ID: 901942956

View in Genome Browser
Species Human (GRCh38)
Location 1:12677808-12677830
Sequence AAGTGTTTGGACCTCTCCCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 128
Summary {0: 1, 1: 0, 2: 2, 3: 5, 4: 120}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
901942956_901942962 6 Left 901942956 1:12677808-12677830 CCAGGGGAGAGGTCCAAACACTT 0: 1
1: 0
2: 2
3: 5
4: 120
Right 901942962 1:12677837-12677859 ATTGCATCTTGGTACTGGAATGG 0: 1
1: 0
2: 1
3: 7
4: 139
901942956_901942958 -5 Left 901942956 1:12677808-12677830 CCAGGGGAGAGGTCCAAACACTT 0: 1
1: 0
2: 2
3: 5
4: 120
Right 901942958 1:12677826-12677848 CACTTCTGCCCATTGCATCTTGG 0: 1
1: 6
2: 21
3: 45
4: 217
901942956_901942963 13 Left 901942956 1:12677808-12677830 CCAGGGGAGAGGTCCAAACACTT 0: 1
1: 0
2: 2
3: 5
4: 120
Right 901942963 1:12677844-12677866 CTTGGTACTGGAATGGCCAAAGG 0: 1
1: 0
2: 0
3: 8
4: 118
901942956_901942959 1 Left 901942956 1:12677808-12677830 CCAGGGGAGAGGTCCAAACACTT 0: 1
1: 0
2: 2
3: 5
4: 120
Right 901942959 1:12677832-12677854 TGCCCATTGCATCTTGGTACTGG 0: 1
1: 1
2: 1
3: 13
4: 68

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
901942956 Original CRISPR AAGTGTTTGGACCTCTCCCC TGG (reversed) Intergenic
900646509 1:3711207-3711229 ACGTGTGTGGAGCGCTCCCCAGG - Intronic
901942956 1:12677808-12677830 AAGTGTTTGGACCTCTCCCCTGG - Intergenic
903216218 1:21844545-21844567 AAGTGTCTAGACCTCAGCCCTGG - Intronic
905531091 1:38679294-38679316 AAGTGGTTGGACTTCTCCCATGG - Intergenic
907744511 1:57199383-57199405 AGGTGTTTGCACCTCTCTCTGGG - Intronic
908444192 1:64186460-64186482 AACTGTCTGTACCTCTCCGCAGG - Intergenic
908705269 1:66947088-66947110 GATTTTTTGGACCTCTCCCCCGG + Intronic
909474699 1:76069790-76069812 AACTGTTAGGCCCTCTCCCCTGG + Intergenic
912474775 1:109928486-109928508 ATGTCTTTGGACCCCTCCTCAGG - Intronic
918087056 1:181254688-181254710 CCGTGTATAGACCTCTCCCCAGG - Intergenic
924233275 1:241979831-241979853 AAGTTTGTGGACCTCTGCTCTGG + Intergenic
1063839404 10:10052883-10052905 GAGTGTTAGGACGTCTGCCCAGG - Intergenic
1070396759 10:76017804-76017826 ATGTGTTTGCACATCTGCCCTGG - Intronic
1070515952 10:77206632-77206654 AAGTTTTTGGCCATCTCCACTGG + Intronic
1073151696 10:101316063-101316085 CAGTGTCTGGGCCCCTCCCCAGG + Intergenic
1073520952 10:104128648-104128670 AAGTATTTGCACCCCTACCCTGG + Intergenic
1075172781 10:120131353-120131375 AACTGCTTGGAGCTGTCCCCTGG - Intergenic
1075419958 10:122293430-122293452 AGGTGTCTGGACCTCTCTGCAGG + Intronic
1082276098 11:50223132-50223154 AAGTGTTTATAGCTGTCCCCAGG - Intergenic
1083145082 11:60752087-60752109 AAATGTTTGAACTTCACCCCTGG - Intergenic
1085055126 11:73398839-73398861 ATGTGTATGTACCTCTGCCCAGG - Intergenic
1089489910 11:118876356-118876378 AAGTGTGAGGAGCACTCCCCTGG + Intergenic
1096196171 12:49650146-49650168 AGGTGTTTGGACTTCACCCTAGG - Intronic
1098445079 12:70558154-70558176 AAGTGTTTAGAGTTCTGCCCTGG + Intronic
1105464947 13:20631175-20631197 TATTCTTTGGACCTCTCCCTAGG - Intronic
1105944554 13:25178074-25178096 AAGTGTTTAGAGTCCTCCCCTGG - Intergenic
1106768428 13:32939162-32939184 GAGTGTCTGGATGTCTCCCCAGG + Intergenic
1107977705 13:45705912-45705934 CAGTGTTTGGACATCTCTTCTGG + Intronic
1108642702 13:52397387-52397409 AAGTGAATGGTCCTCTTCCCAGG + Exonic
1110010773 13:70331141-70331163 AAATGTTTAGAGTTCTCCCCTGG - Intergenic
1111139209 13:84092007-84092029 AGGTGTTTGGATCTATCCCCAGG - Intergenic
1111572791 13:90108555-90108577 AAGTGTTTGGATCCTCCCCCTGG + Intergenic
1113546119 13:111152881-111152903 AGGTGTTTGGACCTTACCCACGG - Intronic
1114254788 14:20992385-20992407 TAGTGTTTGTAAGTCTCCCCAGG + Intronic
1117507488 14:56417643-56417665 GAGAGTATGGACCACTCCCCAGG + Intergenic
1118546737 14:66898279-66898301 AAGTCTTTGGACCTTTGCCTAGG - Intronic
1122862999 14:104591020-104591042 AGGGGATTGGGCCTCTCCCCAGG - Intronic
1128511570 15:68316771-68316793 GAGTGTTTGGACATCAGCCCTGG - Intronic
1129737206 15:77973069-77973091 AAATGCTGTGACCTCTCCCCAGG - Intergenic
1129848872 15:78780566-78780588 AAATGCTGTGACCTCTCCCCAGG + Intronic
1139758697 16:69166611-69166633 AAGTGACTGGAGTTCTCCCCAGG - Intronic
1140264525 16:73408807-73408829 AGGTGTTTGGTCCTCTCCCATGG + Intergenic
1141412539 16:83845341-83845363 CACTGTTGGGTCCTCTCCCCAGG + Intergenic
1146367691 17:32242019-32242041 AAGTGCTTTGACCTCTTGCCAGG + Intronic
1148917877 17:50998462-50998484 AAGGCTTTGGACTTATCCCCAGG + Exonic
1150014166 17:61536686-61536708 TTGAATTTGGACCTCTCCCCAGG - Intergenic
1153450751 18:5225555-5225577 AAGTGTTAGAATTTCTCCCCTGG + Intergenic
1160177668 18:76609124-76609146 AAGTGTTTGGTCCTAGTCCCTGG - Intergenic
1160835687 19:1123488-1123510 AAGGGTTTGAACCTGTCCCAGGG + Intronic
1161013859 19:1973548-1973570 GAGTGCTTGGCCCTGTCCCCAGG + Intronic
1167159226 19:47756460-47756482 AAGGGCCTGGACCTCTCCTCGGG - Intronic
1168712927 19:58512068-58512090 CAGTGGCTGGTCCTCTCCCCAGG + Intronic
925468595 2:4134807-4134829 AAGAGTATTCACCTCTCCCCTGG + Intergenic
929069841 2:38019238-38019260 AAGTGTTTGTACCACTCTGCCGG - Intronic
929648960 2:43658644-43658666 AAGTGTGTGGATGTCTCCACAGG + Intronic
929994748 2:46818226-46818248 AAGTGTTTCAACCTCACCCTGGG - Exonic
932075813 2:68661664-68661686 CAGTGTTTTGGCCTCCCCCCGGG - Intergenic
932418641 2:71588487-71588509 AAGAATTTCAACCTCTCCCCAGG - Intronic
934738673 2:96703448-96703470 TAGTTTTAGGACCTCTTCCCGGG - Intergenic
934740728 2:96720224-96720246 AGATGTTTGGGCCTCACCCCTGG - Intronic
936239841 2:110777829-110777851 AAGTGGTGTGGCCTCTCCCCAGG - Intronic
936538394 2:113330007-113330029 CTGTGTTTGGACCTCTCCTGGGG - Intergenic
941653292 2:168116691-168116713 AAATGTTTGCCCCTCTGCCCTGG - Intronic
943280097 2:185921248-185921270 AGGTATTTGCTCCTCTCCCCTGG + Intergenic
1171069239 20:22050348-22050370 AACTGTGTGGACCACTCTCCTGG - Intergenic
1175127898 20:56766056-56766078 CAGGGTTTGACCCTCTCCCCTGG - Intergenic
1179104091 21:38383252-38383274 GAGTCTTTGGATCTCTTCCCCGG + Exonic
1179651252 21:42810572-42810594 AAGTGTTTCCTCCTCACCCCTGG - Intergenic
949236323 3:1813328-1813350 AAATCTATGGACCTCGCCCCAGG - Intergenic
950522996 3:13507441-13507463 AAGTGTTTGGACCTGTTTGCAGG + Intergenic
952754222 3:36851980-36852002 AAGTGTTTCAATCTTTCCCCTGG - Intronic
954677620 3:52324485-52324507 CAGGGTTTGTGCCTCTCCCCTGG + Intronic
955436559 3:58906150-58906172 AAGTGTTTAGAACTCTGCCTAGG + Intronic
967896068 3:194397047-194397069 ACGTGTTTGGGGCTCTGCCCCGG - Exonic
969281604 4:6174595-6174617 CAGTGTTGCGACCTCTCCACAGG - Intronic
970642470 4:18082386-18082408 AAGTGCTTGGATTTCTTCCCTGG + Intergenic
971585043 4:28394686-28394708 AAGTGTGTGGTACCCTCCCCCGG + Intronic
975878369 4:78870761-78870783 AAGTGTTTGGACCTGTCTTTAGG + Exonic
983106710 4:163695130-163695152 AAGTGTTTGCACCTCTGAACAGG - Intronic
983811422 4:172066940-172066962 AACTTTTTGGACTTCTCCCTGGG + Intronic
984407392 4:179350572-179350594 AAATGTTAGGACTTCTCTCCAGG + Intergenic
987049419 5:14136732-14136754 AAGTGATGGGACCCCTGCCCAGG - Intergenic
987340419 5:16935332-16935354 AAGTGTTTGAACCCCTGCACAGG + Intronic
987697952 5:21356103-21356125 AAGTGTGTGGAACTTCCCCCCGG - Intergenic
988772999 5:34450525-34450547 AAGTGTTTGGAGTTCTCCCCTGG - Intergenic
991742490 5:69696280-69696302 AAGTGTGTGGAACTTCCCCCCGG + Intergenic
991755204 5:69858924-69858946 AAGTGTGTGGAACTTCCCCCCGG - Intergenic
991794064 5:70276018-70276040 AAGTGTGTGGAACTTCCCCCCGG + Intergenic
991821880 5:70571593-70571615 AAGTGTGTGGAACTTCCCCCCGG + Intergenic
991834531 5:70734072-70734094 AAGTGTGTGGAACTTCCCCCCGG - Intergenic
991886441 5:71275560-71275582 AAGTGTGTGGAACTTCCCCCCGG + Intergenic
995049419 5:107685174-107685196 CAGTAAATGGACCTCTCCCCAGG + Intergenic
999189716 5:149738121-149738143 AAGTGTTAGGACATCACTCCTGG + Intronic
1000846014 5:166281081-166281103 ATGTGGTTGGTCCTCTCCACAGG - Intergenic
1001126986 5:169028657-169028679 AAATGTATGGACCTCTTCCTAGG - Intronic
1001947117 5:175788471-175788493 AGGTGCTTGGTCCCCTCCCCTGG - Intergenic
1003235123 6:4288633-4288655 AAGAGTGTGGGCCTCTTCCCAGG - Intergenic
1003320002 6:5043003-5043025 GAGTGTATGACCCTCTCCCCAGG - Intergenic
1003787088 6:9498532-9498554 AAGTGAATGGACCCCTCCTCTGG - Intergenic
1004522811 6:16378221-16378243 AACTGATTGTACCACTCCCCTGG + Intronic
1004642447 6:17528591-17528613 GAGTTTTTTGACCTTTCCCCTGG + Intronic
1005261861 6:24069761-24069783 GAGGGTTTGGAGTTCTCCCCCGG - Intergenic
1005552899 6:26942297-26942319 AAGTGTGTGGAACTTCCCCCTGG + Intergenic
1008290293 6:49706585-49706607 AAATGCTTGGACCTTTACCCAGG - Intronic
1010688512 6:78879610-78879632 AAGTGCTTGGACTTCTATCCTGG - Intronic
1024801562 7:53086114-53086136 CAGTTTATAGACCTCTCCCCAGG + Intergenic
1029903559 7:104067893-104067915 AAGTTTTTGCTCCTCTCTCCAGG + Intergenic
1030067649 7:105672782-105672804 AAGTGTTTCTTCCTCTCCCTAGG - Intronic
1031916047 7:127564032-127564054 AAGTGTATGGAACCCTCCCTGGG + Intergenic
1034500449 7:151447413-151447435 AGGTGTTGGGACCGCACCCCAGG - Intergenic
1035589485 8:802091-802113 AGGTGTGTGGACCATTCCCCAGG - Intergenic
1036661307 8:10710912-10710934 AAGTCATTGCACCTCTCCACTGG + Intronic
1036770795 8:11577322-11577344 AAGTGGTGGGACCCCTCGCCGGG + Intergenic
1043499746 8:80841031-80841053 ATGTGGTTGGACTTCTCTCCTGG - Intronic
1047151172 8:122264794-122264816 AAGTGTTTGGAGTTCTCCCCTGG + Intergenic
1048046869 8:130780929-130780951 GGGTGTTTGGACCCCTCCCTGGG + Intronic
1051268933 9:15335926-15335948 ACGTGTTAGGGCCTATCCCCAGG - Intergenic
1056185024 9:84126024-84126046 AAGTGTTTGGCACCATCCCCTGG - Intergenic
1056709222 9:88977153-88977175 AAGAGTGTGGACTTCACCCCAGG + Intergenic
1057294679 9:93828147-93828169 AAGGGGTGGGACCCCTCCCCAGG - Intergenic
1060878384 9:127099834-127099856 AAGCATTTGGACCTTTTCCCTGG - Intronic
1186724692 X:12344811-12344833 AAGTGTATGGAGATCTCCCGTGG + Intronic
1188386195 X:29561736-29561758 GTGCGTTGGGACCTCTCCCCTGG + Intronic
1191185151 X:57603504-57603526 AAGGGTTTGGAGTCCTCCCCTGG + Intergenic
1192746839 X:73947280-73947302 AAGTGTTTTGCCTTCTCCCAAGG - Intergenic
1195749860 X:108152957-108152979 AACTGTTTTGTCATCTCCCCAGG + Exonic
1197376013 X:125682628-125682650 CAGCATTTGGACCTCTTCCCTGG + Intergenic
1197819899 X:130531738-130531760 AGGGGGTGGGACCTCTCCCCAGG - Intergenic