ID: 901940003 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 1:12654810-12654832 |
Sequence | AATGATCAAAGGTTAGTCTT AGG (reversed) |
Strand | - |
Crispr in exon? | No |
Crispr in intron? | Yes |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | 431 | |||
Summary | {0: 3, 1: 28, 2: 44, 3: 102, 4: 254} |
Found 8 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
901940003_901940012 | 8 | Left | 901940003 | 1:12654810-12654832 | CCTAAGACTAACCTTTGATCATT | 0: 3 1: 28 2: 44 3: 102 4: 254 |
||
Right | 901940012 | 1:12654841-12654863 | AGACGGCCCTCTCCGGGGTAGGG | 0: 1 1: 0 2: 0 3: 3 4: 56 |
||||
901940003_901940013 | 9 | Left | 901940003 | 1:12654810-12654832 | CCTAAGACTAACCTTTGATCATT | 0: 3 1: 28 2: 44 3: 102 4: 254 |
||
Right | 901940013 | 1:12654842-12654864 | GACGGCCCTCTCCGGGGTAGGGG | 0: 1 1: 0 2: 1 3: 8 4: 73 |
||||
901940003_901940009 | 2 | Left | 901940003 | 1:12654810-12654832 | CCTAAGACTAACCTTTGATCATT | 0: 3 1: 28 2: 44 3: 102 4: 254 |
||
Right | 901940009 | 1:12654835-12654857 | TGGGCAAGACGGCCCTCTCCGGG | 0: 1 1: 1 2: 4 3: 10 4: 128 |
||||
901940003_901940007 | -9 | Left | 901940003 | 1:12654810-12654832 | CCTAAGACTAACCTTTGATCATT | 0: 3 1: 28 2: 44 3: 102 4: 254 |
||
Right | 901940007 | 1:12654824-12654846 | TTGATCATTCATGGGCAAGACGG | 0: 1 1: 2 2: 13 3: 39 4: 171 |
||||
901940003_901940010 | 3 | Left | 901940003 | 1:12654810-12654832 | CCTAAGACTAACCTTTGATCATT | 0: 3 1: 28 2: 44 3: 102 4: 254 |
||
Right | 901940010 | 1:12654836-12654858 | GGGCAAGACGGCCCTCTCCGGGG | 0: 1 1: 0 2: 3 3: 11 4: 87 |
||||
901940003_901940016 | 17 | Left | 901940003 | 1:12654810-12654832 | CCTAAGACTAACCTTTGATCATT | 0: 3 1: 28 2: 44 3: 102 4: 254 |
||
Right | 901940016 | 1:12654850-12654872 | TCTCCGGGGTAGGGGTGACCAGG | 0: 1 1: 0 2: 4 3: 16 4: 145 |
||||
901940003_901940008 | 1 | Left | 901940003 | 1:12654810-12654832 | CCTAAGACTAACCTTTGATCATT | 0: 3 1: 28 2: 44 3: 102 4: 254 |
||
Right | 901940008 | 1:12654834-12654856 | ATGGGCAAGACGGCCCTCTCCGG | 0: 1 1: 0 2: 0 3: 7 4: 208 |
||||
901940003_901940011 | 7 | Left | 901940003 | 1:12654810-12654832 | CCTAAGACTAACCTTTGATCATT | 0: 3 1: 28 2: 44 3: 102 4: 254 |
||
Right | 901940011 | 1:12654840-12654862 | AAGACGGCCCTCTCCGGGGTAGG | 0: 1 1: 0 2: 1 3: 12 4: 86 |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
901940003 | Original CRISPR | AATGATCAAAGGTTAGTCTT AGG (reversed) | Intronic | ||