ID: 901957346

View in Genome Browser
Species Human (GRCh38)
Location 1:12796168-12796190
Sequence TCCAGCTGGTCTCAAACTGC TGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 35667
Summary {0: 1, 1: 21, 2: 372, 3: 4667, 4: 30606}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
901957342_901957346 25 Left 901957342 1:12796120-12796142 CCAAAATTTTTATTAAAGACAAT 0: 5
1: 0
2: 6
3: 100
4: 981
Right 901957346 1:12796168-12796190 TCCAGCTGGTCTCAAACTGCTGG 0: 1
1: 21
2: 372
3: 4667
4: 30606

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
901957346 Original CRISPR TCCAGCTGGTCTCAAACTGC TGG Exonic
Too many off-targets to display for this crispr