ID: 901934526

View in Genome Browser
Species Human (GRCh38)
Location 1:12618384-12618406
Sequence CGCGCTCCCCGCGACGGCGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 146
Summary {0: 1, 1: 0, 2: 1, 3: 13, 4: 131}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
901934526_901934536 27 Left 901934526 1:12618384-12618406 CCTGCGCCGTCGCGGGGAGCGCG 0: 1
1: 0
2: 1
3: 13
4: 131
Right 901934536 1:12618434-12618456 GACTCGCGCTCTCCCGGGACTGG 0: 1
1: 0
2: 1
3: 2
4: 57
901934526_901934529 -5 Left 901934526 1:12618384-12618406 CCTGCGCCGTCGCGGGGAGCGCG 0: 1
1: 0
2: 1
3: 13
4: 131
Right 901934529 1:12618402-12618424 GCGCGCATAAGGCGCGCACTCGG 0: 1
1: 0
2: 0
3: 0
4: 8
901934526_901934533 21 Left 901934526 1:12618384-12618406 CCTGCGCCGTCGCGGGGAGCGCG 0: 1
1: 0
2: 1
3: 13
4: 131
Right 901934533 1:12618428-12618450 CGCCGGGACTCGCGCTCTCCCGG 0: 1
1: 0
2: 0
3: 6
4: 80
901934526_901934530 -4 Left 901934526 1:12618384-12618406 CCTGCGCCGTCGCGGGGAGCGCG 0: 1
1: 0
2: 1
3: 13
4: 131
Right 901934530 1:12618403-12618425 CGCGCATAAGGCGCGCACTCGGG 0: 1
1: 0
2: 0
3: 1
4: 9
901934526_901934534 22 Left 901934526 1:12618384-12618406 CCTGCGCCGTCGCGGGGAGCGCG 0: 1
1: 0
2: 1
3: 13
4: 131
Right 901934534 1:12618429-12618451 GCCGGGACTCGCGCTCTCCCGGG 0: 1
1: 0
2: 1
3: 12
4: 122
901934526_901934532 5 Left 901934526 1:12618384-12618406 CCTGCGCCGTCGCGGGGAGCGCG 0: 1
1: 0
2: 1
3: 13
4: 131
Right 901934532 1:12618412-12618434 GGCGCGCACTCGGGCTCGCCGGG 0: 1
1: 0
2: 0
3: 7
4: 72
901934526_901934531 4 Left 901934526 1:12618384-12618406 CCTGCGCCGTCGCGGGGAGCGCG 0: 1
1: 0
2: 1
3: 13
4: 131
Right 901934531 1:12618411-12618433 AGGCGCGCACTCGGGCTCGCCGG 0: 1
1: 0
2: 0
3: 6
4: 39

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
901934526 Original CRISPR CGCGCTCCCCGCGACGGCGC AGG (reversed) Intergenic
900513085 1:3069500-3069522 CGCGCGCTCCCCGAAGGCGCCGG + Intronic
901016678 1:6235897-6235919 CGCGCAGCCCGCCATGGCGCCGG + Exonic
901053066 1:6435344-6435366 CTCACTCCCTGCGGCGGCGCTGG + Intronic
901361365 1:8703429-8703451 CAGACTCCCCGCGACGGCGGCGG + Intronic
901934526 1:12618384-12618406 CGCGCTCCCCGCGACGGCGCAGG - Intergenic
903142249 1:21345620-21345642 TGCACTCCCCGCGCCCGCGCGGG + Intergenic
904641956 1:31937946-31937968 GGCGGCCCCCGCGCCGGCGCCGG - Intronic
907160967 1:52368627-52368649 CGCGCCCCCCGCCGCGGCTCGGG + Intergenic
909392943 1:75136515-75136537 CTCGCTCCCCGCGCCGAGGCTGG + Intronic
911115033 1:94237669-94237691 CGCGCTCCCGGGGGCGGGGCCGG + Intronic
912798593 1:112707155-112707177 CGCCCTCCCCGCCGCGGCGCTGG - Intronic
918260322 1:182789809-182789831 AGCGCGGCCCGCGACGGCACGGG + Intronic
918365653 1:183805139-183805161 CGCGCTGCCCCCGCCGCCGCCGG - Intronic
921850525 1:219928462-219928484 TGCGCTCCCCTGGGCGGCGCCGG - Exonic
1063504016 10:6580174-6580196 CTCCCTCCCGGCGGCGGCGCGGG + Intronic
1063504022 10:6580181-6580203 CCCGCGCCCCGCGCCGCCGCCGG - Intronic
1065019995 10:21495880-21495902 CCCGCTGCACGCGGCGGCGCGGG - Exonic
1065240180 10:23695982-23696004 CGCTCTCCCCGCGCCGCTGCGGG + Intronic
1069024073 10:63521428-63521450 CGCGCTCCCCGGGGCCGCGCTGG - Exonic
1069664509 10:70145761-70145783 CGCGCGGCCCGCGGGGGCGCTGG - Exonic
1076895368 10:133308846-133308868 CGCGCAGCCCCCGACGGCGGCGG + Exonic
1077100381 11:819865-819887 GGCGCTCACGGCCACGGCGCTGG + Exonic
1077916065 11:6612147-6612169 CGCGGACCCCGAGGCGGCGCCGG - Exonic
1078233214 11:9461130-9461152 CGCCCTCAGCGCGGCGGCGCGGG + Intronic
1078729639 11:13963332-13963354 TGCGGCCCCCGCGACGGCCCGGG - Intronic
1084128710 11:67118246-67118268 AGCGGTCTCCGCGACGGCCCGGG - Intergenic
1084546845 11:69818944-69818966 CGCCCGCCCCGCGGCGGCGGCGG + Exonic
1084888120 11:72223828-72223850 CCGGCTCCCCGGGGCGGCGCGGG + Intronic
1086064904 11:82733805-82733827 CGCGCGCGCCGCGCCGGGGCGGG - Exonic
1091238561 11:134037383-134037405 CGCCCTCCCCTCCGCGGCGCAGG - Intergenic
1091740848 12:2959511-2959533 CGCGCGGCCCGTGAGGGCGCCGG - Intronic
1097057364 12:56258092-56258114 CGCGCTCCCCTCAACCGAGCCGG - Intronic
1097057425 12:56258295-56258317 CGAGCTCCCGGCGGCGGCGGCGG + Exonic
1100309232 12:93378486-93378508 CTCGCTCCCCGCCCCTGCGCAGG + Intronic
1103595558 12:122022585-122022607 CGCGCTCTCCCCGCCGCCGCCGG - Intronic
1105698542 13:22915558-22915580 AGCGATGCCCGCGCCGGCGCAGG + Intergenic
1106087651 13:26557792-26557814 CGCGGTCCCGCCGCCGGCGCCGG - Exonic
1106208745 13:27621767-27621789 CGCTCACCCCGCGTCGGGGCGGG + Exonic
1112506664 13:99980206-99980228 CGCGCTCCCGGCGAGGCCCCGGG + Intergenic
1113673830 13:112194866-112194888 CGCGCACCCGGACACGGCGCTGG - Intergenic
1114514047 14:23286065-23286087 CGCGCTCCCGGGGACGGTGGGGG - Exonic
1122736755 14:103847757-103847779 CGCGCTCCCGGCGGCGGGGGAGG + Intergenic
1202899786 14_GL000194v1_random:28385-28407 CCCGCCCCCCGCGCCTGCGCCGG + Intergenic
1124109323 15:26772500-26772522 CCCGCGCCCCGCGCCGGAGCTGG - Intronic
1124983315 15:34583439-34583461 CGGGGTCCCCGCGGCGCCGCGGG + Intronic
1126113263 15:45187678-45187700 CGCGCCCCCCGCGCCGCCCCCGG - Intronic
1131108636 15:89750769-89750791 CGCGCTGCCGGCACCGGCGCTGG + Exonic
1131144344 15:90001679-90001701 CGCGCCCCCCGCGCCCCCGCCGG - Intronic
1131635712 15:94231408-94231430 CGAGCTCCCGGCGGCAGCGCGGG + Intergenic
1132398238 15:101489581-101489603 CGCGCCCCCCGCGCCCGCGGCGG + Exonic
1132453627 16:10570-10592 GGCGCGCGCCGCGCCGGCGCAGG + Intergenic
1132889492 16:2196776-2196798 CGCCCTCCCCGCGCCCGCCCCGG + Intergenic
1132934458 16:2473742-2473764 CGCTCTCCCCGCAGCGGTGCAGG + Exonic
1134143559 16:11742571-11742593 CACGCAGCCCGCGACGGAGCCGG + Exonic
1135296532 16:21283925-21283947 CGCGCACCCCGCAGCGGCGGAGG + Intronic
1135517668 16:23149155-23149177 CGCGCTGGCGGCGGCGGCGCGGG - Exonic
1139410134 16:66751933-66751955 TGCCCGACCCGCGACGGCGCAGG - Intergenic
1139574740 16:67833764-67833786 CGCGCACCCCGCGGCGACCCCGG - Exonic
1139750312 16:69106074-69106096 GGCGCTCCCTGGGACCGCGCGGG + Intronic
1141548628 16:84789201-84789223 CTCGCTCACCGCGACGGCGGCGG + Intergenic
1142764061 17:2056061-2056083 CGCCCTCCCCGCGCCGGGCCCGG + Intronic
1142859983 17:2755618-2755640 CGCGCTCGCGGGGAGGGCGCGGG - Intergenic
1143183510 17:4997954-4997976 CGCGCTGCCCGGGCGGGCGCCGG + Exonic
1143503442 17:7351725-7351747 CGCTCTCTCCGCGGCGGCGCGGG - Intergenic
1147192818 17:38747576-38747598 CCCGCTCCCCGTCCCGGCGCCGG - Intronic
1147200706 17:38799604-38799626 CGGGCTCCCCGGGGCGGGGCGGG - Exonic
1147319496 17:39637239-39637261 CCCGCTCCCAGCGACCGCTCCGG - Intronic
1148323704 17:46771702-46771724 CGCGCCCCCGGCCCCGGCGCCGG + Intronic
1150108559 17:62479015-62479037 CGCGCCCCCCGCGGCCGCCCGGG + Exonic
1152627887 17:81396581-81396603 CGCGCTCCCGGAGACGACGCCGG + Intronic
1155392491 18:25351139-25351161 CGCGCTCTGCACGACGGCGGCGG + Intronic
1156411188 18:36829229-36829251 CGCCCTCCACGGGACGGCGAGGG + Intronic
1157849129 18:51030698-51030720 CGGGCTCCCGACGACGGCGGCGG + Intronic
1159040283 18:63318412-63318434 CGCAGGCCCCGCGGCGGCGCCGG + Exonic
1159586742 18:70289275-70289297 CGCACCCGCCGAGACGGCGCAGG - Intronic
1159770502 18:72542196-72542218 CGCGCCGCTCGCGCCGGCGCCGG - Exonic
1163583023 19:18149434-18149456 CCCGATCCCCGCGGCTGCGCCGG + Exonic
1165453845 19:35899876-35899898 CGCGCGCCCCGCCTCGGAGCAGG - Intronic
1166366292 19:42280182-42280204 CCCGCTCCCCACGAGGGCCCGGG + Intronic
1167103257 19:47416886-47416908 TGCTCTCCCCGTGACGGGGCCGG - Exonic
925609791 2:5693149-5693171 CGCGCTCCCGCCGCCGCCGCCGG - Exonic
926077085 2:9950884-9950906 CGCGCGCCCCGGGCCGGCCCCGG - Intergenic
926095717 2:10079906-10079928 CGCGCTCCCCGCGACCGCGGTGG + Exonic
926901112 2:17753406-17753428 CGCGCTCTCCGAGGCGGCACCGG - Intronic
927714279 2:25342100-25342122 CTCGCCCCCCGCGGCCGCGCTGG + Intronic
929242489 2:39666401-39666423 TGCGCTCCACGCGCGGGCGCCGG - Intronic
932699995 2:73985455-73985477 CCCGCGCCCCTCGGCGGCGCGGG + Intergenic
939612965 2:144332383-144332405 CGCGCTCCCCGCCTCCCCGCTGG + Intronic
941819139 2:169827558-169827580 CGAGCTGCCCGCGCCGGGGCTGG + Exonic
946322084 2:218960145-218960167 CGGGATCCCCCCGACGGCGGCGG + Exonic
1170821614 20:19759109-19759131 GGCGCGCCCCTCGACCGCGCGGG + Intergenic
1175715479 20:61252338-61252360 CGCGCTCGCCGCCCCGGCTCCGG - Intergenic
1175847432 20:62065971-62065993 CGCGGTCTCCGCGCCTGCGCAGG - Intergenic
1175975473 20:62708560-62708582 CGCGCTCCCCGGGGCAGGGCGGG - Intergenic
1176194435 20:63830906-63830928 GGCGCTCCCAGCTGCGGCGCGGG - Intronic
1176619161 21:9043159-9043181 CCCGCCCCCCGCGACTGCGCCGG + Intergenic
1178314787 21:31558941-31558963 CGGGATCTCCGCGACGGGGCCGG + Exonic
1178417021 21:32412521-32412543 CGCGCGCCCCGCGGCTGCCCAGG - Exonic
1183452785 22:37906014-37906036 CGCCCGCCCCTCGACGGCGCCGG - Intronic
1185259530 22:49853851-49853873 CCCGCCGCCCGCGACGCCGCCGG - Exonic
953385080 3:42501831-42501853 CGCTCCCCACGCGAGGGCGCTGG + Intronic
954256539 3:49411611-49411633 CGCGCTTCCGGGGACTGCGCGGG + Intronic
954265947 3:49470411-49470433 CGCGGTCCTCCCGCCGGCGCTGG + Exonic
955387615 3:58492070-58492092 CCCGCGCCCGGCGACGGCGGCGG - Intergenic
956751396 3:72346604-72346626 CACGCTCCCTTCGAAGGCGCTGG - Intergenic
961012875 3:123448000-123448022 CTCGCCGCCCTCGACGGCGCCGG + Exonic
969240345 4:5893039-5893061 CGCGCTCCGCGCCTCGGTGCGGG + Exonic
969417181 4:7068339-7068361 CGCGCGCCCCACCCCGGCGCTGG - Intergenic
972396851 4:38664756-38664778 CGCCCTGCCCGGGACGGCGGCGG - Intronic
972511531 4:39771668-39771690 CGCGCGCGCGGCGACGGCGTCGG + Intronic
973292474 4:48483770-48483792 CGCGCCGCCCGCGAGGCCGCTGG - Exonic
975666858 4:76741341-76741363 CGCGCTCGAAGAGACGGCGCCGG - Exonic
980130415 4:128811749-128811771 CGCGGTCCCCGCGCCGGTTCCGG + Intronic
986695927 5:10354107-10354129 CCCGCCCCCCTCGGCGGCGCGGG - Intronic
990412210 5:55552551-55552573 CGCGCTCCTCGCGAAGGCAGTGG - Intergenic
994083219 5:95731190-95731212 CGCGCTCCCCGCGGAGGCCCCGG - Exonic
1002888969 6:1317395-1317417 CGCGCCCCCCGCGTCGGCCGAGG - Intergenic
1003049418 6:2766056-2766078 CGCGCTCCCCGCCGCGGCGGCGG - Exonic
1003868450 6:10383508-10383530 CACGCTCCCAGCCACGTCGCGGG + Intergenic
1006043280 6:31271928-31271950 GGCCCTCCCGGCGAGGGCGCAGG - Intronic
1006427568 6:33975873-33975895 CTCGCTCCCCGCGCAGACGCGGG - Intergenic
1013106138 6:107028163-107028185 CGCTCTCACTGCGCCGGCGCCGG + Intergenic
1015149237 6:130019894-130019916 GGCGAACGCCGCGACGGCGCGGG - Intronic
1015541428 6:134317827-134317849 CTCGCTCCCCGCGCCGGCCGCGG - Exonic
1020418210 7:7969448-7969470 CCCGCTCCCGGCGGCGGCGACGG - Exonic
1022449830 7:30504531-30504553 CGCGCTACCCACGCCGGGGCCGG - Intronic
1023038362 7:36152740-36152762 CGCCCTCGCCGGCACGGCGCCGG + Intergenic
1026806766 7:73433909-73433931 CCCGCGCCCCGCGACGTGGCGGG + Exonic
1031025203 7:116672266-116672288 CGCGCGGCCCGCGGCGGCCCGGG - Intergenic
1032402898 7:131636301-131636323 TGCGCTCCCCGCGCCAGCACAGG + Intergenic
1034174735 7:149091234-149091256 CGCGCTGCCCGCGGTGGCCCGGG + Intergenic
1035264762 7:157684795-157684817 CTCGGTCCCCGCGCGGGCGCTGG + Intronic
1041648796 8:60281188-60281210 CCCGCGCCCAGCGAAGGCGCAGG - Exonic
1047961771 8:130016377-130016399 CGCGCTCCCCTCGCCCGCCCGGG - Intronic
1049585269 8:143430083-143430105 CGAGGTGCCCCCGACGGCGCCGG + Exonic
1049643782 8:143727203-143727225 CGTGATCCCGGCGGCGGCGCGGG - Exonic
1058176023 9:101737693-101737715 CGTGCGCCCGGCGAGGGCGCCGG + Exonic
1059176797 9:112175339-112175361 CCCGCTTCCCTCGGCGGCGCCGG - Intronic
1059800440 9:117745020-117745042 CGCGCAGCCCGCGAAGGCGCGGG - Intergenic
1061500399 9:130998379-130998401 CGCGCCCCCCTCCACGGCGCTGG + Intergenic
1061540673 9:131276702-131276724 GGCGCTCGCCCCGAGGGCGCCGG - Intergenic
1062346723 9:136118489-136118511 TGCCCTCTCCGCGGCGGCGCCGG + Exonic
1203790971 EBV:151291-151313 TGCGCCCCCCGTGACGGAGCTGG - Intergenic
1186466075 X:9785851-9785873 CGCGCGCCCCGAGACGGAGGAGG + Intronic
1187163913 X:16787146-16787168 TGCGCTCCCCGCCACTGCGCGGG + Intronic
1200093870 X:153648211-153648233 CGGCCTCCCCGCGCCGGCGCCGG - Exonic