ID: 901973741

View in Genome Browser
Species Human (GRCh38)
Location 1:12928420-12928442
Sequence CCCAGCTGGTCTGAAACTGC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 34757
Summary {0: 2, 1: 11, 2: 263, 3: 3044, 4: 31437}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
901973741 Original CRISPR CCCAGCTGGTCTGAAACTGC TGG Intronic
Too many off-targets to display for this crispr