ID: 901957346 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 1:12796168-12796190 |
| Sequence | TCCAGCTGGTCTCAAACTGC TGG |
| Strand | + |
| Crispr in exon? | Yes |
| Crispr in intron? | No |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | 35667 | |||
| Summary | {0: 1, 1: 21, 2: 372, 3: 4667, 4: 30606} |
Found 1 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 901957342_901957346 | 25 | Left | 901957342 | 1:12796120-12796142 | CCAAAATTTTTATTAAAGACAAT | 0: 5 1: 0 2: 6 3: 100 4: 981 |
||
| Right | 901957346 | 1:12796168-12796190 | TCCAGCTGGTCTCAAACTGCTGG | 0: 1 1: 21 2: 372 3: 4667 4: 30606 |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 901957346 | Original CRISPR | TCCAGCTGGTCTCAAACTGC TGG | Exonic | ||
| Too many off-targets to display for this crispr | |||||