ID: 901949146

View in Genome Browser
Species Human (GRCh38)
Location 1:12727515-12727537
Sequence GAGCCTCCAGAAGACCAAGT GGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 187
Summary {0: 1, 1: 0, 2: 1, 3: 7, 4: 178}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
901949146_901949152 13 Left 901949146 1:12727515-12727537 CCCACTTGGTCTTCTGGAGGCTC 0: 1
1: 0
2: 1
3: 7
4: 178
Right 901949152 1:12727551-12727573 TTAGTGGTCTTTACAGGCCAAGG 0: 1
1: 0
2: 0
3: 5
4: 90
901949146_901949150 -3 Left 901949146 1:12727515-12727537 CCCACTTGGTCTTCTGGAGGCTC 0: 1
1: 0
2: 1
3: 7
4: 178
Right 901949150 1:12727535-12727557 CTCTGATCTTGGTTGGTTAGTGG 0: 1
1: 0
2: 0
3: 10
4: 109
901949146_901949153 19 Left 901949146 1:12727515-12727537 CCCACTTGGTCTTCTGGAGGCTC 0: 1
1: 0
2: 1
3: 7
4: 178
Right 901949153 1:12727557-12727579 GTCTTTACAGGCCAAGGTCAAGG 0: 1
1: 0
2: 3
3: 29
4: 205
901949146_901949151 7 Left 901949146 1:12727515-12727537 CCCACTTGGTCTTCTGGAGGCTC 0: 1
1: 0
2: 1
3: 7
4: 178
Right 901949151 1:12727545-12727567 GGTTGGTTAGTGGTCTTTACAGG 0: 1
1: 0
2: 0
3: 9
4: 77
901949146_901949149 -10 Left 901949146 1:12727515-12727537 CCCACTTGGTCTTCTGGAGGCTC 0: 1
1: 0
2: 1
3: 7
4: 178
Right 901949149 1:12727528-12727550 CTGGAGGCTCTGATCTTGGTTGG 0: 1
1: 0
2: 0
3: 18
4: 176

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
901949146 Original CRISPR GAGCCTCCAGAAGACCAAGT GGG (reversed) Exonic
900537815 1:3187456-3187478 GAGCCACCAGGAGAGCAGGTGGG - Intronic
901217161 1:7561312-7561334 GAGCCTCCAGGAGCCCAGCTGGG + Intronic
901949146 1:12727515-12727537 GAGCCTCCAGAAGACCAAGTGGG - Exonic
903281330 1:22251630-22251652 GAACTTCCAGAAGAGCAAGCAGG + Intergenic
905993200 1:42358079-42358101 GATTCTGCAGAAGACCCAGTAGG + Intergenic
906073394 1:43034353-43034375 GAGTACCCAGAAGGCCAAGTAGG + Intergenic
906187150 1:43870871-43870893 GAGCATGGAGAAGGCCAAGTGGG + Intronic
906921289 1:50067330-50067352 AAGCCTGCAGAGGAACAAGTAGG + Intronic
908097999 1:60760743-60760765 GAGCCTCCAGAAGCAAAAGCTGG - Intergenic
909885094 1:80931340-80931362 GAGCCTCCAGAAGACTATCAGGG + Intergenic
915108878 1:153550407-153550429 AGGCCCCCAGAATACCAAGTGGG + Intergenic
917539938 1:175902388-175902410 GGGACTCCCGAAGCCCAAGTGGG - Intergenic
918160545 1:181894869-181894891 GAACCTACAGAAGAACAATTGGG - Intergenic
918445111 1:184609546-184609568 GAGGCTCCAGTCTACCAAGTGGG + Intronic
922741324 1:228015852-228015874 GAAGCCCCAGAAGCCCAAGTGGG + Intronic
923929455 1:238677346-238677368 GAGCCTCCAGATGTCTAAATAGG + Intergenic
924523496 1:244826305-244826327 GACCCTCCAGGACAACAAGTGGG + Intergenic
1063498875 10:6535709-6535731 GAGACTTCAAAAGACCAAGAGGG - Intronic
1064019285 10:11796349-11796371 GAGCCTCCAGGGGACCGAGGTGG - Intergenic
1065242101 10:23716582-23716604 GAGCCTCCAGAGGGAGAAGTTGG - Intronic
1066564854 10:36710748-36710770 GTGACTCCATAAGCCCAAGTGGG - Intergenic
1067292017 10:44950474-44950496 GAGCCTCCAGCAGCCCATGGGGG + Intergenic
1067897656 10:50201369-50201391 GCTACTCCAGAAGCCCAAGTGGG - Intronic
1068163649 10:53300263-53300285 GAGCATCCAGAAGACACAATGGG - Intergenic
1069958061 10:72063589-72063611 GAGCCTGCAGGAAAGCAAGTGGG - Intronic
1070761011 10:79024459-79024481 GAGCCTGCAGAAGAAGAGGTTGG + Intergenic
1073100803 10:101005691-101005713 GAGGCTTGAGGAGACCAAGTGGG + Exonic
1073449312 10:103600348-103600370 GACCCTCGGGAAGACCAGGTTGG + Exonic
1073703619 10:105957959-105957981 GAGCCACCAAACAACCAAGTAGG - Intergenic
1075182544 10:120224948-120224970 GTGACTCCTGAAGCCCAAGTGGG + Intergenic
1077611646 11:3646576-3646598 GAGCCTCTAGAAAGCCAAGGAGG + Intronic
1078715403 11:13834626-13834648 GTGCCTCCAGAGGACAAGGTGGG - Intergenic
1079745439 11:24122560-24122582 GAGGCTCTGGAAGACTAAGTGGG - Intergenic
1081473829 11:43404532-43404554 TAGGCTCCAGAAGAGCAAGGGGG - Intronic
1084115356 11:67039960-67039982 GACCCTCCGGAAGTCCCAGTCGG + Exonic
1085423112 11:76380765-76380787 GAACCTGAAGAAGGCCAAGTCGG + Exonic
1086488611 11:87335533-87335555 CAGCCTCCGAAATACCAAGTAGG + Intergenic
1086573055 11:88306868-88306890 GAGACTCCTGAAGCCCAAGTGGG - Intronic
1087979461 11:104593251-104593273 GAGGCTCCAGTAGACCAGGAGGG + Intergenic
1088088473 11:106009193-106009215 TGGCCTTCAGAAGACCAATTTGG - Exonic
1093424301 12:19010868-19010890 GAGACTCCTGAAGCCCAAGAGGG - Intergenic
1093712228 12:22340214-22340236 GCGACTCCCGAAGCCCAAGTGGG - Intronic
1095748136 12:45682367-45682389 GCGACTCCTGAAGCCCAAGTGGG - Intergenic
1096429728 12:51532789-51532811 GAGATTCCAGAAGAACAGGTGGG + Intergenic
1102203741 12:111075855-111075877 TAGTCTCCATCAGACCAAGTGGG + Intronic
1106055664 13:26234263-26234285 GAACCTGAAGAAGACCAAGTTGG - Intergenic
1107821756 13:44292190-44292212 GAGCCTCCAGAAGCCGAGGGAGG + Intergenic
1107930588 13:45304044-45304066 GAGACTGGAGAAGACCATGTAGG - Intergenic
1108254685 13:48598799-48598821 GTGACTCCCGAAGCCCAAGTGGG - Intergenic
1109204578 13:59467168-59467190 GAGACTCCTGAAGCCCAAGTGGG - Intergenic
1109495002 13:63158107-63158129 GAGCCTGCAGAAGAAAGAGTCGG - Intergenic
1113594655 13:111522368-111522390 CAGCCTCAAGAAGAGCCAGTGGG - Intergenic
1118721642 14:68598721-68598743 GTGCCTCCAGAAGACGGAGGCGG + Intronic
1119320639 14:73728206-73728228 GGGCCTTAAGAAGACCAACTTGG - Intronic
1121081122 14:91109237-91109259 GAGTCTCCAGAAGCACAACTAGG - Intronic
1121091948 14:91189026-91189048 GAGCCTCCAGAAGAGACAGATGG + Exonic
1124902051 15:33833037-33833059 GAGTCTCCATAGGACCACGTAGG + Intronic
1125377337 15:39044095-39044117 GAGACTCCAGAAGCCTAAGAGGG - Intergenic
1126276943 15:46894869-46894891 GTGACTCCCGAAGCCCAAGTTGG + Intergenic
1127874873 15:63103477-63103499 GAGCCTCCAGAAGGGTAACTTGG + Intergenic
1131026360 15:89145477-89145499 GAGCCTTCAGAAGAACTAGATGG + Intronic
1133401949 16:5494587-5494609 CTGCCTCCAGAAGACCTCGTGGG - Intergenic
1133702074 16:8318084-8318106 GAGACTCTAGAAGACAAAGAAGG - Intergenic
1137786499 16:51141606-51141628 GAACCTCCAGAGCACCAAGGTGG - Exonic
1139328011 16:66166902-66166924 GTGACTCCTGAAGCCCAAGTGGG + Intergenic
1141710860 16:85698254-85698276 GGGGCTCCTGAAGACCAACTAGG - Intronic
1142302320 16:89265893-89265915 GAGACTCCAGCAGACCAGGGTGG + Intergenic
1142689806 17:1598724-1598746 AAGACTCCAGAAGACCAGGCAGG - Intronic
1142881088 17:2883143-2883165 CAGCCCCCAGGAGACCACGTGGG + Intronic
1146059320 17:29596254-29596276 CAGCCTCCAGCAGAGCAATTTGG - Intronic
1146227409 17:31078901-31078923 GAGCAGCCAGAAGGCCAGGTTGG - Intergenic
1148533296 17:48415934-48415956 GAGTTTTCAGAAGCCCAAGTTGG + Intronic
1152076830 17:78164988-78165010 ATGCCTCCAGGAGACCAAGGTGG + Intronic
1153219523 18:2848954-2848976 GCTCCTCCAGAAGCCCACGTGGG - Intronic
1157329352 18:46692200-46692222 GAGCCTCCAGATGTGCAAATGGG - Exonic
1158188265 18:54796253-54796275 GTGACTCCTGAAGTCCAAGTGGG + Intronic
1160056966 18:75492387-75492409 GAGACTCCAGCAGAACAAGCAGG + Intergenic
1160977446 19:1800303-1800325 GAAGCTCCAGAAGACGAAGAAGG + Exonic
1164498217 19:28789042-28789064 AAGCCTTCAGAATTCCAAGTTGG + Intergenic
1164649730 19:29883017-29883039 GAGCCTCCAGGTGACCAAAGTGG - Intergenic
1167304495 19:48699442-48699464 GAACTTCCAGAAGCCAAAGTGGG - Intronic
927109947 2:19857548-19857570 CAGACCCCAGAAGAACAAGTCGG + Intergenic
929773230 2:44910579-44910601 AAGCCTCCAGAATGCCAAGAGGG + Intergenic
929936128 2:46296064-46296086 GAGCCTGGAGAAGGCGAAGTGGG - Intronic
932614411 2:73222915-73222937 TGAACTCCAGAAGACCAAGTCGG - Intronic
932750014 2:74365603-74365625 GAGCCTCCTGGAGAAGAAGTTGG - Exonic
933221702 2:79697367-79697389 GAGTTTCCAGAAGAACATGTGGG - Intronic
935909516 2:107880142-107880164 GAGGGTCCAGAAAACCAAATTGG - Intronic
936480119 2:112878202-112878224 GAGGCTCCAGAAGAAAATGTGGG - Intergenic
938549926 2:132370615-132370637 AAGGCTCCTGAAGCCCAAGTGGG + Intergenic
943494152 2:188598701-188598723 GAGCTTTCAGAAGAACATGTTGG + Intergenic
943737883 2:191377429-191377451 AAGTCTCCAGAAGAGGAAGTGGG - Intronic
946962305 2:224997915-224997937 GGGCTACCAGAAGACCAAGCAGG + Intronic
948351644 2:237345759-237345781 GTTCCTGCAGAAGACCAAGCAGG - Intronic
948757373 2:240167447-240167469 GAGGCTCCAGGAGGCCAAGGAGG - Intergenic
1173163647 20:40671036-40671058 GAGTTTCCAGAACAGCAAGTAGG - Intergenic
1175168373 20:57062497-57062519 GTGACTCCCGAAGCCCAAGTAGG + Intergenic
1176065143 20:63190526-63190548 GAGCCTCCACAGGGCCAAGCGGG + Intergenic
1176065156 20:63190571-63190593 GAGCCTCCACAGGGCCAAGCGGG + Intergenic
1176269227 20:64227032-64227054 GACCCTACAGAAGTCCAAGCTGG + Intronic
1179233883 21:39528375-39528397 GAGCTTCAAGAAGACAAAGAAGG + Intergenic
1181091097 22:20473148-20473170 GAGCCCCTGGAAGACCAATTAGG + Intronic
1181508596 22:23378665-23378687 GAGCTGCCAGGAGCCCAAGTAGG - Intergenic
1182444167 22:30380531-30380553 GAGCCTTCAGAAGAGGAAGCTGG - Intronic
1183329307 22:37210974-37210996 GATCCTCAAGAAGCCCAAGAGGG + Intronic
1184534349 22:45076575-45076597 GAGGAGCCAGAAGACCAAGCAGG + Intergenic
951189363 3:19749960-19749982 GATCCTCTAGGAGACCACGTTGG - Intergenic
955182012 3:56681909-56681931 TACCATCTAGAAGACCAAGTTGG + Intronic
955748986 3:62168713-62168735 GTGACTCCTGAAGCCCAAGTGGG + Intronic
956743172 3:72290845-72290867 GAGCCTGCAGAGGAACAAATGGG - Intergenic
958159719 3:89802757-89802779 GAGCTTACAGAACACCAACTAGG + Intergenic
959723530 3:109518582-109518604 TAGCCTCTAGGAGAACAAGTTGG - Intergenic
959965343 3:112347636-112347658 GACCTTCCAGAAGACCATGGGGG - Exonic
961624026 3:128247026-128247048 GACCCTAGAGAACACCAAGTAGG + Exonic
961644281 3:128384337-128384359 GAGCCTCCAGAAGACCTCATGGG + Intronic
964247142 3:154666786-154666808 GTGACTCCTGAAGCCCAAGTGGG + Intergenic
965284874 3:166805764-166805786 GAGGGTCCAGAGAACCAAGTTGG + Intergenic
965420815 3:168456097-168456119 GCGACTCCTGAAGCCCAAGTGGG + Intergenic
965849653 3:173009228-173009250 CATCCTCCAGGAGGCCAAGTTGG + Intronic
967358821 3:188606277-188606299 GATCCTTGAGAAGACCTAGTTGG + Intronic
968448753 4:665379-665401 GAGGCTCCTGAGGACCAAGAGGG - Intronic
971407398 4:26334979-26335001 GAGCCTGCAGAACAACCAGTAGG - Intronic
971948003 4:33306263-33306285 GGGACTCCTGAAGCCCAAGTGGG - Intergenic
972415311 4:38833225-38833247 GAGCCTCCAGGAGATTTAGTTGG - Intronic
973221295 4:47730504-47730526 GTGGCTCCTGAAGCCCAAGTGGG - Intronic
977441232 4:97070546-97070568 GTGACTCCTGAAGCCCAAGTGGG - Intergenic
981685002 4:147444375-147444397 GAGTCTCCAAAAATCCAAGTTGG + Intergenic
983141426 4:164154678-164154700 GAGACTCCCAAAGCCCAAGTGGG + Intronic
983645935 4:169991604-169991626 GAGCATGCAGATGACCAAGAGGG - Exonic
984461118 4:180038143-180038165 GAGGCTGCAGAAGACAAACTTGG + Intergenic
984822649 4:183896000-183896022 GAGTTTCCAGAAGGCCAAGGAGG + Intronic
989719156 5:44504219-44504241 GCGACTCCTGAAGCCCAAGTGGG - Intergenic
992210791 5:74477892-74477914 GCGACTCCCGAAGTCCAAGTGGG + Intergenic
992323262 5:75635275-75635297 GAGCCTCCAGGAGACCTCATGGG - Intronic
994266788 5:97726281-97726303 GAGCCTCCAGTGGTCAAAGTTGG - Intergenic
998492851 5:142562332-142562354 GAGCCTCCAGAAAAGGAACTTGG - Intergenic
1000005907 5:157184801-157184823 GGGCTTTCAGAAGACCAAGGTGG - Intronic
1001651659 5:173320269-173320291 GAGCCCCCAGAAGCCCAGGGCGG + Intronic
1002762688 6:214251-214273 GAGGCTCCTGAAGCCCAAGTGGG - Intergenic
1006414947 6:33897986-33898008 GAATATCCAGAAAACCAAGTCGG - Intergenic
1006990457 6:38210925-38210947 GTCCCTCCTGAACACCAAGTGGG + Intronic
1010503755 6:76631856-76631878 GAGACTCCAGAAGTCCAAGTGGG + Intergenic
1012277850 6:97295342-97295364 GAGCTTACAGAATACCAAATTGG - Intergenic
1014867532 6:126550616-126550638 GTGACTCCTGAAGCCCAAGTAGG + Intergenic
1016073145 6:139764696-139764718 GAGGCTGCAGAAGCACAAGTGGG + Intergenic
1016366646 6:143325853-143325875 TTGCCTCCAGAAGACCTAGCTGG - Intronic
1022044107 7:26609740-26609762 AAGCCAGCAGAAGACCAAGGAGG - Intergenic
1022828520 7:34041258-34041280 AAGTCTCCAGAAGACCCTGTGGG - Intronic
1023535985 7:41211553-41211575 GAGCCACCAGAAGATGAAGGAGG + Intergenic
1026482223 7:70789429-70789451 GAGCTTCCAGAAAGCCAAGATGG - Intronic
1027534184 7:79375589-79375611 GAGTTTCCTGAAGACCAAATGGG - Intronic
1027888353 7:83938013-83938035 GACACTCCTGAAGCCCAAGTAGG - Intergenic
1028726320 7:94091780-94091802 GATACACCAGAAGAGCAAGTTGG + Intergenic
1030905523 7:115176567-115176589 TAGGCTCCTGGAGACCAAGTGGG + Intergenic
1033506072 7:142001744-142001766 GCTCCACCAGAACACCAAGTCGG + Intronic
1033738851 7:144252371-144252393 GAGCCTCCAGAAGGCCACTGCGG + Intergenic
1033744196 7:144298583-144298605 GAGCCTCCAGAAGGCCACTGCGG - Intergenic
1033881263 7:145886906-145886928 GTGACTCCTGAAGCCCAAGTAGG + Intergenic
1034985785 7:155514548-155514570 AAGTATTCAGAAGACCAAGTTGG - Intronic
1039605712 8:38878626-38878648 GAGCATGTAGAAGGCCAAGTGGG + Intergenic
1040835004 8:51722384-51722406 GAGACTCCTGAAGCCCAAGTGGG + Intronic
1041571532 8:59342944-59342966 TAGCCTCCAGCAGAGTAAGTGGG - Intergenic
1042024727 8:64410993-64411015 GTGCCCCCAGAAGAACAAATTGG + Intergenic
1043363113 8:79499195-79499217 GAGCTTCCAGAGGAAGAAGTAGG - Intergenic
1044113376 8:88303592-88303614 GAGCCTTCAGAAGAAGGAGTAGG + Intronic
1044364639 8:91329427-91329449 GATGCTCCAGAAGAACAAGGGGG - Intronic
1046848354 8:118944224-118944246 GAGTCTTCAGCAGACCAACTAGG - Intronic
1048459754 8:134611627-134611649 GAGCCATCAGAAGACCCAGCAGG - Intronic
1048531458 8:135253884-135253906 GTGACTCCTGAAGCCCAAGTAGG - Intergenic
1048731079 8:137441765-137441787 GTGACTCCTGAAGCCCAAGTGGG + Intergenic
1048845056 8:138598022-138598044 GGGTCTCCAGAAGACCATATGGG + Intronic
1056260172 9:84840885-84840907 GTGCCTCCAACAGGCCAAGTAGG - Intronic
1059596934 9:115730925-115730947 GAGACTCCAGAGGAACAAGAGGG + Intergenic
1060375037 9:123109965-123109987 GGGTCTACTGAAGACCAAGTTGG - Intronic
1060547484 9:124469859-124469881 TAGCCTGCAGGAGACAAAGTAGG + Intronic
1060847192 9:126846951-126846973 GAGCCACCAGGAGCCCAGGTAGG + Intergenic
1061387131 9:130296912-130296934 GACCCTGCAGGAGGCCAAGTGGG + Intronic
1186445785 X:9627261-9627283 GAGCTCCATGAAGACCAAGTAGG - Intronic
1187310701 X:18138547-18138569 AAGCTTCAAGAACACCAAGTGGG + Intergenic
1187707830 X:22025207-22025229 GTGACTCCCGAAGCCCAAGTGGG + Intergenic
1190363218 X:49668173-49668195 GAACCTCCAGAGCACCAAGGTGG - Intergenic
1196513726 X:116545910-116545932 GAGCTTCCAGAAGAAGAAGTAGG - Intergenic
1199255979 X:145719347-145719369 GAGCCTCCAGAACATCACCTTGG + Intergenic
1200063246 X:153492879-153492901 CAGCCTCCAGGAGTCCCAGTGGG - Intronic
1202232584 Y:22671446-22671468 GAGCCTCCAGATGACTGGGTGGG + Intergenic
1202310572 Y:23524712-23524734 GAGCCTCCAGATGACTGGGTGGG - Intergenic
1202560230 Y:26145882-26145904 GAGCCTCCAGATGACTGGGTGGG + Intergenic