ID: 901940443

View in Genome Browser
Species Human (GRCh38)
Location 1:12657749-12657771
Sequence TGGGTGTCCCAGAACTGCCA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 212
Summary {0: 1, 1: 0, 2: 0, 3: 19, 4: 192}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
901940441_901940443 -6 Left 901940441 1:12657732-12657754 CCATTCTGGGACCAAAATGGGTG 0: 1
1: 0
2: 2
3: 11
4: 130
Right 901940443 1:12657749-12657771 TGGGTGTCCCAGAACTGCCATGG 0: 1
1: 0
2: 0
3: 19
4: 192
901940437_901940443 0 Left 901940437 1:12657726-12657748 CCACACCCATTCTGGGACCAAAA 0: 1
1: 0
2: 0
3: 13
4: 176
Right 901940443 1:12657749-12657771 TGGGTGTCCCAGAACTGCCATGG 0: 1
1: 0
2: 0
3: 19
4: 192
901940440_901940443 -5 Left 901940440 1:12657731-12657753 CCCATTCTGGGACCAAAATGGGT 0: 1
1: 0
2: 0
3: 10
4: 143
Right 901940443 1:12657749-12657771 TGGGTGTCCCAGAACTGCCATGG 0: 1
1: 0
2: 0
3: 19
4: 192

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
901940443 Original CRISPR TGGGTGTCCCAGAACTGCCA TGG Intronic
900319535 1:2075757-2075779 TGGGTGCCCCAGACCTTCCACGG + Intronic
900457943 1:2786404-2786426 TGGGGGTCCCACAGCGGCCAGGG + Intronic
900659100 1:3774046-3774068 CGGGAGTCTCAGAACTGCCTGGG + Intronic
901229924 1:7636055-7636077 TTGGTCTCCTGGAACTGCCAGGG + Intronic
901934650 1:12619036-12619058 TGGGTCTCCCTGGACTGCCCTGG + Intergenic
901940443 1:12657749-12657771 TGGGTGTCCCAGAACTGCCATGG + Intronic
902005332 1:13227379-13227401 TAGGTGTCCCAGACCAGCCTAGG + Intergenic
902024613 1:13373476-13373498 TAGGTGTCCCAGACCAGCCTAGG + Intergenic
902109672 1:14067755-14067777 TGGTTGCCCCAGAACTTTCAAGG - Intergenic
902437278 1:16406531-16406553 TGGGAGTCCGAGAACAGCCTGGG + Intronic
902627035 1:17682829-17682851 TGGGCCTCCCAGACCAGCCAAGG + Intronic
902895200 1:19474951-19474973 TGCGAGGCCCAGAACTGACAAGG + Intronic
903650106 1:24916945-24916967 TGGGTCTCCCAGACCTGAGATGG - Intronic
905925239 1:41745052-41745074 TGGGGGTCCCAGCACTATCAAGG + Intronic
906489528 1:46257449-46257471 TGTGTGGACCAGAACTTCCATGG + Intronic
907318263 1:53586406-53586428 TGGAAGTCCCAGCTCTGCCATGG - Intronic
908267999 1:62397221-62397243 AGGCTATCCCAGCACTGCCAAGG + Intergenic
909181740 1:72433023-72433045 AGGCTGCCACAGAACTGCCACGG + Intergenic
909433782 1:75617035-75617057 CTGGCGTCCCAGAACTGCAAGGG + Intergenic
911164717 1:94714345-94714367 TGGGTCTCCCCGCACTGCCCTGG - Intergenic
912536109 1:110373308-110373330 TGGCTGTCCCAGTAGTGCCTTGG - Intronic
915145924 1:153795663-153795685 TGCGTGGCCCAGAACCGCTACGG + Intergenic
915598002 1:156906298-156906320 TGGGTGCCACACAACGGCCATGG - Exonic
915599620 1:156914010-156914032 TGGCTGTCCCAGAACTGAGGAGG - Exonic
915801169 1:158794940-158794962 TGGGTGTCCCAAAGCTCCCATGG + Intergenic
916473252 1:165143907-165143929 AGGGTGCTCAAGAACTGCCAAGG - Intergenic
922991418 1:229916024-229916046 TGGTTTTCCCAGAATAGCCATGG + Intergenic
923021013 1:230163907-230163929 TGTCTGTCCCAGAACTGGCCGGG + Intronic
924508706 1:244710680-244710702 TGGGTGTCACAGAAATACCCTGG + Intergenic
1067294386 10:44966653-44966675 TGGGTGTTCTGGAACTGTCATGG + Intronic
1067419739 10:46135035-46135057 TGGGACTCCCAGAACCCCCATGG - Intergenic
1067426279 10:46214376-46214398 TGGGACTCCCAGAACCCCCATGG + Intergenic
1067505090 10:46841632-46841654 TGGGACTCCCAGAACCCCCATGG - Intergenic
1068872897 10:61964220-61964242 AGGGTGTCCAGGAACTCCCAAGG + Intronic
1069632015 10:69902818-69902840 TGGGGCACCCAGGACTGCCAGGG + Exonic
1069952123 10:72026206-72026228 AGGGTATCCCAGAAGAGCCATGG + Intergenic
1070428514 10:76313106-76313128 TTTGTGTCCCAGCTCTGCCAAGG + Intronic
1070672926 10:78390500-78390522 GGGCTTTCCCAGGACTGCCAGGG + Intergenic
1072325007 10:94288996-94289018 TGAGTAACCCAGAACAGCCATGG - Intronic
1072443568 10:95478681-95478703 TGGGGGTCCCAGAACTGTGTTGG - Intronic
1072466646 10:95669568-95669590 GGGGTGTCTCAGACCTTCCATGG + Intronic
1073032004 10:100534126-100534148 TGGGTGTTCCAGATCAGCCTGGG - Intronic
1075403453 10:122177780-122177802 TGGCCCTTCCAGAACTGCCATGG + Intronic
1075893765 10:125977536-125977558 TGGGCATCCCAGGAGTGCCAAGG - Intronic
1076139655 10:128069006-128069028 TGAGTATCACAGCACTGCCAGGG + Intronic
1077181815 11:1220300-1220322 TGAGGGTCCCAGCTCTGCCATGG + Intergenic
1077333848 11:1994719-1994741 TGGGCCTCCCAGAGCGGCCATGG + Intergenic
1077991990 11:7420293-7420315 TGGCTGTCCTAAAACTGACATGG - Intronic
1078900068 11:15633683-15633705 TGGGTCCTCCTGAACTGCCAAGG - Intergenic
1081584684 11:44376344-44376366 TGGATTTCCCAGCCCTGCCAGGG - Intergenic
1081786957 11:45754382-45754404 TGCTTGTCCCAGTGCTGCCATGG - Intergenic
1081906465 11:46673508-46673530 TGTGTGTCCCCCAACTGCCTGGG + Intronic
1083184917 11:61012022-61012044 TGGGTATCCCAGGACTGCAAAGG - Intronic
1084230649 11:67750216-67750238 TGGGTGTTCGAGACCAGCCAGGG + Intergenic
1084506663 11:69572723-69572745 GGGGTGTTCCATAACTGCCTGGG + Intergenic
1084938031 11:72597556-72597578 TGGGCTTCTCAGACCTGCCAGGG - Exonic
1085036794 11:73305765-73305787 TTTCTGTCCCAGAACTGACAGGG + Intergenic
1085048014 11:73364448-73364470 TGGGGGTCCCAGAAATGGCCTGG - Exonic
1085351062 11:75798101-75798123 TGGGTGTACCAGAATTACCTGGG - Intronic
1086398776 11:86443677-86443699 TGTGTGTCTCAGAAGTGACAAGG + Intronic
1087396486 11:97607497-97607519 TGTGTGTGCCAGAACTGTTATGG - Intergenic
1087693844 11:101353205-101353227 TCTGTGTGCCAAAACTGCCAAGG + Intergenic
1089853820 11:121523057-121523079 TTTGTGTCCCTGAAATGCCAAGG - Intronic
1202816831 11_KI270721v1_random:49901-49923 TGGGCCTCCCAGAGCGGCCATGG + Intergenic
1092961765 12:13602705-13602727 TGGGTTTCCAAGAAGTCCCATGG - Intronic
1093464086 12:19432811-19432833 TGGGAGTCCCAGAAGGGCAAGGG - Intronic
1094793702 12:33945446-33945468 TGGGTATCCCAGAAATGCCTTGG - Intergenic
1102298347 12:111754153-111754175 TGGGTGGCCCTGGACTCCCAGGG + Intronic
1103893301 12:124255955-124255977 TGGGTGTCCCAATATAGCCAGGG - Intronic
1104074101 12:125374144-125374166 TGTGTGTCACACATCTGCCAAGG - Intronic
1107694992 13:42991683-42991705 TGGGTGTGTCGGAACTGCCTAGG - Intronic
1110799698 13:79680714-79680736 TGGTTGTCCCAGAACTCCACAGG - Intergenic
1111119318 13:83824547-83824569 TGGGTGTCACAGCACTGGCTTGG - Intergenic
1113919885 13:113901293-113901315 TGGATGAGCCAGAACTGCCTTGG - Intergenic
1116330894 14:43596636-43596658 TGGGTTTTGAAGAACTGCCACGG - Intergenic
1117237781 14:53796938-53796960 TGGGTGTGGCAGAACTGACAAGG - Intergenic
1121528713 14:94637898-94637920 TGGGTGTCCTGGAATTGCAATGG - Intergenic
1122783691 14:104154396-104154418 TGGGTGGCCCAGGGCTCCCAGGG + Intronic
1124220875 15:27848544-27848566 TGGGTGTGCCAGGACAGGCAGGG - Intronic
1124322454 15:28725400-28725422 TGGGAGTTCCAGACCTGCCTGGG + Intronic
1124400159 15:29340979-29341001 TGTGTGTCCCAGCTCTCCCATGG - Intronic
1125598708 15:40903784-40903806 TAGGTGTCCCAGAAGTGAGAAGG + Exonic
1126256804 15:46636830-46636852 TGTGTGACCCCAAACTGCCACGG + Intergenic
1128455570 15:67829655-67829677 TGGGTACCCCAGAAGCGCCAGGG + Intronic
1129675787 15:77632029-77632051 CGGGTGTCCCAGACCTGCTCTGG - Intronic
1131064011 15:89421700-89421722 GGGGTGTCCTGGGACTGCCAAGG + Intergenic
1132652375 16:1027380-1027402 TGGGCCTCCCAGAACCTCCATGG - Intergenic
1132684269 16:1155746-1155768 TGTGTGTCTCAGGACTTCCAAGG + Intronic
1132985804 16:2766942-2766964 TGGGTGTTCTAGAGCTGCCAAGG - Exonic
1135632868 16:24049544-24049566 TGCATGTCCCAGATGTGCCAGGG - Intronic
1136288345 16:29257407-29257429 TGGTTTTCCCAGAAATTCCAAGG + Intergenic
1136346164 16:29677547-29677569 TTCCTGTCCAAGAACTGCCAGGG - Intronic
1138559061 16:57789167-57789189 TGGGACCCCCAGGACTGCCAAGG + Intronic
1139336023 16:66231834-66231856 AGGGTCCCCCAGAACTGCCTGGG - Intergenic
1141636542 16:85316941-85316963 TGGGTTCCCCAAAAGTGCCAGGG - Intergenic
1142094026 16:88230188-88230210 TGGTTTTCCCAGAAATTCCAAGG + Intergenic
1143764687 17:9129823-9129845 TGGTGGTCCCAGACCTGGCAAGG + Intronic
1145235958 17:21208621-21208643 TGGGTCTCTCAGAACTGGGAAGG - Intronic
1146599931 17:34205411-34205433 TGGTTCTCCCAGAACTGCAGAGG - Intergenic
1146806988 17:35872498-35872520 TGGCTGTCCCGGTACTGACAAGG - Intronic
1148337006 17:46848691-46848713 TGGCTGGCTCAGAACTGCCCAGG - Intronic
1148775256 17:50091676-50091698 TGGGTCTCCCAGAACAGCCTGGG - Intergenic
1148811460 17:50295089-50295111 AGGATGTCCCAGACATGCCATGG - Intergenic
1148991516 17:51670502-51670524 TTGGTGTCCCAGAGATTCCAGGG - Intronic
1152424687 17:80212511-80212533 GGGGTGACACAGAAGTGCCAAGG - Intronic
1152693117 17:81730288-81730310 TGCGTGACCCAGCTCTGCCAAGG - Intergenic
1152734549 17:81991045-81991067 TGGGTGACCGAGACCTGCCGTGG + Intronic
1154339254 18:13489480-13489502 AGGGTGTCCTGGAACTGTCATGG + Intronic
1156600411 18:38598908-38598930 TCTGTGTCCCAGCCCTGCCAGGG - Intergenic
1159194929 18:65101147-65101169 TGAGTGAACCAGAAGTGCCAAGG + Intergenic
1160589577 18:79935722-79935744 TGGGTGTCCCAGCAGAGCCTGGG + Intronic
1160852546 19:1199863-1199885 TGGGAGTCCCAGAGCCACCAGGG + Intronic
1162528827 19:11223475-11223497 TGGGTGCCGGGGAACTGCCAGGG + Intronic
1163276481 19:16287660-16287682 TGGGTGACCATGAACTCCCAGGG + Intergenic
1163402139 19:17100674-17100696 TGGTGGTCCCAAGACTGCCAAGG - Intronic
1163593167 19:18205381-18205403 TGGGCGTCCCAGTACTCCCAGGG - Intergenic
1165113758 19:33516600-33516622 AGGGTGTCCCAGTACTGATACGG - Intronic
1166049455 19:40249333-40249355 TGCGTGTGCCAAAGCTGCCATGG + Intronic
1167424505 19:49423184-49423206 TGCCAGTCCCAGAACTCCCAGGG - Intronic
1167444272 19:49528223-49528245 GGGGGGTCCCAGACCTGCCAGGG - Intronic
1168538713 19:57192587-57192609 TGGGTCTCCCAGATCCCCCAAGG - Intronic
925304852 2:2840833-2840855 TGGCTGCTCCAGAACTGCCATGG + Intergenic
926062663 2:9813880-9813902 TAAGTGCCCCAGCACTGCCATGG + Intergenic
927101606 2:19791777-19791799 AGGGTGTCCCAAAACTCTCAAGG - Intergenic
929792439 2:45033526-45033548 TGAGTGTCCCAGAAGAACCAGGG - Intergenic
931053572 2:58441653-58441675 TGGTGGTCCCAGGACTCCCAAGG + Intergenic
931464633 2:62475492-62475514 TGGGAAACCCAGAACCGCCAGGG - Intergenic
933666503 2:84969632-84969654 TGGGTCACTCAGAACTCCCAAGG - Intergenic
935428077 2:102942323-102942345 TGGGTGTCCCAGATCTGAGTTGG + Intergenic
935615380 2:105074695-105074717 TGTGTGTGCCACAACTGCCTGGG - Intronic
936462570 2:112723666-112723688 TGGGACTCCCAGAGCTGCCCTGG - Intronic
937529303 2:122808962-122808984 TGGGGGTCCTAGAACTCCCAAGG - Intergenic
940906026 2:159170733-159170755 TTGGTGGCCCTGAGCTGCCACGG + Exonic
943972330 2:194426865-194426887 TGGGTTTCCCAGGACAGTCAGGG - Intergenic
947739083 2:232476749-232476771 TGGGTATCCCAGAAATCCCAGGG + Intergenic
948364231 2:237444380-237444402 TGTGTCTCTCAGAACTGCCCAGG + Intergenic
1172363983 20:34334893-34334915 TGGGTGACCCAGGCCTGCCCTGG + Intergenic
1173208248 20:41011642-41011664 TGGCAGTTCCAGAAATGCCATGG + Intergenic
1175033214 20:55975264-55975286 TGCGTTTCCCAGCACTGCCTTGG - Intergenic
1175999611 20:62826013-62826035 TGGGGGTCCCACCTCTGCCAAGG + Intronic
1176410890 21:6448873-6448895 TGGGTGTCTCAGGACAACCACGG + Intergenic
1178214859 21:30583835-30583857 TGAGTGTCCCAGAGCTGGCAAGG + Intergenic
1179686383 21:43057195-43057217 TGGGTGTCTCAGGACAACCACGG + Intronic
1180786416 22:18550154-18550176 GGGGGACCCCAGAACTGCCACGG + Intergenic
1181131696 22:20735873-20735895 GGGGGACCCCAGAACTGCCATGG + Intronic
1181243337 22:21489707-21489729 GGGGGACCCCAGAACTGCCACGG + Intergenic
949145090 3:690614-690636 TGGGGGCCCCACATCTGCCATGG + Intergenic
950602759 3:14049364-14049386 TGGGGGTCCCTGTACTACCAGGG + Intronic
954671586 3:52294009-52294031 TGGGGGTCCCAGCACTGGGATGG + Intergenic
955137529 3:56234534-56234556 TGAATGTCCCAGAAATTCCAGGG - Intronic
957775733 3:84756035-84756057 TTGGTGGCCCACACCTGCCAAGG + Intergenic
958419124 3:93911774-93911796 ACAGTGTCCCATAACTGCCATGG - Intronic
960533339 3:118789559-118789581 TGGGTGTCTCAGAGTTCCCAAGG - Intergenic
960923473 3:122773057-122773079 TGGGAGTTCCAGAACAGCCTGGG - Intronic
961152571 3:124651844-124651866 TAGGAGTCCCAGACCAGCCAGGG - Intronic
962455305 3:135559904-135559926 TGGATCTCCTAGAACTTCCATGG - Intergenic
968486357 4:864885-864907 TTGGTGTCCCAGAGCTGCAGTGG - Intronic
968644854 4:1735361-1735383 AGGGTGTCCGAGAGCAGCCACGG + Intronic
969965987 4:10995928-10995950 TAGGTGGCCAAGAACTCCCAGGG + Intergenic
971599400 4:28573059-28573081 TGTGTCTCCCAGAATTCCCACGG + Intergenic
972766235 4:42153823-42153845 TGGGAGTCCAGGAACTGTCAGGG + Intergenic
972782649 4:42299614-42299636 TGGGTGTTCAAGAACAGCCTGGG + Intergenic
980682218 4:136178043-136178065 TGAGTGTTCCAGAATTGCAAAGG + Intergenic
982665092 4:158251674-158251696 GGGTGGTCCCAGAACTGTCATGG - Intronic
985061211 4:186081395-186081417 AGTGAGTCCCAGAACAGCCAAGG + Intronic
991017731 5:61949543-61949565 TTTGTGCCCCAGAACTCCCACGG + Intergenic
994730910 5:103489487-103489509 TGGGTGTGAGAGAATTGCCAGGG + Intergenic
1001898832 5:175405375-175405397 TGGATGTCCCAGTTCTGACAGGG + Intergenic
1005820976 6:29598926-29598948 AGGGTGTCCTAAAACTACCAAGG + Intronic
1005907389 6:30276085-30276107 TCGATGTGCCAGAGCTGCCATGG + Intergenic
1007622112 6:43221619-43221641 GGGGTGTGCCAGGAATGCCAAGG - Intronic
1011801064 6:91016918-91016940 TGGGTGGCCCAAAACTTCCTGGG - Intergenic
1017658878 6:156654945-156654967 TGGGTGTCCTAGTACTGTCAGGG - Intergenic
1017717352 6:157222235-157222257 AGGGTGACCCAGGACTTCCAGGG - Intergenic
1018096354 6:160390400-160390422 TCTGTGTCTCAGAACAGCCATGG + Intronic
1018626692 6:165786251-165786273 TGAGTGTCCCAGAAGTTCAAAGG + Intronic
1019270345 7:143627-143649 AGGGGGTCCCAGCCCTGCCAGGG + Intergenic
1019566197 7:1680214-1680236 GGGGTGTTCCAGCACTGCCCTGG - Intergenic
1019972201 7:4550122-4550144 TTGGTGTCCCAGACATGCCATGG - Intergenic
1022904709 7:34844537-34844559 TGGGTGTCTCAGCATAGCCAGGG + Intronic
1023082177 7:36536086-36536108 TGGGTGTCTCACTCCTGCCAGGG - Intronic
1024157206 7:46638039-46638061 TGGCTTTCCCAGTTCTGCCAGGG - Intergenic
1027472104 7:78586250-78586272 TTAGTGTCTCAGAACTGACAAGG + Intronic
1027990550 7:85354831-85354853 TGCAAGTCCCAGAACTGCAATGG - Intergenic
1028834955 7:95364692-95364714 TTGGTGGCTCAAAACTGCCAAGG - Intronic
1029155501 7:98514593-98514615 TGGGTGTCCCAGAAATATCCTGG + Intergenic
1029633427 7:101767843-101767865 TGGGTTTCCCTGCACAGCCAGGG - Intergenic
1032489065 7:132310395-132310417 TGGTGTTCCCAGAGCTGCCAGGG - Intronic
1033210524 7:139456979-139457001 TGTGTATCCCAGAAGTGTCACGG + Intronic
1038209648 8:25504320-25504342 TGGGTGTCCCTGAGTTGCCCAGG + Intronic
1038642948 8:29342093-29342115 TGGGTGGCCCAGGAGTGCCAGGG + Intronic
1039345292 8:36696985-36697007 CAGGTGTCCCAGACCAGCCAAGG - Intergenic
1041567533 8:59296906-59296928 TGTGTGTTCCAGAACTTGCAGGG - Intergenic
1043387788 8:79765498-79765520 TTGCTGCCCCAGAACGGCCACGG - Exonic
1049706544 8:144045826-144045848 TGGGCTTCCCACAACTGCCCAGG + Intronic
1053462208 9:38279723-38279745 TGGGTGTTCCAGAACTGTTATGG + Intergenic
1057279079 9:93697585-93697607 TGCCTGTCCTAAAACTGCCAGGG + Intergenic
1061660479 9:132126865-132126887 TCGGGGTCCCAGGACAGCCAGGG - Intergenic
1062019024 9:134307514-134307536 TGCCTGCCCCAGAACTGCCCTGG + Intergenic
1062317962 9:135977728-135977750 TGGGTGTCCCAGGGCTGCTGGGG - Intergenic
1062318099 9:135978079-135978101 GGGGTGTCCCAGAGCTGCTGAGG - Intergenic
1062724649 9:138065015-138065037 TGAGGGTGCCAGAACTGCCTTGG - Intronic
1187070994 X:15888233-15888255 TGGGTGTCCAGGAAGTGCCAGGG - Intergenic
1193224124 X:78961474-78961496 AGCGGGTCACAGAACTGCCATGG - Exonic
1196580697 X:117375733-117375755 TGGGAGGCCTAGAACTGACAGGG + Intergenic
1196683244 X:118489992-118490014 TGAGGGTCCCTGAATTGCCAAGG - Intergenic
1198109211 X:133487850-133487872 TGGGGGTCCCAGACATGCCATGG + Intergenic
1198330512 X:135618356-135618378 TGGGTGGGCCAGACCTGGCAGGG + Intergenic
1198336416 X:135670640-135670662 TGGGTGGGCCAGACCTGGCAGGG - Intergenic
1198363213 X:135915982-135916004 TGGGTGGGCCAGACCTGGCAGGG + Intergenic
1198427596 X:136535601-136535623 AGGTTGGCCCAGAACTACCATGG - Intronic
1201865840 Y:18653321-18653343 TAGGAGTTCCAGAACTGCCTGGG + Intergenic