ID: 901940003

View in Genome Browser
Species Human (GRCh38)
Location 1:12654810-12654832
Sequence AATGATCAAAGGTTAGTCTT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 431
Summary {0: 3, 1: 28, 2: 44, 3: 102, 4: 254}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
901940003_901940012 8 Left 901940003 1:12654810-12654832 CCTAAGACTAACCTTTGATCATT 0: 3
1: 28
2: 44
3: 102
4: 254
Right 901940012 1:12654841-12654863 AGACGGCCCTCTCCGGGGTAGGG 0: 1
1: 0
2: 0
3: 3
4: 56
901940003_901940013 9 Left 901940003 1:12654810-12654832 CCTAAGACTAACCTTTGATCATT 0: 3
1: 28
2: 44
3: 102
4: 254
Right 901940013 1:12654842-12654864 GACGGCCCTCTCCGGGGTAGGGG 0: 1
1: 0
2: 1
3: 8
4: 73
901940003_901940009 2 Left 901940003 1:12654810-12654832 CCTAAGACTAACCTTTGATCATT 0: 3
1: 28
2: 44
3: 102
4: 254
Right 901940009 1:12654835-12654857 TGGGCAAGACGGCCCTCTCCGGG 0: 1
1: 1
2: 4
3: 10
4: 128
901940003_901940007 -9 Left 901940003 1:12654810-12654832 CCTAAGACTAACCTTTGATCATT 0: 3
1: 28
2: 44
3: 102
4: 254
Right 901940007 1:12654824-12654846 TTGATCATTCATGGGCAAGACGG 0: 1
1: 2
2: 13
3: 39
4: 171
901940003_901940010 3 Left 901940003 1:12654810-12654832 CCTAAGACTAACCTTTGATCATT 0: 3
1: 28
2: 44
3: 102
4: 254
Right 901940010 1:12654836-12654858 GGGCAAGACGGCCCTCTCCGGGG 0: 1
1: 0
2: 3
3: 11
4: 87
901940003_901940016 17 Left 901940003 1:12654810-12654832 CCTAAGACTAACCTTTGATCATT 0: 3
1: 28
2: 44
3: 102
4: 254
Right 901940016 1:12654850-12654872 TCTCCGGGGTAGGGGTGACCAGG 0: 1
1: 0
2: 4
3: 16
4: 145
901940003_901940008 1 Left 901940003 1:12654810-12654832 CCTAAGACTAACCTTTGATCATT 0: 3
1: 28
2: 44
3: 102
4: 254
Right 901940008 1:12654834-12654856 ATGGGCAAGACGGCCCTCTCCGG 0: 1
1: 0
2: 0
3: 7
4: 208
901940003_901940011 7 Left 901940003 1:12654810-12654832 CCTAAGACTAACCTTTGATCATT 0: 3
1: 28
2: 44
3: 102
4: 254
Right 901940011 1:12654840-12654862 AAGACGGCCCTCTCCGGGGTAGG 0: 1
1: 0
2: 1
3: 12
4: 86

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
901940003 Original CRISPR AATGATCAAAGGTTAGTCTT AGG (reversed) Intronic