ID: 901940006

View in Genome Browser
Species Human (GRCh38)
Location 1:12654821-12654843
Sequence TCTTGCCCATGAATGATCAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 317
Summary {0: 1, 1: 6, 2: 18, 3: 50, 4: 242}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
901940006_901940018 21 Left 901940006 1:12654821-12654843 CCTTTGATCATTCATGGGCAAGA 0: 1
1: 6
2: 18
3: 50
4: 242
Right 901940018 1:12654865-12654887 TGACCAGGTTAATTACCCACAGG 0: 7
1: 10
2: 11
3: 22
4: 56
901940006_901940016 6 Left 901940006 1:12654821-12654843 CCTTTGATCATTCATGGGCAAGA 0: 1
1: 6
2: 18
3: 50
4: 242
Right 901940016 1:12654850-12654872 TCTCCGGGGTAGGGGTGACCAGG 0: 1
1: 0
2: 4
3: 16
4: 145
901940006_901940012 -3 Left 901940006 1:12654821-12654843 CCTTTGATCATTCATGGGCAAGA 0: 1
1: 6
2: 18
3: 50
4: 242
Right 901940012 1:12654841-12654863 AGACGGCCCTCTCCGGGGTAGGG 0: 1
1: 0
2: 0
3: 3
4: 56
901940006_901940010 -8 Left 901940006 1:12654821-12654843 CCTTTGATCATTCATGGGCAAGA 0: 1
1: 6
2: 18
3: 50
4: 242
Right 901940010 1:12654836-12654858 GGGCAAGACGGCCCTCTCCGGGG 0: 1
1: 0
2: 3
3: 11
4: 87
901940006_901940011 -4 Left 901940006 1:12654821-12654843 CCTTTGATCATTCATGGGCAAGA 0: 1
1: 6
2: 18
3: 50
4: 242
Right 901940011 1:12654840-12654862 AAGACGGCCCTCTCCGGGGTAGG 0: 1
1: 0
2: 1
3: 12
4: 86
901940006_901940008 -10 Left 901940006 1:12654821-12654843 CCTTTGATCATTCATGGGCAAGA 0: 1
1: 6
2: 18
3: 50
4: 242
Right 901940008 1:12654834-12654856 ATGGGCAAGACGGCCCTCTCCGG 0: 1
1: 0
2: 0
3: 7
4: 208
901940006_901940013 -2 Left 901940006 1:12654821-12654843 CCTTTGATCATTCATGGGCAAGA 0: 1
1: 6
2: 18
3: 50
4: 242
Right 901940013 1:12654842-12654864 GACGGCCCTCTCCGGGGTAGGGG 0: 1
1: 0
2: 1
3: 8
4: 73
901940006_901940009 -9 Left 901940006 1:12654821-12654843 CCTTTGATCATTCATGGGCAAGA 0: 1
1: 6
2: 18
3: 50
4: 242
Right 901940009 1:12654835-12654857 TGGGCAAGACGGCCCTCTCCGGG 0: 1
1: 1
2: 4
3: 10
4: 128

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
901940006 Original CRISPR TCTTGCCCATGAATGATCAA AGG (reversed) Intronic