ID: 901955446

View in Genome Browser
Species Human (GRCh38)
Location 1:12781793-12781815
Sequence GCTGCTACCAAAACAAAAGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
901955446_901955451 21 Left 901955446 1:12781793-12781815 CCAGCTTTTGTTTTGGTAGCAGC No data
Right 901955451 1:12781837-12781859 TTTTCTGTTTTCCAAGTTAATGG 0: 30
1: 11
2: 6
3: 72
4: 813
901955446_901955453 27 Left 901955446 1:12781793-12781815 CCAGCTTTTGTTTTGGTAGCAGC No data
Right 901955453 1:12781843-12781865 GTTTTCCAAGTTAATGGAATGGG No data
901955446_901955452 26 Left 901955446 1:12781793-12781815 CCAGCTTTTGTTTTGGTAGCAGC No data
Right 901955452 1:12781842-12781864 TGTTTTCCAAGTTAATGGAATGG No data
901955446_901955447 -3 Left 901955446 1:12781793-12781815 CCAGCTTTTGTTTTGGTAGCAGC No data
Right 901955447 1:12781813-12781835 AGCCACTGATTTACCCATACAGG 0: 5
1: 12
2: 23
3: 17
4: 107

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
901955446 Original CRISPR GCTGCTACCAAAACAAAAGC TGG (reversed) Intergenic
No off target data available for this crispr