ID: 901941821

View in Genome Browser
Species Human (GRCh38)
Location 1:12668061-12668083
Sequence CACCTATGACTGATGGAGGA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 179
Summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 170}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
901941813_901941821 9 Left 901941813 1:12668029-12668051 CCAACCATAGCCTCAGTGGGTAC 0: 1
1: 0
2: 1
3: 6
4: 93
Right 901941821 1:12668061-12668083 CACCTATGACTGATGGAGGAGGG 0: 1
1: 0
2: 0
3: 8
4: 170
901941812_901941821 10 Left 901941812 1:12668028-12668050 CCCAACCATAGCCTCAGTGGGTA 0: 1
1: 0
2: 0
3: 7
4: 74
Right 901941821 1:12668061-12668083 CACCTATGACTGATGGAGGAGGG 0: 1
1: 0
2: 0
3: 8
4: 170
901941814_901941821 5 Left 901941814 1:12668033-12668055 CCATAGCCTCAGTGGGTACCAAC 0: 1
1: 0
2: 1
3: 5
4: 100
Right 901941821 1:12668061-12668083 CACCTATGACTGATGGAGGAGGG 0: 1
1: 0
2: 0
3: 8
4: 170
901941815_901941821 -1 Left 901941815 1:12668039-12668061 CCTCAGTGGGTACCAACGACCTC 0: 1
1: 1
2: 0
3: 4
4: 73
Right 901941821 1:12668061-12668083 CACCTATGACTGATGGAGGAGGG 0: 1
1: 0
2: 0
3: 8
4: 170

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
901941821 Original CRISPR CACCTATGACTGATGGAGGA GGG Intergenic
901941821 1:12668061-12668083 CACCTATGACTGATGGAGGAGGG + Intergenic
905421796 1:37851717-37851739 CAGTAATCACTGATGGAGGATGG + Intronic
909126459 1:71677212-71677234 CATCAATGAATCATGGAGGATGG - Intronic
912495545 1:110089139-110089161 CACCTAAGACTGTTGAGGGAGGG + Intergenic
918359913 1:183746802-183746824 CACCTAGGCCTGTTGGGGGATGG - Intronic
922881997 1:228988015-228988037 CACGCATGACTGTTGGAGGGTGG + Intergenic
922955452 1:229595508-229595530 CAGCTAAAACTGATGGATGAAGG - Intronic
923305398 1:232683566-232683588 CAGCTCTGAGTGATGGAGTAGGG - Intergenic
1066072954 10:31838916-31838938 CACCTAAGCCTGGTGGGGGAGGG + Intronic
1070700037 10:78595264-78595286 CAGTTTTGACTGATGGAGGGTGG + Intergenic
1071505190 10:86227765-86227787 CACCCATGATGGAGGGAGGATGG - Intronic
1073657253 10:105430011-105430033 CACTTACAACTGGTGGAGGAAGG - Intergenic
1074885366 10:117689040-117689062 CAACTCTGAGAGATGGAGGAGGG - Intergenic
1077987171 11:7364862-7364884 CAGCTGTGACAGATGGATGAGGG + Intronic
1080816929 11:35767390-35767412 AACCTGTGACTGACAGAGGAGGG - Intronic
1083541582 11:63515317-63515339 CATCTATGACTACAGGAGGATGG - Intronic
1089640477 11:119844420-119844442 CACCTACTTCTCATGGAGGAGGG + Intergenic
1090945059 11:131422101-131422123 CTACTTTGCCTGATGGAGGAAGG + Intronic
1093005849 12:14049969-14049991 GACCTATGACCTATGGATGAAGG + Intergenic
1094069538 12:26397646-26397668 CACCTACAACTGTTGGAGGAAGG + Intronic
1095924842 12:47568120-47568142 CAGCTATGAGTGTTGGAGTAAGG + Intergenic
1096510220 12:52123735-52123757 CAGCTTTGGCTGAGGGAGGATGG - Intergenic
1100392130 12:94152750-94152772 TACCTATGGCTGATTGAAGACGG - Intronic
1103091653 12:118102398-118102420 CACCCATGACTGAAGGTGGCGGG + Intronic
1104706541 12:130951691-130951713 CCCCGATGGCTGATGGGGGAGGG - Intergenic
1104724211 12:131066152-131066174 CTCCTATGACTGCTGGAGTCAGG - Intronic
1109041734 13:57347425-57347447 AACCTAGGACAGATGGATGATGG + Intergenic
1109159286 13:58951895-58951917 CTCCTATGGTTGCTGGAGGAAGG - Intergenic
1110559464 13:76894899-76894921 AACCTCTGACTCATGCAGGAAGG - Intergenic
1114598875 14:23937618-23937640 AACCAATGACTGATGGGGGTGGG - Intergenic
1117522582 14:56565690-56565712 GACTAAGGACTGATGGAGGATGG + Intronic
1118177433 14:63455480-63455502 GACCTAGGAGTGATGGGGGAAGG - Intronic
1118765461 14:68906649-68906671 CACCCATGGCTGCTGCAGGAAGG + Intronic
1119913769 14:78376216-78376238 CATATATGAGTGATGCAGGATGG + Intronic
1120763357 14:88305929-88305951 AACCAATAACTGATGGAAGATGG - Intronic
1121347891 14:93149621-93149643 AACCTTTGACTGATGGGAGATGG - Intergenic
1123920780 15:25068343-25068365 CACCTGTGACTGATGCTGGAAGG - Intergenic
1124826011 15:33096516-33096538 TACTAATGACTGGTGGAGGAAGG - Intronic
1125239577 15:37558452-37558474 CACCCATGTCTGATGGGGGAGGG - Intergenic
1127912403 15:63428225-63428247 CACCAATGACTGATGGAAGTTGG - Intergenic
1128703538 15:69821743-69821765 CACCTAGGACTGGTGGGGAAGGG + Intergenic
1129246184 15:74280321-74280343 CACCCATCAGTGATGGGGGAGGG + Intronic
1130150720 15:81309499-81309521 CAGCTCTAACTGATGGAGTATGG - Exonic
1131406422 15:92168629-92168651 CACCTAAGACTGCTGTAGCATGG + Intronic
1134097565 16:11428793-11428815 CACCTCTGACAGATGGAGAGTGG + Intronic
1134784913 16:16933704-16933726 CACCCATGACTGATAGCTGATGG + Intergenic
1137379498 16:47984188-47984210 CATCTATGACTGAGGGTGGCCGG + Intergenic
1138240478 16:55423645-55423667 AACCGATGACTGATGGGAGATGG - Intronic
1141790017 16:86228024-86228046 CTCCTCTGGCTGATTGAGGACGG - Intergenic
1146055156 17:29577285-29577307 CCCTTATGACTGACGCAGGACGG + Intronic
1148040783 17:44705306-44705328 CACCTATGAGTAATGGGGAAAGG - Intergenic
1148394306 17:47295910-47295932 GGCCAATGACTGATGGAGAAGGG + Intronic
1148711414 17:49684086-49684108 AACCAATGGCTGGTGGAGGAAGG + Intergenic
1153358785 18:4169887-4169909 TAGCTATGAATGATGGAGCAAGG - Intronic
1153605703 18:6829106-6829128 TACATTTCACTGATGGAGGATGG - Intronic
1153762308 18:8343439-8343461 CATCTATGACTTCTGGAGGATGG + Exonic
1156526101 18:37768738-37768760 CACCAAAGACTGTAGGAGGAAGG + Intergenic
1158295038 18:55986806-55986828 GACCTATGACTAATGGAGAAAGG + Intergenic
1159379639 18:67639850-67639872 GACGTATTACTGATGGATGAGGG - Intergenic
1161093486 19:2375466-2375488 GACCAATCACTGATGGGGGATGG + Intergenic
1166250623 19:41567992-41568014 CACCTATGTCTGTAGGATGAAGG - Intronic
1166297108 19:41894798-41894820 CACCTGGGTCTGAGGGAGGAGGG + Intronic
1166297248 19:41895181-41895203 CTCCTGTGTCTGAGGGAGGAGGG + Intronic
1166531556 19:43546318-43546340 CTCCTGTGTCTGAGGGAGGAAGG - Intronic
1166546204 19:43636013-43636035 CTCCTGGGTCTGATGGAGGAGGG - Intronic
1166568809 19:43780649-43780671 CTCCTAGGTCTGAGGGAGGAGGG - Intronic
1166569552 19:43784963-43784985 CTCCTAGGTCTGAGGGAGGAGGG + Intergenic
1166679054 19:44756487-44756509 CTCCTGGGTCTGATGGAGGAGGG + Intronic
1166687050 19:44801871-44801893 CTCCTAGGTCTGAGGGAGGAGGG - Intergenic
1167248843 19:48390337-48390359 CTCCTAGGTCTGAGGGAGGAGGG - Intronic
1167264896 19:48478604-48478626 CTCCTGGGCCTGATGGAGGAGGG + Intronic
1167264910 19:48478640-48478662 CTCCTGGGTCTGATGGAGGAGGG + Intronic
1167264962 19:48478784-48478806 CACCTGGGTCTGACGGAGGAGGG + Intronic
1167314266 19:48754930-48754952 CTCCTAAGTCTGAGGGAGGAGGG - Intronic
1167327696 19:48835640-48835662 CTCCTAGGTCTGAGGGAGGAGGG + Intronic
1167328200 19:48837652-48837674 CTCCTGGGTCTGATGGAGGAGGG - Intronic
1167596899 19:50432688-50432710 CACCTGGGTCTGAGGGAGGAGGG - Intergenic
1167671900 19:50858383-50858405 CTCCTAGGTCTGAGGGAGGAGGG + Intronic
1167690690 19:50982595-50982617 CCCCTAGGTCTGAGGGAGGAGGG - Intronic
1167690743 19:50982781-50982803 CTCCTAGGTCTGAGGGAGGAGGG - Intronic
1167690867 19:50983145-50983167 CTCCTAGGTCTGAGGGAGGAGGG - Intronic
1168238092 19:55076073-55076095 CTCCTAGGTCTGAGGGAGGAGGG + Intronic
1168238767 19:55078932-55078954 CTCCTGGGTCTGATGGAGGAGGG + Intronic
1168252279 19:55147652-55147674 CACCTGGGTCTGAGGGAGGAGGG + Intronic
1168277257 19:55284828-55284850 CTCCTAGGTCTGAGGGAGGAGGG + Intronic
1168293671 19:55369087-55369109 CTCCTAGGTCTGAGGGAGGAAGG + Intronic
1168294880 19:55373534-55373556 CTCCTGTGTCTGAAGGAGGAGGG - Intergenic
1168325774 19:55537655-55537677 CTCCTAGGTCTGAGGGAGGAGGG - Intergenic
1168325900 19:55538105-55538127 CTCCTGGGCCTGATGGAGGAGGG + Intergenic
1168325913 19:55538143-55538165 CTCCTAGGTCTGAGGGAGGAGGG + Intergenic
925708035 2:6709084-6709106 TACATATGACTATTGGAGGAAGG - Intergenic
926145123 2:10392531-10392553 CAACTATGACTGAAAGAGCAGGG - Intronic
926408571 2:12578878-12578900 CATCCATGACTGATGGATGCAGG + Intergenic
927389090 2:22572796-22572818 CTCCTCTGACTTAAGGAGGATGG - Intergenic
928094293 2:28394269-28394291 GAGTTATGACTGATGGAGAACGG - Intronic
928379715 2:30807314-30807336 CAGGTGTGTCTGATGGAGGAGGG + Exonic
929115246 2:38438476-38438498 CACCTATAACTGTTGGAGCAGGG - Intergenic
931141458 2:59462969-59462991 CAGCAATGACTGCTGAAGGAAGG - Intergenic
932239556 2:70146124-70146146 TCCCATTGACTGATGGAGGAGGG + Intergenic
933950457 2:87324837-87324859 CTTCTATGACTGCTGGGGGATGG - Intergenic
934496436 2:94804943-94804965 TACCTAGGGCTGAGGGAGGAAGG + Intergenic
935744550 2:106179120-106179142 CACCTGTGCCTGATGCATGATGG - Intronic
936329321 2:111533742-111533764 CTTCTATGACTGCTGGGGGATGG + Intergenic
936489481 2:112957885-112957907 CACGCATGGCTGATGGAGGTTGG + Intergenic
938635754 2:133224472-133224494 CACATATGACTGTTGTAGTAGGG - Intronic
938769716 2:134490724-134490746 CTCCTATGATAGATGGAGGCTGG + Intronic
943369478 2:187000639-187000661 CACCTTTGCCTCATGGAGCATGG + Intergenic
944085248 2:195838406-195838428 CACCTTTGTCTCATGGAGGATGG - Intronic
944306796 2:198188473-198188495 CACTTATCACTGATACAGGAGGG + Intronic
947041360 2:225924675-225924697 CACCCATGACTGAGGGAAGGAGG - Intergenic
1169344472 20:4819551-4819573 AACCAATGACTGATGGGAGAAGG - Intronic
1170788951 20:19491893-19491915 AACTAATCACTGATGGAGGAAGG - Intronic
1173013240 20:39201300-39201322 CAGAAATGCCTGATGGAGGAAGG - Intergenic
1174218214 20:48933287-48933309 CAACGATGACAGAAGGAGGACGG - Intronic
1174832967 20:53830479-53830501 CACCCATGTCTGATGATGGAGGG - Intergenic
1175606887 20:60318396-60318418 CACCTCCGCCTGATGAAGGAAGG + Intergenic
1177681051 21:24371602-24371624 CACCTCTGAGTGGTAGAGGAGGG - Intergenic
1178766282 21:35454414-35454436 CAACTGTGAAAGATGGAGGAAGG - Intronic
950176659 3:10879535-10879557 AACCTGTGATTGAGGGAGGAGGG - Intronic
950426794 3:12928635-12928657 CACCAAGGACTGATTGGGGAAGG - Intronic
952185654 3:30965588-30965610 CACCTATCACTGAAGTAGGTAGG - Intergenic
955054840 3:55445984-55446006 CACCTGTGACTCCTGGAGGGTGG + Intergenic
955085228 3:55696322-55696344 CAACAATGACTTATGGAAGAAGG - Intronic
956278984 3:67536400-67536422 CGCCTATCACCAATGGAGGAGGG - Intronic
957797522 3:85030856-85030878 CAACCATGACTGATACAGGATGG - Intronic
957964384 3:87303876-87303898 CACCTTTGCCTAATGGGGGATGG + Intergenic
962944020 3:140151270-140151292 TACCTTTGACCTATGGAGGAAGG + Intronic
962968466 3:140376284-140376306 CATCTATAGCTGATGGAGGTGGG - Intronic
967048262 3:185757396-185757418 CAGATATGACTCATGGAGAAAGG - Intronic
967546650 3:190737822-190737844 CAGCTTTGACTGAGAGAGGATGG + Intergenic
969668579 4:8576380-8576402 CACCAATGGCTGATGGAGCTAGG - Intronic
972963905 4:44486490-44486512 CACCTACAACTGCTGAAGGAGGG - Intergenic
976500762 4:85786370-85786392 CTCCTATGAATGAAAGAGGATGG - Intronic
976878761 4:89891746-89891768 CAGATATGTCTTATGGAGGAAGG + Intronic
990299162 5:54433574-54433596 CCCCTAAGTCAGATGGAGGAAGG - Intergenic
994088780 5:95789756-95789778 CTACTATGACTGAAGGAGGGAGG - Intronic
998072094 5:139205900-139205922 CAGCTTTCACTCATGGAGGAAGG - Intronic
998467704 5:142358721-142358743 CACCTAGAAATGATGGAGCAGGG + Intergenic
999952835 5:156668819-156668841 CTCCTCTGAGTCATGGAGGAGGG + Intronic
1001985376 5:176070103-176070125 GACCTACGACTGATGTAGGGAGG + Intronic
1002829037 6:802195-802217 CACCTGTTTCTGATGGAGGTAGG - Intergenic
1006047204 6:31308147-31308169 GACCAATGACAGAGGGAGGAAGG - Intronic
1007702813 6:43774354-43774376 CACCCATGGCAGAAGGAGGAGGG + Exonic
1008788851 6:55204198-55204220 AACCTATGACTCATGGAAGTTGG + Intronic
1008974723 6:57411188-57411210 GAGCTTTTACTGATGGAGGAAGG - Intronic
1010765052 6:79769574-79769596 CACCTCTGAGAGATGGATGAAGG + Intergenic
1018218287 6:161552024-161552046 AACGTATGAGTGATGAAGGAAGG + Intronic
1019782025 7:2946271-2946293 CTTCTATGACTGAAGGAGGTTGG + Intronic
1021119539 7:16783036-16783058 CACATATGACGGAGGCAGGAAGG - Intronic
1022478597 7:30728126-30728148 CACCTCTGACAGAAGGGGGAAGG - Intronic
1026235807 7:68526294-68526316 CTCCAATAACTTATGGAGGAAGG + Intergenic
1035157413 7:156925558-156925580 CCCCTTAGACTCATGGAGGAAGG - Intergenic
1035374445 7:158398150-158398172 CTCCTATGAATGATGAATGACGG - Intronic
1036384552 8:8267569-8267591 CACCTATTCATGATGAAGGAAGG + Intergenic
1037629643 8:20642606-20642628 CTGCTATGACTGATGGAAGTAGG + Intergenic
1046064573 8:109181282-109181304 CTCCTAGGCCTGAAGGAGGAAGG - Intergenic
1047386941 8:124418548-124418570 CACCTGTGCCTAATGGATGATGG + Intergenic
1047488148 8:125351390-125351412 CACCCATGAGGGATGGAGCAAGG - Intronic
1051153472 9:14112996-14113018 CACCTGTTGCTGATGTAGGAAGG + Exonic
1053137177 9:35658490-35658512 CAGCTAGGGCTGCTGGAGGAGGG + Intronic
1053660709 9:40275504-40275526 TACCTAGGGCTGAGGGAGGAAGG - Intronic
1053911085 9:42904849-42904871 TACCTAGGGCTGAGGGAGGAAGG - Intergenic
1054372832 9:64421721-64421743 TACCTAGGGCTGAGGGAGGAAGG - Intergenic
1054523901 9:66100780-66100802 TACCTAGGGCTGAGGGAGGAAGG + Intergenic
1054680459 9:67911497-67911519 TACCTAGGGCTGAGGGAGGAAGG - Intergenic
1057612366 9:96556906-96556928 CGCCTATTATTGATGGAAGAGGG + Intronic
1060491205 9:124085963-124085985 CACCTTTGACTGATGGTGACGGG - Intergenic
1061178361 9:129010420-129010442 CTCCGATGGGTGATGGAGGAAGG - Intronic
1187647787 X:21367901-21367923 CCCCTACAACTGATGGAGGGGGG + Intergenic
1187758969 X:22558870-22558892 GACCGATGACTGATGGAAGCTGG - Intergenic
1189295344 X:39913848-39913870 CTGCTTTGACTAATGGAGGATGG - Intergenic
1190057145 X:47187572-47187594 CTCCTATGACTGTTGCAGGGTGG - Intergenic
1191182753 X:57580328-57580350 CACCTTTCACTGAGGGTGGATGG - Intergenic
1192099423 X:68248177-68248199 CATCTCTGGCTGCTGGAGGAGGG + Intronic
1192208501 X:69111520-69111542 CCCCTATGAATGAGGGAGGGAGG + Intergenic
1192388714 X:70701741-70701763 CACTTGTGATTGATGGAAGAAGG + Intronic
1195007511 X:100700950-100700972 CATCTGTGTCTGATGAAGGAGGG + Exonic
1196079680 X:111618151-111618173 AATCTAGGACTGATGGGGGAAGG + Intergenic
1200767142 Y:7089801-7089823 CAGCGAGGACTGATGGAGGTGGG - Intronic