGGCAGAGTGAGCATGG + Intergenic
1038478384 8:27884897-27884919 CAGGGAGTACAGAGTGAGGCAGG + Intronic
1038701094 8:29849907-29849929 CAGGCGTCACAGAGAGAGGGGGG - Intergenic
1038871254 8:31496370-31496392 CAGTGGGCACAGAGTGAGGGAGG + Intergenic
1039025382 8:33252739-33252761 GAGGCTCCACCCAGTGAGGAGGG + Intergenic
1039608820 8:38902932-38902954 CAGGCGGCACATGGTGAAGAGGG - Intronic
1039893379 8:41699246-41699268 CAGGCAGCACGGTGTGAGGGAGG + Intronic
1040402942 8:47071119-47071141 GAGGCTGCAGTGAGTGGGGATGG - Intergenic
1040977175 8:53206361-53206383 CAGGCTGCAGAGAGTGATATTGG + Intergenic
1041021647 8:53644062-53644084 CAGGCAGCTAAGAATGAGGAAGG - Intergenic
1041389845 8:57338589-57338611 AAGGGTGGACAGAGTTAGGAGGG - Intergenic
1041624534 8:60010468-60010490 CAGAGTGCACAGTGTGGGGATGG + Intergenic
1042615169 8:70640546-70640568 CAGCCTGCACCAAGAGAGGAGGG - Intronic
1043324879 8:79037546-79037568 CTGGCTGCATAGAATGAGTAAGG - Intergenic
1045057495 8:98382171-98382193 CCTGCTGCACAGAGCCAGGAAGG - Intergenic
1047429182 8:124776030-124776052 CAGCCTGCAGAGAGTCATGAAGG - Intergenic
1047761378 8:127957157-127957179 CAGGTTGCACAGCTTGGGGATGG + Intergenic
1047896585 8:129373222-129373244 AAGGCTGCAGTGAGGGAGGAGGG - Intergenic
1049396681 8:142404088-142404110 CAAGCATCACAGAGTGAGGGCGG - Intergenic
1049514388 8:143045693-143045715 CAGGCTTGCCAGAGAGAGGAAGG + Intronic
1050319717 9:4439106-4439128 CATGCAGCACAGAGAGAGAAAGG - Intergenic
1051347300 9:16163768-16163790 CAGGGTGTAAAGAGAGAGGAAGG - Intergenic
1051398529 9:16654047-16654069 CAGTCTGCACAGAGTGATCTGGG + Intronic
1051599474 9:18858376-18858398 GAGGCTGAACAGAGTGAAAAGGG - Intronic
1051606143 9:18919125-18919147 GGGGCTGCACAGGGTGGGGAAGG + Intergenic
1051689578 9:19696012-19696034 CAGGCTGCACAGCAGGAGGTGGG + Intronic
1052276327 9:26680746-26680768 GAGGCTGCAGTGAGTGATGACGG - Intergenic
1055133563 9:72803744-72803766 GAGGCTGCAGAGAGATAGGAAGG + Intronic
1055341026 9:75283350-75283372 CAGGGTGCACGGTGAGAGGAGGG - Intergenic
1055934223 9:81589987-81590009 CATGCTGCACAGAGAAGGGACGG - Intronic
1056205575 9:84316465-84316487 CTTGCTGCCCAGTGTGAGGATGG + Intronic
1056762350 9:89424627-89424649 CAGGCAGGACACAGTGAGGAAGG - Intronic
1057348988 9:94278691-94278713 GAGGCTGGACAGAGTGTGAAGGG + Intronic
1057711694 9:97451352-97451374 CAGGCTGCAGTGAGTTATGATGG - Intronic
1057907483 9:98993865-98993887 CAGGCTGGAAAGGCTGAGGATGG - Intronic
1059383260 9:113945100-113945122 CTGGCAGGACAGAGTGAGGTAGG - Intronic
1059547854 9:115196835-115196857 CAGGCCACACAGAGTGATGGAGG - Intronic
1060367503 9:123033454-123033476 CAGACTGCACAGTGTGGGAATGG - Intronic
1061877950 9:133554307-133554329 GGGGCTGGACAGAGTAAGGAGGG + Intronic
1062101611 9:134731477-134731499 CTGGCTGCAGAGGGAGAGGAAGG - Exonic
1062426877 9:136510212-136510234 CAGGCTTCACAGACCGAGCAGGG + Intronic
1062469398 9:136695937-136695959 CAGGATGCACAGAGGGAAGGGGG - Intergenic
1062751614 9:138258424-138258446 AAGGCTGGACAGAGTGAGATTGG + Intergenic
1203563254 Un_KI270744v1:74669-74691 CAGGCTGGGCACAGTGGGGAGGG - Intergenic
1185881796 X:3747797-3747819 CATCCTGCACACAGTGAGTAGGG + Intergenic
1185889565 X:3812411-3812433 CAGCCTGCAGAGAGAGAGGGAGG - Intergenic
1186919490 X:14262449-14262471 GAGGATGCCCAGAGTCAGGATGG + Intergenic
1187850091 X:23583168-23583190 GAGGATGCCCAGAGTCAGGATGG - Intergenic
1187859858 X:23670819-23670841 GAGGCTACACAAAATGAGGAGGG - Intronic
1188691855 X:33139231-33139253 CAGGCTGCAGTGAGTTACGATGG + Intronic
1190095287 X:47474811-47474833 GAGGCTGCAGTGAGTGATGATGG + Intronic
1192038936 X:67596581-67596603 CAGACTGAACACACTGAGGAAGG - Intronic
1192121923 X:68464554-68464576 CAGCCAGATCAGAGTGAGGAGGG + Intergenic
1195861703 X:109390007-109390029 CAGCCTGCACACAGGAAGGAAGG + Intronic
1197692312 X:129515094-129515116 CAGGAAGCACAGAGTCAAGATGG - Intronic
1197875842 X:131105018-131105040 AAGGCTGCAGTGAGTCAGGATGG + Intergenic
1197947988 X:131861497-131861519 CAGTATCCACAGAGTGATGAAGG + Intergenic
1199905392 X:152223549-152223571 GTGGCTGGCCAGAGTGAGGAAGG - Intronic
1199933976 X:152553302-152553324 AGGGCTTCACACAGTGAGGAGGG - Intergenic
1200783201 Y:7235541-7235563 CATCCTGCACACAGTGAGTAGGG - Intergenic
1201160178 Y:11159825-11159847 CAGGCTGGGCACAGTGGGGAGGG + Intergenic
1201510059 Y:14749294-14749316 CAGGCTGCACAGTGTGTCCAGGG - Intronic
1201591216 Y:15616883-15616905 CAGGGTGCAGGGAGTGGGGAGGG + Intergenic
1202027743 Y:20542323-20542345 TAGGCTGAACAGAGTCAAGATGG - Intergenic