ID: 901940011 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 1:12654840-12654862 |
| Sequence | AAGACGGCCCTCTCCGGGGT AGG |
| Strand | + |
| Crispr in exon? | No |
| Crispr in intron? | Yes |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | 100 | |||
| Summary | {0: 1, 1: 0, 2: 1, 3: 12, 4: 86} |
Found 2 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 901940006_901940011 | -4 | Left | 901940006 | 1:12654821-12654843 | CCTTTGATCATTCATGGGCAAGA | 0: 1 1: 6 2: 18 3: 50 4: 242 |
||
| Right | 901940011 | 1:12654840-12654862 | AAGACGGCCCTCTCCGGGGTAGG | 0: 1 1: 0 2: 1 3: 12 4: 86 |
||||
| 901940003_901940011 | 7 | Left | 901940003 | 1:12654810-12654832 | CCTAAGACTAACCTTTGATCATT | 0: 3 1: 28 2: 44 3: 102 4: 254 |
||
| Right | 901940011 | 1:12654840-12654862 | AAGACGGCCCTCTCCGGGGTAGG | 0: 1 1: 0 2: 1 3: 12 4: 86 |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 901940011 | Original CRISPR | AAGACGGCCCTCTCCGGGGT AGG | Intronic | ||