ID: 901946837

View in Genome Browser
Species Human (GRCh38)
Location 1:12711115-12711137
Sequence CCTTCCACTCATGACTTTTG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
901946837_901946840 3 Left 901946837 1:12711115-12711137 CCTCAAAAGTCATGAGTGGAAGG No data
Right 901946840 1:12711141-12711163 TCTTTTTCCTTTCTTAATTCAGG No data
901946837_901946842 20 Left 901946837 1:12711115-12711137 CCTCAAAAGTCATGAGTGGAAGG No data
Right 901946842 1:12711158-12711180 TTCAGGACATCCTCTCTTGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
901946837 Original CRISPR CCTTCCACTCATGACTTTTG AGG (reversed) Intergenic
No off target data available for this crispr