ID: 901934176

View in Genome Browser
Species Human (GRCh38)
Location 1:12616680-12616702
Sequence CTTCAGAGCTGCAGCCGCCC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 265
Summary {0: 1, 1: 0, 2: 1, 3: 28, 4: 235}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
901934168_901934176 22 Left 901934168 1:12616635-12616657 CCGCTCTTCCCTTTTCAAACCCA 0: 1
1: 0
2: 3
3: 75
4: 656
Right 901934176 1:12616680-12616702 CTTCAGAGCTGCAGCCGCCCAGG 0: 1
1: 0
2: 1
3: 28
4: 235
901934174_901934176 -10 Left 901934174 1:12616667-12616689 CCCTCTCTCGTGTCTTCAGAGCT 0: 1
1: 0
2: 0
3: 8
4: 173
Right 901934176 1:12616680-12616702 CTTCAGAGCTGCAGCCGCCCAGG 0: 1
1: 0
2: 1
3: 28
4: 235
901934171_901934176 3 Left 901934171 1:12616654-12616676 CCCAAACCAAGTACCCTCTCTCG 0: 1
1: 0
2: 1
3: 3
4: 85
Right 901934176 1:12616680-12616702 CTTCAGAGCTGCAGCCGCCCAGG 0: 1
1: 0
2: 1
3: 28
4: 235
901934173_901934176 -3 Left 901934173 1:12616660-12616682 CCAAGTACCCTCTCTCGTGTCTT 0: 1
1: 0
2: 0
3: 10
4: 180
Right 901934176 1:12616680-12616702 CTTCAGAGCTGCAGCCGCCCAGG 0: 1
1: 0
2: 1
3: 28
4: 235
901934170_901934176 13 Left 901934170 1:12616644-12616666 CCTTTTCAAACCCAAACCAAGTA 0: 1
1: 0
2: 1
3: 28
4: 243
Right 901934176 1:12616680-12616702 CTTCAGAGCTGCAGCCGCCCAGG 0: 1
1: 0
2: 1
3: 28
4: 235
901934172_901934176 2 Left 901934172 1:12616655-12616677 CCAAACCAAGTACCCTCTCTCGT 0: 1
1: 0
2: 0
3: 2
4: 67
Right 901934176 1:12616680-12616702 CTTCAGAGCTGCAGCCGCCCAGG 0: 1
1: 0
2: 1
3: 28
4: 235
901934169_901934176 14 Left 901934169 1:12616643-12616665 CCCTTTTCAAACCCAAACCAAGT 0: 1
1: 0
2: 0
3: 25
4: 230
Right 901934176 1:12616680-12616702 CTTCAGAGCTGCAGCCGCCCAGG 0: 1
1: 0
2: 1
3: 28
4: 235

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
901934176 Original CRISPR CTTCAGAGCTGCAGCCGCCC AGG Intronic
900479593 1:2891662-2891684 GTGCAGAGCTGCAGCCGCCAGGG - Intergenic
901618253 1:10559579-10559601 GTTGAGAGCTGCAGCAGCCGTGG - Intronic
901934176 1:12616680-12616702 CTTCAGAGCTGCAGCCGCCCAGG + Intronic
902475758 1:16686108-16686130 CCTCGGAGCAGCAGCCGCCGCGG - Intergenic
903116280 1:21181128-21181150 ATTCAGAGCTGCAGCCACCTTGG + Intergenic
903227404 1:21901697-21901719 CTGGGCAGCTGCAGCCGCCCTGG - Intronic
903365536 1:22803254-22803276 CTGCACAGCTGCAGCCGCTGTGG + Intronic
903557169 1:24202458-24202480 CTTCAGAGATGGAGCCGGGCAGG + Intergenic
904333662 1:29783730-29783752 CCAGAGAGCTGCTGCCGCCCTGG + Intergenic
904837737 1:33349868-33349890 CTCGAGGGCTGCAGCCGCCGCGG + Intronic
905248936 1:36635800-36635822 TTTCAGAGGTGCAGACTCCCAGG + Intergenic
905857392 1:41323023-41323045 CTACAGAGCTCCAACAGCCCAGG - Intergenic
906273641 1:44500643-44500665 GTACAGAGCTGCAGCCGCTGGGG - Intronic
910730233 1:90387462-90387484 CTTTAGAGCAGCAGCCAGCCAGG - Intergenic
915937381 1:160097478-160097500 CTTCAGAGCTGCTGTCGTCAAGG - Intronic
917969239 1:180196629-180196651 CCTCAGAGCTGCACCAGGCCAGG + Exonic
919778386 1:201208271-201208293 CTTCAGAGCCTCAGAGGCCCTGG + Exonic
920624247 1:207580379-207580401 CTTCAGGGCTCCAGTCTCCCTGG - Exonic
920626937 1:207611816-207611838 CTTCAGGGCTCCAGTCTCCCTGG - Exonic
923489865 1:234475165-234475187 CTTCAGAGGCGCAGGCACCCAGG + Intronic
1064744250 10:18463488-18463510 CTTCACAGCTTCAACCTCCCAGG + Intronic
1066004688 10:31135364-31135386 CATCAGAATTGCAGCCTCCCTGG + Intergenic
1067523057 10:47022447-47022469 TTTCAGAGCTGCTGTCTCCCAGG - Intergenic
1069411101 10:68154318-68154340 TTTCAAGGCTGCAGCAGCCCTGG + Intronic
1069984384 10:72273664-72273686 CTTGGCAGCTGCAGCCGCCGCGG + Intergenic
1070266797 10:74910693-74910715 CTACAGATCTGCAACCTCCCTGG + Intronic
1072719097 10:97769987-97770009 CATCATGGCTGCAGCCGCCAGGG - Intronic
1075139574 10:119819142-119819164 CTTCAGAGCTGCAGACGTGGGGG + Intronic
1075297550 10:121291615-121291637 CTTCAGAGCCACAGCTGACCGGG + Intergenic
1076096118 10:127736317-127736339 CTCCAGTCCTGCTGCCGCCCGGG - Intergenic
1076224340 10:128762021-128762043 CTTCAGGGAAGCAGCAGCCCAGG - Intergenic
1078489158 11:11753355-11753377 CTACAGAGCTGCTACCTCCCAGG + Intergenic
1080052425 11:27870974-27870996 CATCTGAGCTGCAGCAGCTCTGG - Intergenic
1081540746 11:44032935-44032957 CTACAGAGCTCAAGCCTCCCTGG + Intergenic
1081927926 11:46846121-46846143 CTGGAGACCTCCAGCCGCCCAGG + Intronic
1082993150 11:59226251-59226273 CTTCAGAGCTGCATTCCCTCTGG + Intergenic
1083291713 11:61694200-61694222 GTTCAGAGCTGGAGAGGCCCAGG - Intronic
1084367936 11:68715588-68715610 CTTCAGAGATGCAGCAGTCTAGG - Intronic
1085446591 11:76604863-76604885 CTACAGTCCTGCAGCTGCCCCGG + Intergenic
1089659325 11:119975784-119975806 TATCAGAGCTGCAGCTGCCTTGG + Intergenic
1089678871 11:120108394-120108416 CCTCAGAACTGCAGGAGCCCTGG + Intergenic
1089935400 11:122359275-122359297 CTCCAGAGCTGCAGGCACGCCGG + Intergenic
1090402278 11:126456557-126456579 CCTCAGAGCAGCCCCCGCCCTGG + Intronic
1090664403 11:128905303-128905325 CCGCAGAGCTGCAGCTGGCCAGG + Intronic
1090669886 11:128938685-128938707 TTCCAGAGCTCCCGCCGCCCTGG - Intronic
1091288351 11:134421962-134421984 CTTCAGAAATGCAGCCTCCGGGG - Intergenic
1095986687 12:48004152-48004174 CTCCAGAGCTGGAGCGGGCCGGG + Intronic
1096504910 12:52086651-52086673 GCTCAGAGCTGCAGCCTCTCTGG + Intergenic
1096718166 12:53503277-53503299 CTTCATAGCAGCAGAAGCCCTGG - Intronic
1098999532 12:77162173-77162195 CTTTGGAGCTGCAGTCTCCCAGG - Intergenic
1100053775 12:90484317-90484339 CTTCAAGGCTGCAGCAGCTCTGG - Intergenic
1100776926 12:97985277-97985299 CATCAGAGCTGCAGACGGTCAGG - Intergenic
1100858334 12:98778065-98778087 CTTCAGGTCTCCAGCTGCCCAGG + Intronic
1101477182 12:105062055-105062077 CTGCAGAGTTGCAGCAGCACTGG - Intronic
1102472542 12:113167817-113167839 CTACAGATCTGCAGCCTCCTGGG - Intronic
1103400175 12:120638683-120638705 CTTCAGGGCTGCAACGCCCCAGG + Intergenic
1103725702 12:122996477-122996499 AGTCAGAGCAGCAGCCGCCGGGG - Exonic
1104801557 12:131558311-131558333 CTTCAGAGCAGCATCCACCTGGG - Intergenic
1104804855 12:131579250-131579272 CTGAAATGCTGCAGCCGCCCTGG + Intergenic
1104852092 12:131881576-131881598 CTTCAGCTCTGCAGCCACACAGG - Intergenic
1104907059 12:132219235-132219257 CGTCACAGCTGCAGCGGGCCTGG - Intronic
1104916681 12:132269167-132269189 CCTCAGCGCTGAGGCCGCCCTGG - Intronic
1112830549 13:103444753-103444775 CTTCATTGCTGCAGCTGCCATGG + Intergenic
1113201115 13:107867800-107867822 CGTCCGAGTTGCAGGCGCCCGGG + Intergenic
1113638409 13:111938163-111938185 CTTCAGGGCTGCAGGCTCCCTGG + Intergenic
1113711177 13:112466545-112466567 GTTCAGAGCTGCTTCCACCCGGG + Intergenic
1113910611 13:113839590-113839612 CCTCAGGGCTGCAGCCTCCTTGG + Intronic
1113955547 13:114098453-114098475 CAGCAGGGCTGCAGGCGCCCAGG + Intronic
1114430825 14:22658943-22658965 CTTGTGAGTTGCAGCTGCCCTGG + Intergenic
1116862114 14:50003293-50003315 GCTCACGGCTGCAGCCGCCCGGG + Intronic
1117457240 14:55910789-55910811 ATTCAGCTCTGCAGCCTCCCTGG - Intergenic
1121125574 14:91404558-91404580 CCCCAGATCTGCAGCCGCGCTGG - Intronic
1121717233 14:96084950-96084972 CTTCTGAGCAGCAGCTGCCCAGG + Intronic
1122145160 14:99684424-99684446 CTGCCGAGCAGCAGCAGCCCGGG - Exonic
1122781947 14:104147446-104147468 CTTCAGAGCTGCAGACCCACAGG + Intronic
1122896753 14:104761490-104761512 CTCCAGTGTTGCAGCTGCCCTGG - Intronic
1123500677 15:20878301-20878323 ATTCAGCGCTGCAGTCGCCAGGG - Intergenic
1123557922 15:21451994-21452016 ATTCAGCGCTGCAGTCGCCAGGG - Intergenic
1123594151 15:21889275-21889297 ATTCAGCGCTGCAGTCGCCAGGG - Intergenic
1124191310 15:27579704-27579726 CTCCAGGCCTGCAGCCGCCTAGG + Intergenic
1124427133 15:29571204-29571226 CCGCAGACCTGCAGCCGCCAGGG - Intergenic
1124453706 15:29822001-29822023 CGCCAGAGCTGCGGCCGCCAAGG - Exonic
1124497184 15:30193623-30193645 CTGCAGTGCTGCAGCAGCCGCGG + Intergenic
1124746390 15:32345024-32345046 CTGCAGTGCTGCAGCAGCCGCGG - Intergenic
1124835735 15:33194656-33194678 CTTCGAGGCTGCAGCCGCCACGG - Exonic
1125410904 15:39405222-39405244 GTTCTGAGCTGCATCCTCCCTGG + Intergenic
1125902731 15:43364033-43364055 CTTCTGAGCTTCAGCCTCACTGG + Exonic
1126581959 15:50250234-50250256 GTTCAAAGCTGCAGCCACCTGGG + Intronic
1126668154 15:51093648-51093670 CTTCAGAGCTGCACAAGCGCCGG + Intronic
1127906677 15:63381377-63381399 CTTCAGAGCTGGCGGTGCCCGGG + Intronic
1128139303 15:65287167-65287189 CCTCACAGCAGCAGCAGCCCTGG + Intronic
1129117359 15:73371963-73371985 CTGCAGTGCTGCAGCGGGCCTGG + Intergenic
1129296454 15:74602866-74602888 ATTCAGAGCTCCAGCCTCACAGG + Intronic
1129356405 15:74995126-74995148 CTTCAGATCTGCAGGCGCAGGGG - Intronic
1129472101 15:75761693-75761715 CTTCAGGGCGGCATCAGCCCAGG + Intergenic
1131748816 15:95482707-95482729 CTACAGACCTGCAGCCACCTGGG + Intergenic
1202966273 15_KI270727v1_random:179166-179188 ATTCAGCGCTGCAGTCGCCAGGG - Intergenic
1132664542 16:1075644-1075666 CCTCTGAGCTGCACCCTCCCTGG - Intergenic
1132791595 16:1692559-1692581 GATCAGAGCTGCAGCCTCCCTGG + Intronic
1133774364 16:8885782-8885804 CTGGAGAGCTGCTGCAGCCCAGG - Intergenic
1134253197 16:12589377-12589399 CTTCAGAGGTGCAGTCACCCAGG + Intergenic
1138101641 16:54256620-54256642 ATGCCGAGCTGCAGCCCCCCAGG - Intronic
1138349243 16:56337796-56337818 CTTCTGGGCTGCAGCCCGCCAGG + Intronic
1138590462 16:57996751-57996773 CGTCAGACCTGCAGCGGCACCGG - Exonic
1138628687 16:58275264-58275286 CTTGGGAGCTGCAGACTCCCAGG - Intronic
1139605740 16:68016950-68016972 TTTCAGTGCTTCAGCCTCCCAGG - Intronic
1139668192 16:68472852-68472874 CGTCAGAGGTGCAGCAGCCTGGG - Intergenic
1140522887 16:75597416-75597438 CTTCAGAGCAGCAGTCCCCAAGG + Intronic
1141426555 16:83947946-83947968 CTGCAGTGCTGCAAGCGCCCAGG - Intronic
1142185745 16:88694001-88694023 CATCCGAGCTGCCGCGGCCCCGG + Intergenic
1143735715 17:8910884-8910906 CTTCAGAGACGCAACTGCCCGGG + Intronic
1143897140 17:10145147-10145169 GCTCAGGGCTGCAGACGCCCTGG + Intronic
1147444235 17:40465100-40465122 CTTCAGCCCTGCAGCCACCCAGG - Intergenic
1147566661 17:41540576-41540598 CATCTGAGCTCCAGCAGCCCCGG - Intergenic
1147662166 17:42122554-42122576 CTTCACAGCTGCGGCCTCCCCGG + Exonic
1148582742 17:48754835-48754857 CTTCAGAGCCGGAGCCGCTTGGG + Intergenic
1149520125 17:57312421-57312443 CTTCAAGGCTGCAGGCTCCCTGG + Intronic
1151767096 17:76138262-76138284 TCCCAGAGCTGCAGCCGCCTGGG - Intronic
1151986096 17:77544834-77544856 ATTCAGAGAGGCAGCTGCCCTGG + Intergenic
1152069601 17:78128253-78128275 CCCCAGAGTTGCAGCCGCTCTGG - Intronic
1152568074 17:81109009-81109031 CTTCAGAGCAGCGGCTGCCCGGG - Intronic
1152855335 17:82662458-82662480 CTTCAGGGTGGCAGCGGCCCAGG - Intronic
1152867406 17:82732441-82732463 CTACAGAGCTGGCGCCACCCAGG - Intergenic
1156012694 18:32512988-32513010 CTTCACAGCAGCAGGCTCCCCGG + Intergenic
1156503779 18:37576366-37576388 CTTCAGCACTGCAGCAACCCTGG + Intergenic
1157752711 18:50193837-50193859 CGGCAGCGCTGCAGCCGCCCGGG - Intronic
1160694234 19:474795-474817 CTTCTGAGCCGCAGCAGCTCTGG + Exonic
1160739762 19:680369-680391 CCGCAGACCTGCAGCCGCGCCGG - Exonic
1161272417 19:3397429-3397451 CTTCAGGGCTGCAGCCAGGCTGG + Intronic
1161706313 19:5823760-5823782 CTCCTCAGCTGCAGCCGCTCCGG + Intergenic
1161925452 19:7295540-7295562 CTTCAGAGATGAAGCCATCCTGG - Intergenic
1162790672 19:13061137-13061159 ATTCAGAGCGGCAGCCACACAGG + Intronic
1163160068 19:15458898-15458920 TTTCTGAGCTCCAGCCTCCCTGG + Intronic
1164535828 19:29086116-29086138 CTCCAGAGCTGAACCTGCCCAGG - Intergenic
1165191139 19:34064461-34064483 ATTCAGGGCTGCAGACCCCCAGG - Intergenic
1166938107 19:46347152-46347174 CTTCAGAGCTCCATCAGCCGGGG - Exonic
925496949 2:4462250-4462272 CTCTGGAGCTGCAGCCACCCAGG + Intergenic
927975653 2:27336225-27336247 CCCCAGAGCTGGAGCAGCCCAGG + Exonic
928022761 2:27716431-27716453 CTCCAGGGCTGCAGCTGCTCGGG - Intergenic
931434103 2:62232240-62232262 CTTCCGAGCTGCAGTCAACCAGG + Intergenic
932736874 2:74260486-74260508 CTTCTGAGCTGCAGACTCCTTGG + Intronic
933660076 2:84920452-84920474 CATCAGAACTGCAGGCTCCCTGG + Intergenic
933995849 2:87669279-87669301 CTTCAGACCTGGAGCCCCCATGG - Intergenic
934717060 2:96550397-96550419 CCTCAGAGCTGCGGGAGCCCAGG + Intronic
935122872 2:100197762-100197784 CTTCTGGGCAGCAGCCTCCCAGG - Intergenic
935214852 2:100967919-100967941 CTTTGGAGCTGCAGGAGCCCAGG - Intronic
936298008 2:111281633-111281655 CTTCAGACCTGGAGCCCCCATGG + Intergenic
938341200 2:130537755-130537777 ATTCCCAGCTACAGCCGCCCAGG + Intergenic
938348631 2:130582954-130582976 ATTCCCAGCTACAGCCGCCCAGG - Intronic
938653802 2:133410617-133410639 CTCCAGAGCTGCAGCATCGCAGG + Intronic
939863018 2:147441754-147441776 CTTCAGAGCTGAGGACCCCCAGG - Intergenic
944690544 2:202154686-202154708 CTTCTGAGCTGCTGCCTCCAAGG - Exonic
944716215 2:202377479-202377501 CTTCCTCGCTGCAGCGGCCCTGG + Exonic
946158442 2:217821840-217821862 CTTTAGTGCTCCAGCCACCCAGG - Exonic
946740736 2:222798738-222798760 CTTCAGAGCTGCAGACACCTGGG - Intergenic
947252822 2:228126783-228126805 TTTCAGAGCTGCAGCTTCCAGGG + Intronic
947887815 2:233589083-233589105 CTTCAGAGCTACACTCACCCTGG - Intergenic
948555340 2:238806231-238806253 CTTCAGAACGGCTGCCGCCCTGG - Intergenic
948907684 2:240987596-240987618 CTTCAGGGCTGGAGCAGGCCTGG - Intronic
1173809714 20:45948427-45948449 CTTCAGACCTGCTTCCTCCCTGG - Intergenic
1175259902 20:57667755-57667777 CTGCAGAGCCCCAGCGGCCCTGG + Intronic
1175921942 20:62454285-62454307 CTGCAGAGCTGGAGCGGTCCTGG + Intergenic
1176124159 20:63467857-63467879 CTCCAGAGGTGCCGGCGCCCTGG - Intronic
1178728099 21:35073102-35073124 CTGCAGAGCTGCAGCCTCCGTGG - Intronic
1179209729 21:39314253-39314275 CTTCAGCGCCGCAGACGCTCCGG - Intronic
1179249024 21:39657414-39657436 CATCAGAGCTGCAGGCTCTCTGG + Intronic
1179720109 21:43311466-43311488 CTCCAGAGGTGCTGCTGCCCAGG - Intergenic
1182149839 22:28020177-28020199 CTTCACAGCTGCACCACCCCGGG + Intronic
1182693465 22:32179560-32179582 CTCCAGAGCTGCCTCCTCCCAGG + Intergenic
1182942064 22:34286382-34286404 GGTCAGAGCTGGAGCTGCCCAGG - Intergenic
1183212267 22:36458262-36458284 CTGCAGCCCTGCAGCCGGCCTGG + Intergenic
1183928597 22:41223471-41223493 CTGCAGAGCTGCAGCCCATCAGG + Intronic
1184277601 22:43419071-43419093 CTTCAGTGCTCCAGCAGCCCAGG + Intronic
1184375805 22:44111942-44111964 CTTCTGACCCGCAGCCTCCCAGG - Intronic
1184585586 22:45445855-45445877 CTTCATTGCTGCAGAAGCCCAGG - Intergenic
1184679399 22:46062013-46062035 CTTCAGAGCCGCTGCGGGCCTGG + Intronic
1184739545 22:46419486-46419508 CTTCCGAGCTGCAGCCTCCCGGG + Intronic
1184821873 22:46915536-46915558 CCTGAGAGCTGCAGCTGGCCTGG + Intronic
1184881288 22:47305998-47306020 CTGCAGAGTGGCAGCTGCCCAGG - Intergenic
1185273997 22:49942086-49942108 CTTCAGAGCTGCTTCCACCCTGG - Intergenic
1185277467 22:49956000-49956022 CTTCAGCGCAGCAGCCTCACTGG - Intergenic
949543624 3:5053711-5053733 GTTCAGAGCTTCAGCCACACTGG - Intergenic
949575932 3:5339257-5339279 CATCAGAACTGCAGCCTCGCAGG + Intergenic
950186591 3:10949239-10949261 CATCAGGCCTGCAGCTGCCCTGG - Intergenic
950783805 3:15415548-15415570 CTTCAGAGCTTCGCCAGCCCTGG - Intronic
952853301 3:37746968-37746990 CTTCAGAGTTGCAGATTCCCTGG + Intronic
952919610 3:38275700-38275722 CCACAGGGCTGCAGCCTCCCTGG + Intronic
960640087 3:119815616-119815638 CTCCAGAGCTGGAGTCACCCAGG - Intronic
961529036 3:127528571-127528593 CCTCAGAGCTGCAGGCACCATGG + Intergenic
962414770 3:135172203-135172225 GTTCAGTGCTGCAGACACCCAGG + Intronic
962954063 3:140248047-140248069 TTTCAGACCTGCTGCCTCCCAGG + Intronic
966293769 3:178393074-178393096 CTTCAGATCTGCTGATGCCCAGG + Intergenic
966596247 3:181726686-181726708 TTTCAGAGCTGCGGCAGCCGGGG + Intergenic
968503073 4:960167-960189 CTTAAGAGCAGCAGGCTCCCTGG - Exonic
969652483 4:8475952-8475974 CTGCGGAGCTGCGGCCACCCCGG + Exonic
975022310 4:69503856-69503878 CTTCTGAGCTGCGGTGGCCCAGG - Intronic
976765336 4:88592614-88592636 CGGCGGAGCTGCAGCCGCGCTGG + Intronic
982472706 4:155812574-155812596 CTTCAGAGCCCCAGTTGCCCGGG - Intergenic
985163114 4:187064195-187064217 CCTCTGTGCTGCAGCCTCCCGGG - Intergenic
985792492 5:1937711-1937733 CCTCAGGGCTGCAGCTGCCCGGG + Intergenic
985865250 5:2509375-2509397 CTCCAAAGCTGCAGCCCCACTGG + Intergenic
987207763 5:15644926-15644948 CTGCAGATCTGCAGCACCCCTGG + Intronic
988320346 5:29686619-29686641 CTTCAGAGAGGCAGCCACCAAGG + Intergenic
992837466 5:80654844-80654866 CTCCACAGGTGCAGCCGACCAGG + Exonic
994313929 5:98310132-98310154 CCTCCCAGCTGCAGCCACCCAGG + Intergenic
997990809 5:138543147-138543169 CGTCAGAGCCGCCGCCGCCGCGG - Exonic
999106404 5:149075039-149075061 CATCAGAGGTGCAGCTGCTCTGG - Intergenic
1001208301 5:169785695-169785717 CTTCAGAGCTCCAGGATCCCTGG - Intronic
1002575414 5:180171221-180171243 CTTCTGAGCTGCAGGAGCCCGGG + Intronic
1005303028 6:24489551-24489573 GCTCAGAGCTGCAGCAGCACTGG + Exonic
1006737867 6:36287502-36287524 CTTCCGAGCTGCAGGCTGCCAGG - Intronic
1006965495 6:37979993-37980015 CTTCGGAGCTGCAGCTGCACAGG + Intronic
1009942098 6:70302011-70302033 CTTGACAGCTGCAGATGCCCAGG + Exonic
1010787105 6:80016774-80016796 CTTCTGAACTGAACCCGCCCAGG - Intronic
1014239172 6:118995879-118995901 CTTCAGAGGTGCTGCAGCCCAGG - Intronic
1019073251 6:169366902-169366924 CTTCACAGCTCCTGACGCCCGGG - Intergenic
1019334755 7:477862-477884 CTGCAGACGTGCAGCCCCCCAGG - Intergenic
1019586092 7:1804494-1804516 CTCCTGGGCTGCAGCCGCGCAGG + Intergenic
1019686545 7:2384990-2385012 CTGCTGAGCTGCAGCCACCCAGG - Intergenic
1020153641 7:5703390-5703412 CATCACAGCTGGAGCTGCCCTGG + Intronic
1021874754 7:25037842-25037864 TTTCTGAGATGCAGCCTCCCCGG - Intergenic
1022108730 7:27214682-27214704 CTTTGGGGCTGCAGCCACCCAGG - Intergenic
1022485125 7:30771817-30771839 CTCCCCAGCTGCCGCCGCCCCGG - Intronic
1024637264 7:51301107-51301129 CTTCAGAGCAGCAGCCTGCGCGG - Intronic
1028774760 7:94664281-94664303 CTTGCGAGCTGCAGCAGCCCTGG - Exonic
1031113219 7:117637397-117637419 CTTCCAAGCTGCAGGCGCACAGG - Intronic
1031146895 7:118006648-118006670 CTTCAGAGCCACAGCAGCACGGG + Intergenic
1034337131 7:150330855-150330877 CTGCAGAGCAGCAGCCACTCTGG + Exonic
1034455428 7:151167552-151167574 GTTCGGAGCTGCGGCCGCCCCGG + Intronic
1035165838 7:156989206-156989228 CACCAGAGCTGAAGCTGCCCCGG - Intergenic
1035567381 8:650510-650532 CCTCCCAGCAGCAGCCGCCCCGG + Intronic
1035663857 8:1365823-1365845 CGTCTGAGCTGCGGCCCCCCAGG - Intergenic
1038680812 8:29665168-29665190 ATTCAGAGCTGCCTCCACCCTGG - Intergenic
1038726000 8:30083071-30083093 CTGCAGAGCTGCAGCCGCAACGG + Exonic
1039471871 8:37818484-37818506 CTTGTGAGCTGCTGCCGCCCTGG - Intronic
1040280219 8:46037126-46037148 CTTCAGGGATCCACCCGCCCTGG - Intergenic
1040415769 8:47194133-47194155 CTTCCGTGCTGCAGCTGCCTTGG + Intergenic
1042600316 8:70493211-70493233 CTTCACAGCTGCAGCCCCCATGG - Intergenic
1044380618 8:91528614-91528636 CTTCGAGGCTGCAGCCGCCACGG - Intergenic
1049036596 8:140081128-140081150 CTTCTCAGCTGCAGACGCACTGG - Intronic
1049301049 8:141870644-141870666 CTTCGGAGCTGCAGCATTCCTGG + Intergenic
1049565025 8:143333752-143333774 CTGCTGAGCTGCAGTCGCCCAGG - Intronic
1050191100 9:3027365-3027387 CTTCACAGTAGCAGCTGCCCAGG + Intergenic
1052637209 9:31121177-31121199 CTTCAGGGGTGGAGCTGCCCAGG - Intergenic
1056905354 9:90642783-90642805 CTTCAGAGCTCCACTCGCGCAGG + Exonic
1057739113 9:97696818-97696840 GTTTAGGGATGCAGCCGCCCCGG - Intronic
1059481907 9:114597581-114597603 CTTCAGTGCTGCAACTGCCACGG - Exonic
1060723983 9:125995414-125995436 CCTCAGAGCTGCAGGGGCCCTGG + Intergenic
1060895746 9:127215980-127216002 CTTCAGAGCTGCTGCCTGCAAGG - Intronic
1061870552 9:133518044-133518066 CTCCAGGCCTGCAGCAGCCCAGG - Intronic
1062450763 9:136614824-136614846 CTGCTGAGCTGCAGCCTCCAAGG - Intergenic
1062631654 9:137465720-137465742 CTTGGGAGCTGCTGCCGCACAGG + Intronic
1185453091 X:293197-293219 ATGAAGAGCTGCGGCCGCCCAGG + Exonic
1186795700 X:13044626-13044648 CACGAGAGCAGCAGCCGCCCCGG + Intronic
1187535917 X:20141693-20141715 CCTCGGAGCAGCAGCCGCCGCGG - Exonic
1187576525 X:20562133-20562155 CTGCAGAGCTTCAGAAGCCCAGG + Intergenic
1193641607 X:84015514-84015536 CTTCACAGGTGCAGTCACCCTGG + Intergenic
1193972102 X:88067466-88067488 CTACAGGGCTGTAGCTGCCCAGG + Intergenic
1194130589 X:90076110-90076132 CTCCAGAGCTGCAGGTGCACAGG - Intergenic
1195750986 X:108161877-108161899 CATCAAGGCTGCAGCCGCCTGGG + Intronic
1199686579 X:150270601-150270623 CTTCAGAGCTGCATCTACCTGGG + Intergenic
1200124260 X:153805839-153805861 TTTCAGAGCAGCAGGGGCCCTGG + Intronic
1200142049 X:153907294-153907316 CTTCAAAGCTGCAGGACCCCTGG + Intronic
1201768224 Y:17592904-17592926 ATTCATAGCTGCAGCCCACCTGG + Intergenic
1201833329 Y:18313081-18313103 ATTCATAGCTGCAGCCCACCTGG - Intergenic