ID: 901970127

View in Genome Browser
Species Human (GRCh38)
Location 1:12901796-12901818
Sequence CTCCTTCACCAACTGGAAAT AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 191
Summary {0: 2, 1: 0, 2: 1, 3: 7, 4: 181}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
901970123_901970127 -5 Left 901970123 1:12901778-12901800 CCAGTGATCATCGAAACCCTCCT 0: 2
1: 0
2: 0
3: 2
4: 59
Right 901970127 1:12901796-12901818 CTCCTTCACCAACTGGAAATAGG 0: 2
1: 0
2: 1
3: 7
4: 181
901970122_901970127 17 Left 901970122 1:12901756-12901778 CCAAATGGTAGGGCATGAAGGTC 0: 3
1: 2
2: 1
3: 3
4: 70
Right 901970127 1:12901796-12901818 CTCCTTCACCAACTGGAAATAGG 0: 2
1: 0
2: 1
3: 7
4: 181

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
901970127 Original CRISPR CTCCTTCACCAACTGGAAAT AGG Intronic
900688895 1:3967339-3967361 CTCCTTCCTCATCTGGAAAATGG + Intergenic
901970127 1:12901796-12901818 CTCCTTCACCAACTGGAAATAGG + Intronic
902015044 1:13299985-13300007 CTCCTTCACCAACTGGAAATAGG - Intergenic
902702622 1:18182984-18183006 CTCCTTCACCCGCTGCAAACTGG + Intronic
903073036 1:20737383-20737405 CTCCTTATCCATCAGGAAATGGG + Intergenic
903229918 1:21915303-21915325 CCCCTTCTCCCACTGGGAATGGG + Intronic
905122385 1:35691790-35691812 CTCCTTCTCCTACTCCAAATTGG + Intergenic
905222786 1:36460433-36460455 CTGCTTCCTCATCTGGAAATGGG - Intronic
905746982 1:40426492-40426514 CTGGTTGACCAGCTGGAAATTGG + Intergenic
907939393 1:59072866-59072888 CTCCTTAATCAACTGCGAATGGG - Intergenic
908065310 1:60396898-60396920 CACCTTCCTCATCTGGAAATTGG + Intergenic
908590376 1:65625797-65625819 CATATTCACAAACTGGAAATAGG + Intronic
909464502 1:75958230-75958252 CTCTTCCACCATCAGGAAATTGG + Intergenic
910702428 1:90090643-90090665 TTCCTTTACCAACTGGTAATTGG - Intergenic
910863230 1:91763914-91763936 GTCCTTCACCATTTGGGAATTGG + Intronic
913368534 1:118070139-118070161 CTCCTTCAACAAGTTGAAGTTGG - Intronic
913658573 1:120985296-120985318 CTGTTTCATCAAATGGAAATGGG - Intergenic
914009937 1:143768416-143768438 CTGTTTCATCAAATGGAAATGGG - Intergenic
914523185 1:148436540-148436562 CTGTTTCATCAAATGGAAATGGG - Intergenic
914648558 1:149677077-149677099 CTGTTTCATCAAATGGAAATGGG - Intergenic
915203172 1:154248995-154249017 CTCTTTCCTCATCTGGAAATAGG - Intronic
923993954 1:239470564-239470586 AACCTTAACCAACTGGAAACAGG + Intronic
1065917609 10:30366100-30366122 CTCCTGCACCGACTGGTAGTGGG - Intronic
1066100110 10:32110182-32110204 CTCCTTCCCCATCTACAAATAGG + Intergenic
1066279241 10:33898920-33898942 CTCCTTGACCAACTACAAGTAGG - Intergenic
1067078049 10:43199183-43199205 CTTCTTCACCACCTGGAAGGTGG + Exonic
1067708841 10:48632711-48632733 TTCCAACACCAACTGCAAATTGG + Intronic
1068661784 10:59630090-59630112 TTCCTTCACCAATCGCAAATCGG + Intergenic
1069979910 10:72245188-72245210 CTCCTCCTCCAACTGCAAAGGGG + Intergenic
1070589641 10:77792685-77792707 CTCCTTCACCAGCAAGAAACTGG + Intronic
1070777876 10:79120593-79120615 CTCATTCCCCATCTGGAAACAGG + Intronic
1071277107 10:84065423-84065445 CCCCTGCAGCAACTAGAAATGGG + Intergenic
1071541588 10:86489768-86489790 CCTCTTTACCACCTGGAAATGGG + Intronic
1072474406 10:95745916-95745938 CTCCCTGACTACCTGGAAATAGG + Intronic
1072902783 10:99424029-99424051 CTCCTTCGCCAGCTGGGATTTGG + Intronic
1075736388 10:124666953-124666975 CTCCTTTACCAGCTGGCATTGGG + Intronic
1077031002 11:467289-467311 GTCCTTCAGGAACTGGAAACAGG + Intronic
1082115463 11:48323696-48323718 CTCCTCAACCAACTGAAATTAGG + Intergenic
1083417689 11:62536087-62536109 CTCCTTCTCCATCTGGAATGAGG + Exonic
1085321132 11:75574796-75574818 CTCCCCCACCAAGTGGGAATGGG + Intergenic
1086395583 11:86412031-86412053 CTCCTTGACCAACTAAAAGTAGG - Intronic
1086535127 11:87835261-87835283 CTCTGCCACCAACTGGAACTAGG + Intergenic
1086989088 11:93283090-93283112 CACCTTCCCCAACTGAAAACAGG + Intergenic
1087149316 11:94844371-94844393 ATCCTTAACCAACTGGATTTGGG - Intronic
1087647752 11:100827925-100827947 CTCCTTCACCACATGGGAGTGGG + Intronic
1095995988 12:48085162-48085184 CTTCTCCACCACCAGGAAATTGG - Intronic
1096109572 12:49020841-49020863 TTCCTTCTCCATCTGGACATGGG - Exonic
1096214148 12:49790308-49790330 CTCCTTCCCCAGAAGGAAATAGG + Intergenic
1102996436 12:117354969-117354991 CTTCATTTCCAACTGGAAATGGG + Intronic
1104445174 12:128827005-128827027 CTCCTCTACCAACTGCAAAGTGG - Intergenic
1106564868 13:30875419-30875441 GTCCTTCAGCAACTAGATATCGG + Intergenic
1108060423 13:46527557-46527579 CTCTTTCCTCAACTGTAAATAGG + Intergenic
1110939946 13:81337460-81337482 CTGCTTCACCAACCTGACATGGG - Intergenic
1111017254 13:82397552-82397574 CTCCTTCACCCACTGGCATAGGG + Intergenic
1111306390 13:86418763-86418785 CTTCTTCAGCTTCTGGAAATGGG - Intergenic
1115285973 14:31712838-31712860 CTCCTTGACCAACTAAAATTGGG + Intronic
1116177102 14:41485278-41485300 CTGCTTCAACATCTGGAAAGAGG - Intergenic
1117417086 14:55507186-55507208 CTCCTTGACCAACAAGTAATGGG - Intergenic
1118732587 14:68678845-68678867 CTCCTTCACTCACTGATAATTGG - Intronic
1119841397 14:77795934-77795956 CCCCTTCAACTACTGGGAATGGG - Intergenic
1121442947 14:93960102-93960124 CTCCTTCACCAAGTGGACTGGGG - Intronic
1121644908 14:95511166-95511188 CTGCTTCCCCCACTGGAAAATGG + Intergenic
1125936810 15:43644140-43644162 CTGCTTCCACAACTGGATATTGG - Intronic
1125949622 15:43740929-43740951 CTACTTCCACAACTGGATATTGG - Intergenic
1126321161 15:47425301-47425323 CTCACTCACCAACTGCAGATAGG - Intronic
1129863683 15:78885027-78885049 CTCCTTCAGGAACAGGAAAAAGG - Exonic
1130104929 15:80921994-80922016 GTCCTTCCCCAACAGGAAACTGG + Exonic
1131114468 15:89785394-89785416 CTCCTTCACCCACTTGATGTTGG + Exonic
1131601363 15:93852338-93852360 CTTCCTCATCAATTGGAAATGGG + Intergenic
1132289012 15:100686326-100686348 CTCCTTCTCCAGCTGGAGAGTGG + Intergenic
1132312815 15:100869646-100869668 CACCTTCACCAACTAGGAGTTGG - Intergenic
1132593238 16:735637-735659 CTCAGGCACCAACTGGATATGGG + Intronic
1136239943 16:28937510-28937532 CTCCTTCTCCAACGGTAACTTGG + Exonic
1140598096 16:76440140-76440162 CTATTTCATCAACTGGAAAGGGG - Intronic
1142735380 17:1895244-1895266 CTCCTTCCTCATCTGAAAATGGG - Intronic
1148333600 17:46826625-46826647 CTGCTTCATCAACTGCAAAATGG + Intronic
1150142005 17:62738200-62738222 TTCCATCACTTACTGGAAATAGG - Intronic
1150488099 17:65558072-65558094 CTCCATCACCGACTGGATCTCGG + Exonic
1150960020 17:69902624-69902646 CTCCTTCCCCATCTGTAAAGTGG - Intergenic
1155670893 18:28369909-28369931 CATCTTCACCAACTGCAAAGGGG + Intergenic
1156694591 18:39751860-39751882 CTCCTTCACCTTCTTGAAGTGGG + Intergenic
1158416889 18:57256700-57256722 GCTCTTCACCCACTGGAAATAGG + Intergenic
1158984706 18:62802140-62802162 TTCCATCAACAACTGGAAAAAGG - Intronic
1163713834 19:18862868-18862890 CCCATTCACCAGCTGGAAGTTGG + Intronic
1165604394 19:37087943-37087965 CTCCTTCAAAAGCTAGAAATCGG - Intronic
926593300 2:14762334-14762356 CTGCTTCATCAACTGCAAATTGG + Intergenic
927763195 2:25779555-25779577 CTCCTTCAACATCTGTAAAAAGG + Intronic
928713400 2:34032715-34032737 AACTTTCACCAACTGGAAAGAGG + Intergenic
930585018 2:53258284-53258306 CTCCTTAACTCACTGAAAATTGG + Intergenic
931506793 2:62937322-62937344 CACTTTCTCCAACTGTAAATTGG + Intronic
932769683 2:74493563-74493585 CTCATTCACCAACTAGAGCTTGG + Exonic
932998993 2:76897734-76897756 CTCCTTCAGTGACTGGAACTTGG + Intronic
934140185 2:89039366-89039388 CTCCCTGACCAACTGAAATTAGG - Intergenic
934229052 2:90161171-90161193 CTCCCTGACCAACTGAAATTAGG + Intergenic
935221478 2:101018384-101018406 ACCCTTAACCAACTGCAAATTGG + Intronic
935493687 2:103752212-103752234 CTCCTCCACCAAGAGGAATTGGG + Intergenic
936712885 2:115153281-115153303 CCCCTTTCCCAACAGGAAATTGG - Intronic
937623867 2:124022241-124022263 CTACTTCACCATTTGGAAAGTGG + Intergenic
938008761 2:127811411-127811433 CTCATTCACATACTGGAAAACGG - Intergenic
938040542 2:128072432-128072454 CTTCTCCACCAATTGGTAATAGG - Intergenic
938386727 2:130872108-130872130 CTCCTTCCTCTGCTGGAAATAGG + Intronic
940025264 2:149199992-149200014 CTCCTCCTCCAAAGGGAAATTGG - Intronic
940801150 2:158134390-158134412 CTCCTCTAAGAACTGGAAATAGG + Intronic
943556267 2:189408176-189408198 ATCCTTCACTTACTTGAAATGGG - Intergenic
944506156 2:200413626-200413648 GTCCTTGACAAACTGTAAATAGG - Intronic
944856008 2:203767504-203767526 TTCCTTGACCAACTGAAATTAGG - Intergenic
946284500 2:218692888-218692910 CTCCCTCACCAACTGGCCATGGG - Intronic
946918135 2:224547948-224547970 CTTCTTCCCCATCTAGAAATAGG + Intronic
946938108 2:224742757-224742779 CTCCCTAACCAACTGAAATTAGG - Intergenic
947462701 2:230317316-230317338 CTCCTTCACCCAAAGGAACTGGG + Intergenic
948934222 2:241151745-241151767 CTCCTTGACTAACAGGACATGGG - Intronic
1171095039 20:22324818-22324840 CAAGTTAACCAACTGGAAATTGG + Intergenic
1171801779 20:29627259-29627281 CTCCTTCAACACGTGGGAATGGG + Intergenic
1173240273 20:41289392-41289414 CTCATTCATGAACTAGAAATGGG - Intronic
1178484277 21:33007459-33007481 CACATTCAGCAACTTGAAATTGG - Intergenic
1181713311 22:24705440-24705462 CACCTAAACCAACAGGAAATGGG + Intergenic
1183117265 22:35701597-35701619 GTACTTTACCTACTGGAAATTGG + Intergenic
1184847235 22:47096429-47096451 CTCAATCACAAACTGGAAAAAGG - Intronic
950273407 3:11638412-11638434 TTCCTTCACAAACTGTAATTAGG + Intronic
954942979 3:54392146-54392168 CTGCTTCTCCACCTGGAATTGGG - Intronic
959352351 3:105281648-105281670 CTCAATTACCAAGTGGAAATTGG + Intergenic
962431451 3:135324219-135324241 CTCCTTGCCCAACTGGCATTTGG - Intergenic
963922724 3:150921531-150921553 CTCCTTCCCTACCTGGAATTTGG + Intronic
966666844 3:182480986-182481008 CTCCCTCTCCAACAGGAAAATGG + Intergenic
967090908 3:186134015-186134037 CTCCTTCAACACCAGGAAATTGG + Intronic
968424811 4:516073-516095 TTCCTTCCACAACTGGGAATAGG - Exonic
970472078 4:16388937-16388959 CTCCTTCAACAAGAGGATATGGG + Intergenic
971539723 4:27800909-27800931 GTCCTGAACCAACTGGTAATAGG + Intergenic
972179354 4:36444241-36444263 GTACTTTACCAACTGGAACTGGG + Intergenic
972789853 4:42360896-42360918 GTCAGTCACCAAATGGAAATAGG + Intergenic
972912575 4:43836230-43836252 CTCTTCCACTAACTGCAAATAGG - Intergenic
975315433 4:72946594-72946616 CTCCTTTATCCTCTGGAAATGGG + Intergenic
978003123 4:103581392-103581414 CTTCTTCTCCCTCTGGAAATTGG - Intergenic
981045302 4:140259244-140259266 CTCAGTGACCAACTGGACATGGG - Intronic
981907005 4:149932783-149932805 CTCGTTCACTACCTGGATATTGG + Intergenic
983435650 4:167711589-167711611 TTCCTTAACCAGCTGGAATTGGG - Intergenic
983667222 4:170195734-170195756 GTACTTTAACAACTGGAAATGGG - Intergenic
984325056 4:178241463-178241485 CTGCTCCACCAACTGGGAAGAGG - Intergenic
985952813 5:3236427-3236449 TTCCTTCATCCACTGGGAATAGG - Intergenic
987137586 5:14914138-14914160 CTGCCTCACCAGCAGGAAATAGG - Intergenic
987675120 5:21064004-21064026 CAACTTCTCCAACTTGAAATGGG + Intergenic
988001611 5:25357443-25357465 TTCCTTCACCCTCAGGAAATAGG - Intergenic
988586397 5:32511260-32511282 CTCCTTCACCAGCTGGGTACTGG - Intergenic
990266053 5:54076940-54076962 CTCCTTCAGCAACTGCTAAGAGG - Intronic
990798133 5:59567274-59567296 CACCTTTAGCAACTGGACATTGG - Intronic
991954482 5:71979014-71979036 CTCCTCCACCAACAGGCAAATGG - Intergenic
993733176 5:91446299-91446321 CACCTTCACTAACTGGATAGAGG - Intergenic
995600486 5:113790367-113790389 CTCCTTAACCAATTACAAATCGG - Intergenic
997603540 5:135156652-135156674 CTCCTTCCCATGCTGGAAATGGG + Intronic
1005021610 6:21423853-21423875 CTCCTGCCCCAACTCGAAAGGGG + Intergenic
1005828404 6:29650611-29650633 CCCCCTCACCAAATGGGAATGGG - Intergenic
1006537987 6:34715680-34715702 CTTCTCCACCATCAGGAAATTGG - Intergenic
1011164856 6:84435048-84435070 CTCCTTTCCCAGGTGGAAATAGG + Intergenic
1012907163 6:105080858-105080880 TTCCTTCACCTTATGGAAATAGG + Exonic
1015069497 6:129074257-129074279 CTCCTTCACCACTTAGAAATTGG + Intronic
1015464754 6:133536319-133536341 CTACTTTATCTACTGGAAATTGG - Intergenic
1016550916 6:145279033-145279055 CTCTTTCCACAATTGGAAATTGG + Intergenic
1020520608 7:9181255-9181277 CTCCTTCACAAACTGCAAATCGG - Intergenic
1021539773 7:21744632-21744654 CTCCAACACCAACTGGGTATTGG + Intronic
1022405549 7:30086526-30086548 CTCCTCTACCCACTGGAAGTTGG - Intronic
1023284094 7:38601435-38601457 CCCCTTCACAAAATGGAACTTGG - Intronic
1024136624 7:46415267-46415289 TTCCTTAACCAATTGCAAATTGG + Intergenic
1025058834 7:55786843-55786865 CACCTTCACCTTCTGGAAAAGGG - Intergenic
1026463576 7:70634993-70635015 CCCCTTCACCATCTGTAAAGAGG + Intronic
1030100431 7:105940793-105940815 GTTCAGCACCAACTGGAAATAGG - Intronic
1030492418 7:110254542-110254564 CTTCTGCAGGAACTGGAAATAGG + Intergenic
1031966304 7:128030730-128030752 CTCCTTCTCCAGATGGAAAGAGG - Exonic
1032081833 7:128863005-128863027 CTTCTCCACCACCAGGAAATTGG - Exonic
1032700699 7:134376375-134376397 TTCTTTCACCAAATGAAAATGGG + Intergenic
1033143256 7:138847022-138847044 CTCCTTCAAGAACTGTAAACCGG + Intronic
1039123532 8:34175456-34175478 ATCATTCTCCACCTGGAAATGGG + Intergenic
1047120788 8:121902227-121902249 CACTTGCACCAACTGGAAATAGG - Intergenic
1047322923 8:123805305-123805327 CTGTTTCATCAAATGGAAATGGG - Exonic
1047403473 8:124565544-124565566 CTCATTCTCAAACAGGAAATGGG - Intronic
1047453652 8:124989466-124989488 CTCCATCATCAAATGGAAGTAGG + Intergenic
1048790893 8:138102292-138102314 CTCCTTAATTAACTGGCAATCGG - Intergenic
1048983818 8:139719231-139719253 CACCTTCTCCAAATGGTAATTGG - Intergenic
1050082449 9:1929181-1929203 CTACTTCACAAACTTAAAATTGG - Intergenic
1052747694 9:32456756-32456778 CTCCTTAACCTACTGTAAACTGG - Exonic
1054738624 9:68781460-68781482 GTTCTTCATCAAATGGAAATCGG - Exonic
1055642704 9:78332790-78332812 CTTCTTCCCCAAATGGAACTTGG + Intergenic
1057173020 9:92975186-92975208 CACCTTCTCCAACTGGCATTTGG - Intronic
1057706026 9:97395809-97395831 CTCCTCCTCCACCTGCAAATTGG - Intergenic
1060110422 9:120902718-120902740 CTCCTTCACCAGCTGGATCTGGG + Exonic
1185769644 X:2755805-2755827 AGCCATCACCAGCTGGAAATGGG + Intronic
1186548959 X:10482008-10482030 CTCCTCAACCAAATGAAAATGGG + Intronic
1187136873 X:16556398-16556420 CTCCTTGACCAACTAAAATTGGG - Intergenic
1187642836 X:21313614-21313636 TTCCTCAGCCAACTGGAAATAGG - Intergenic
1189486070 X:41433191-41433213 CTCCTTCATCCACTGGAGCTGGG + Intergenic
1192084370 X:68081214-68081236 TTCCTTCACCAACTATAATTGGG + Intronic
1193105026 X:77661547-77661569 CTTCTTTGCCAACTGGGAATAGG - Intronic