ID: 901945811

View in Genome Browser
Species Human (GRCh38)
Location 1:12702640-12702662
Sequence CAGGGCAAACAGCAGGTGGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
901945811_901945817 -9 Left 901945811 1:12702640-12702662 CCCTCCACCTGCTGTTTGCCCTG No data
Right 901945817 1:12702654-12702676 TTTGCCCTGGGAAGCCGACCTGG No data
901945811_901945822 5 Left 901945811 1:12702640-12702662 CCCTCCACCTGCTGTTTGCCCTG No data
Right 901945822 1:12702668-12702690 CCGACCTGGATGGACCCCATTGG No data
901945811_901945819 -5 Left 901945811 1:12702640-12702662 CCCTCCACCTGCTGTTTGCCCTG No data
Right 901945819 1:12702658-12702680 CCCTGGGAAGCCGACCTGGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
901945811 Original CRISPR CAGGGCAAACAGCAGGTGGA GGG (reversed) Intergenic
No off target data available for this crispr