ID: 901940011

View in Genome Browser
Species Human (GRCh38)
Location 1:12654840-12654862
Sequence AAGACGGCCCTCTCCGGGGT AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 100
Summary {0: 1, 1: 0, 2: 1, 3: 12, 4: 86}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
901940006_901940011 -4 Left 901940006 1:12654821-12654843 CCTTTGATCATTCATGGGCAAGA 0: 1
1: 6
2: 18
3: 50
4: 242
Right 901940011 1:12654840-12654862 AAGACGGCCCTCTCCGGGGTAGG 0: 1
1: 0
2: 1
3: 12
4: 86
901940003_901940011 7 Left 901940003 1:12654810-12654832 CCTAAGACTAACCTTTGATCATT 0: 3
1: 28
2: 44
3: 102
4: 254
Right 901940011 1:12654840-12654862 AAGACGGCCCTCTCCGGGGTAGG 0: 1
1: 0
2: 1
3: 12
4: 86

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
901940011 Original CRISPR AAGACGGCCCTCTCCGGGGT AGG Intronic